ID: 1125641129

View in Genome Browser
Species Human (GRCh38)
Location 15:41231373-41231395
Sequence CGGCACGGCGATGGGTTCTC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 49
Summary {0: 1, 1: 0, 2: 0, 3: 3, 4: 45}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125641116_1125641129 14 Left 1125641116 15:41231336-41231358 CCGTCTCTTCTGGCGCCGCTGCT 0: 1
1: 0
2: 0
3: 16
4: 147
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641113_1125641129 24 Left 1125641113 15:41231326-41231348 CCTCCTGTCGCCGTCTCTTCTGG 0: 1
1: 0
2: 1
3: 10
4: 119
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641112_1125641129 25 Left 1125641112 15:41231325-41231347 CCCTCCTGTCGCCGTCTCTTCTG 0: 1
1: 0
2: 2
3: 15
4: 196
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641115_1125641129 21 Left 1125641115 15:41231329-41231351 CCTGTCGCCGTCTCTTCTGGCGC 0: 1
1: 0
2: 0
3: 3
4: 58
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641111_1125641129 29 Left 1125641111 15:41231321-41231343 CCTTCCCTCCTGTCGCCGTCTCT 0: 1
1: 0
2: 1
3: 40
4: 630
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641123_1125641129 -10 Left 1125641123 15:41231360-41231382 CCGGAGGAGCTCCCGGCACGGCG 0: 1
1: 0
2: 0
3: 8
4: 102
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641122_1125641129 -9 Left 1125641122 15:41231359-41231381 CCCGGAGGAGCTCCCGGCACGGC 0: 1
1: 0
2: 1
3: 18
4: 146
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45
1125641119_1125641129 -1 Left 1125641119 15:41231351-41231373 CCGCTGCTCCCGGAGGAGCTCCC 0: 1
1: 0
2: 0
3: 26
4: 238
Right 1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG 0: 1
1: 0
2: 0
3: 3
4: 45

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125641129 Original CRISPR CGGCACGGCGATGGGTTCTC GGG Exonic
901770773 1:11529408-11529430 CGGCATGGGGATTTGTTCTCAGG - Intronic
903539083 1:24086654-24086676 CCGCAAGGCGATGGGTTCGCTGG + Exonic
906140697 1:43531848-43531870 CGGCACGGCGATGGGGAGCCGGG - Intronic
906192670 1:43908065-43908087 GGGCACAGCGCTGGGTTCTAGGG + Intronic
906314233 1:44775946-44775968 CGGCCCGGCGCGGGGGTCTCCGG + Intronic
911052348 1:93681602-93681624 CGGCGCGGCGCTGGGCGCTCGGG + Intronic
912385619 1:109269865-109269887 GGGCACGGGGCTGGGTGCTCAGG + Intronic
913186054 1:116372293-116372315 CAGCACAGCCTTGGGTTCTCTGG - Intergenic
913701747 1:121381089-121381111 CTGCACGGGCATGGGCTCTCTGG - Intronic
914042307 1:144061558-144061580 CTGCACGGGCATGGGCTCTCTGG - Intergenic
914135782 1:144898930-144898952 CTGCACGGGCATGGGCTCTCTGG + Intronic
920489171 1:206399809-206399831 CTGCACGGGCATGGGCTCTCTGG - Intronic
924415227 1:243850481-243850503 CGGCGCGGGGAGGGGTTCTGCGG + Intronic
1076872869 10:133202163-133202185 CGCCCGGGCGATGGGTTCACAGG + Intronic
1078478568 11:11656465-11656487 GGGCACGGGGATGGGTTCAGAGG - Intergenic
1081872484 11:46389747-46389769 CGGCTCCGCGCGGGGTTCTCGGG + Intergenic
1082790150 11:57341602-57341624 CAGAACGGGGATGGGCTCTCGGG - Intronic
1083778346 11:64905693-64905715 GGGGACGGGGATGGGCTCTCAGG - Intronic
1106000537 13:25719109-25719131 CGACACGGAGATGGATTCACAGG - Intronic
1112601417 13:100859105-100859127 CGGCACGGCAATGCCTCCTCTGG - Intergenic
1118736644 14:68705882-68705904 CGGCAGGATGATGGGTACTCAGG - Intronic
1122302219 14:100737683-100737705 CGGCACCGCGCTGGGCTCCCTGG - Exonic
1125641129 15:41231373-41231395 CGGCACGGCGATGGGTTCTCGGG + Exonic
1132560270 16:590282-590304 CGGCGCGGCCATGGGCTCGCAGG + Exonic
1132926122 16:2429793-2429815 CGGGGCGGCGATCGGGTCTCGGG + Intronic
1133071419 16:3249121-3249143 CGGCATGGGGAGGGGTGCTCAGG + Intronic
1142328221 16:89432372-89432394 TGCCACGGCGATGGGTCCTGAGG - Intronic
1152205122 17:78970533-78970555 CGGCGGGGCGATCGGGTCTCTGG - Intergenic
1157283946 18:46364481-46364503 CGGCATCACGAAGGGTTCTCTGG - Intronic
1161959360 19:7515323-7515345 CGGCCCGGCGTAGGGTTCTCCGG + Intronic
1162871383 19:13589333-13589355 CGGCAGGGAGGTGGGTACTCCGG + Intronic
1163738216 19:18994814-18994836 TGGCCCGGCTATGGGTTCCCGGG + Intronic
926006242 2:9375367-9375389 CGGCACGGAGAGGGGTACTGGGG + Intronic
933762933 2:85686087-85686109 CAGCACTGAGATGAGTTCTCTGG - Intronic
948874773 2:240820565-240820587 CGGCCCGGCGAGGGGTCCGCGGG - Intergenic
1175889330 20:62309459-62309481 CTGCACGGCCATGGGCTCTGGGG + Exonic
1179925604 21:44532467-44532489 CAGGACGGTGATGAGTTCTCAGG - Intronic
950746690 3:15096108-15096130 CGGCACTGCCATGGCTTCTCTGG - Exonic
953046577 3:39298382-39298404 GGCCAGGCCGATGGGTTCTCAGG - Intergenic
968599695 4:1503172-1503194 CTGCACCGCGATGGCTTCGCTGG + Intergenic
985103701 4:186482181-186482203 AGGCACTGCGATGGTTTCTGAGG - Intronic
985889233 5:2702567-2702589 CGAGACGGCGAAGGGATCTCGGG + Intergenic
1002629582 5:180562143-180562165 CGGCACAGGGATGAGTTCCCTGG - Intronic
1008932539 6:56955189-56955211 CGGGAGGGCGCTGGGCTCTCAGG - Intronic
1018061544 6:160093410-160093432 TGGCACAGTGATGGGGTCTCAGG + Intronic
1019425761 7:975809-975831 CGGCACCGCTATGTGTCCTCGGG - Intergenic
1047754262 8:127906634-127906656 CGGGAAGGCAATGGATTCTCCGG - Intergenic
1055806979 9:80106880-80106902 AGGCACGGTGTTGGGTTCTAAGG + Intergenic
1059755938 9:117293560-117293582 CAGAACGACAATGGGTTCTCAGG - Intronic