ID: 1125656487

View in Genome Browser
Species Human (GRCh38)
Location 15:41361899-41361921
Sequence CTCCTGGCACATTTGGGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 238
Summary {0: 1, 1: 0, 2: 1, 3: 16, 4: 220}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125656481_1125656487 -3 Left 1125656481 15:41361879-41361901 CCATACCTGAGATGAAGTTGCTC 0: 1
1: 0
2: 2
3: 19
4: 190
Right 1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG 0: 1
1: 0
2: 1
3: 16
4: 220
1125656483_1125656487 -8 Left 1125656483 15:41361884-41361906 CCTGAGATGAAGTTGCTCCTGGC 0: 1
1: 0
2: 1
3: 13
4: 148
Right 1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG 0: 1
1: 0
2: 1
3: 16
4: 220

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125656487 Original CRISPR CTCCTGGCACATTTGGGGCT TGG Intronic
900245749 1:1635290-1635312 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900256979 1:1702447-1702469 CTGCTGGCACAGCTGGGGCTGGG + Intronic
900490293 1:2945572-2945594 CTCCTGGCACAGATGTGACTTGG + Intergenic
901737912 1:11323962-11323984 TGCCTGGCACAGCTGGGGCTGGG + Intergenic
902360369 1:15939161-15939183 GTCCTGGCACATTTGCTGGTTGG + Intronic
902488484 1:16763725-16763747 CTCCAGGAACATGTGGGGCATGG - Intronic
902751006 1:18510950-18510972 CACCTGGCCACTTTGGGGCTGGG + Intergenic
905648083 1:39638639-39638661 TTGGTGGCAGATTTGGGGCTGGG + Intronic
905856173 1:41316165-41316187 CTCCATGCACACTTGTGGCTGGG - Intergenic
907746787 1:57221564-57221586 TGCCTAGCACATATGGGGCTTGG + Intronic
909357170 1:74723157-74723179 CTCCTGGCTCAGATGTGGCTGGG - Exonic
910633482 1:89381678-89381700 CTCCTGGTTCATTTAGGTCTGGG + Exonic
917450661 1:175144964-175144986 CTGCTGGCAGATTTGGTTCTTGG + Intronic
918045879 1:180940915-180940937 CCTCTGGCACATTTGGGGCCAGG - Intronic
918142989 1:181733786-181733808 CTCCTATCCCATCTGGGGCTGGG + Intronic
922421778 1:225465325-225465347 TTCCACGGACATTTGGGGCTGGG + Intergenic
922767109 1:228161927-228161949 CTTCTTGAACATTTGGGGGTGGG + Intergenic
923531955 1:234818791-234818813 CTCCAGGAACATGTGGGGCAGGG + Intergenic
923546644 1:234928177-234928199 ATCCTGCCACCTTGGGGGCTGGG - Intergenic
924551354 1:245080931-245080953 CTGCTGACACATTGGCGGCTAGG - Intronic
924928869 1:248709443-248709465 CTCCTGCCTCATTTGGAGATAGG + Intergenic
1063172660 10:3523339-3523361 TTCCTGGGAAATTTGGGGATTGG - Intergenic
1063464365 10:6233305-6233327 CTCCCGGCACGTTTGGAGCTGGG + Exonic
1064444893 10:15384384-15384406 CTCCAGGCACATTTTAGGCATGG + Intergenic
1068780417 10:60913719-60913741 GCCCTGTAACATTTGGGGCTGGG - Intronic
1068875858 10:61996013-61996035 CTACAGGCACAGCTGGGGCTTGG - Intronic
1069542241 10:69303837-69303859 CTCCTTGAGCATTTGGGGATTGG + Intronic
1069678746 10:70268557-70268579 CTGCTGGCTCAGCTGGGGCTGGG + Intronic
1069817404 10:71207117-71207139 CTCCTGGGACAATGGGGCCTTGG - Intergenic
1070394729 10:76002313-76002335 CTACTGTCACATTGAGGGCTAGG + Intronic
1070711697 10:78687610-78687632 CTTCTGGCTCCCTTGGGGCTCGG - Intergenic
1072277754 10:93839580-93839602 CTCCTGTCATATTTGGTTCTTGG + Intergenic
1072760312 10:98051238-98051260 CTCCAGTCACATTGGGGGTTAGG + Intergenic
1074259317 10:111835905-111835927 GCCCTGGCTCATTTGTGGCTGGG - Intergenic
1077014798 11:394743-394765 CTCCAGGCACAGGTGGGGCCTGG - Intronic
1077030234 11:462214-462236 CTCCTGGCCCCTCTGGGTCTGGG - Intronic
1077056537 11:596742-596764 CTGCTGTCACATTGGGGGTTAGG + Intronic
1077342428 11:2032049-2032071 CTCCTGGCCCCTTTGGCCCTGGG + Intergenic
1077365844 11:2161277-2161299 CGCCTGGCCCATTAGGGCCTGGG + Intronic
1078081046 11:8204948-8204970 CGGCTGGAACATGTGGGGCTGGG + Intergenic
1080129245 11:28773864-28773886 ATTATGGCACATTTGGTGCTAGG + Intergenic
1081148554 11:39597160-39597182 CCCCCGGTACATTTGGGGATCGG - Intergenic
1083131491 11:60628116-60628138 ATCCTGACACATTTGGAGGTTGG + Intergenic
1083333745 11:61911291-61911313 CTCCTGCCACCTTTGGCGTTGGG - Intronic
1083764649 11:64836059-64836081 CTCCAGGCACACTGGGGGCAGGG + Intronic
1084959305 11:72707936-72707958 AGCATGTCACATTTGGGGCTGGG - Intronic
1088422853 11:109668144-109668166 CTCCTGGAAAATTTGGAGATAGG + Intergenic
1089459960 11:118646915-118646937 CTCCTGGCAAATGTGGGGAAAGG + Intronic
1089853632 11:121521391-121521413 ATCCTGGGATAGTTGGGGCTTGG + Intronic
1090031682 11:123211730-123211752 CTCTTGGCACTTTAGGGACTGGG - Intergenic
1090133995 11:124176713-124176735 CTCGTGGCTCATTTGGTGGTGGG + Intergenic
1202825414 11_KI270721v1_random:87238-87260 CTCCTGGCCCCTTTGGCCCTGGG + Intergenic
1091374226 12:15652-15674 CTCCTGTCACAGTTTGAGCTGGG + Intergenic
1091972255 12:4797249-4797271 CTGCTGGGACGTTTGGGGATTGG - Intronic
1093354971 12:18155514-18155536 CTCCCCGAACATTTGGGGATTGG - Intronic
1094067729 12:26379106-26379128 CACCTGGCACATTATGGGCATGG + Intronic
1094781303 12:33795195-33795217 CTGCTGGCACATTTGGGGGTGGG - Intergenic
1096216001 12:49797601-49797623 TTCCTGGCACACTTGGGGTTGGG + Intronic
1101576442 12:106001340-106001362 CTACTGGCAAACTTGAGGCTAGG + Intergenic
1101863315 12:108500300-108500322 TTTCTGGCACATCTGGGTCTAGG - Intergenic
1103929991 12:124445043-124445065 CTGCTGCCTCATTTGGGGGTCGG - Intronic
1104192354 12:126494286-126494308 CTCTTGGCACAGTGAGGGCTGGG + Intergenic
1104845450 12:131844610-131844632 GTCCTGTGACATCTGGGGCTGGG - Intronic
1106199874 13:27527431-27527453 TTCCTGGTTCCTTTGGGGCTGGG - Intergenic
1106712550 13:32353562-32353584 CTCCAGGCACACTTGTGTCTAGG + Intronic
1115123799 14:29969800-29969822 ATGCTGGCACATTTGGTGCCTGG + Intronic
1116706408 14:48307808-48307830 CTGCAGAAACATTTGGGGCTGGG + Intergenic
1118444262 14:65837458-65837480 CTCCTGGAATATTGGTGGCTGGG + Intergenic
1118916105 14:70107765-70107787 ATCCTTTCAAATTTGGGGCTGGG + Intronic
1119605762 14:76015011-76015033 CTCATGGAACATTTGGGACAGGG + Intronic
1122853164 14:104547569-104547591 CTCCTGGCTCATGTTGGGCCTGG + Intronic
1123144689 14:106117125-106117147 CTCCTGGGAATTCTGGGGCTGGG + Intergenic
1125194094 15:37026919-37026941 GTTCTGGCAGATTTGGGACTTGG + Intronic
1125656487 15:41361899-41361921 CTCCTGGCACATTTGGGGCTTGG + Intronic
1126675540 15:51156831-51156853 CTTATTGCACACTTGGGGCTTGG + Intergenic
1127149208 15:56056188-56056210 TGCCTGGGACATCTGGGGCTTGG + Intergenic
1127696107 15:61449417-61449439 ATCCTAGCACACTTTGGGCTTGG + Intergenic
1127774071 15:62252096-62252118 CTCCTCCCACAGTGGGGGCTGGG - Intergenic
1128683810 15:69669246-69669268 TTCCTGTCTCATTTGGGGCAGGG - Intergenic
1129029362 15:72607382-72607404 CTCCTCTCACAGTGGGGGCTGGG + Intergenic
1129037299 15:72658426-72658448 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129212588 15:74078799-74078821 CTCCTCTCACAGTGGGGGCTGGG - Intronic
1129397811 15:75262280-75262302 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129401422 15:75286561-75286583 CTCCTCTCACAGTGGGGGCTGGG + Intronic
1129729725 15:77923120-77923142 CTCCTCTCACAGTGGGGGCTGGG - Intergenic
1132454523 16:15219-15241 CTCCTGTCACAGTTTGAGCTGGG + Intronic
1133235037 16:4383813-4383835 CTTGTGGCACATGTGGGGCCAGG + Intronic
1136640262 16:31558121-31558143 CTCCTGCCAAACTTAGGGCTGGG + Intergenic
1136923449 16:34350534-34350556 CGCCTGCCACACTTGGCGCTTGG - Intergenic
1136981124 16:35061272-35061294 CGCCTGCCACACTTGGCGCTTGG + Intergenic
1137039614 16:35598889-35598911 CTCCTGCCACAAGTGGGGCTGGG + Intergenic
1138391258 16:56671304-56671326 GTCCTGGCTCATATGGGGATGGG + Intronic
1139519590 16:67473201-67473223 GGCCTGGCTAATTTGGGGCTGGG + Intronic
1139911412 16:70399605-70399627 CTCCTGCTAGCTTTGGGGCTTGG - Exonic
1141120256 16:81348976-81348998 CACCAGGCACATTTGAGGGTAGG - Intronic
1141896133 16:86959676-86959698 ATCCCAGCAGATTTGGGGCTGGG - Intergenic
1141936542 16:87242781-87242803 CTCCTGCCCCACTGGGGGCTTGG + Intronic
1141973195 16:87496244-87496266 CTCCTGGCACGCTTGCAGCTGGG - Intergenic
1142274228 16:89107816-89107838 ATGCAGCCACATTTGGGGCTGGG - Intronic
1142474140 17:179968-179990 CTGGTGGCACATTTGATGCTTGG + Intronic
1145833605 17:27937219-27937241 CACCAGGCACATGTGGGGCAAGG - Intergenic
1145901962 17:28495394-28495416 TTCTTGGGAAATTTGGGGCTTGG - Intronic
1147169314 17:38608892-38608914 CAGCTGGCATGTTTGGGGCTTGG + Intergenic
1148858125 17:50590301-50590323 CTCCTGGAGCCTTTGGGGCAGGG + Intronic
1149557942 17:57587563-57587585 CTGCAGCCACCTTTGGGGCTGGG - Intronic
1151718747 17:75844221-75844243 CTCCGGGGCCATTTGGGGCGGGG + Exonic
1151725346 17:75880668-75880690 CCTCTAGCACATTTGGGCCTGGG - Intronic
1151906604 17:77053263-77053285 CACCTGGCACATTGAGGACTTGG - Intergenic
1152453921 17:80401867-80401889 CTCCTGGCCCCTCTGGGTCTAGG - Intergenic
1152751205 17:82063203-82063225 CTCCCAGGACATCTGGGGCTGGG + Intronic
1153688333 18:7567675-7567697 CTGTTGGCACTTTGGGGGCTTGG + Exonic
1154315517 18:13300566-13300588 CTCCTGGCTTATTTCGGGGTGGG + Intronic
1155410690 18:25541610-25541632 TTCCTGGCAGCTTTGGGGATAGG - Intergenic
1157454129 18:47811061-47811083 TTTATTGCACATTTGGGGCTTGG - Exonic
1157623417 18:49029147-49029169 CTCCAGGCACTTCTGAGGCTGGG + Intergenic
1158107646 18:53904086-53904108 CTCCTGTCACTTTTGGGATTTGG + Intergenic
1160780962 19:877845-877867 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160781186 19:878565-878587 CTGCTGGGGCATGTGGGGCTGGG - Intronic
1160781332 19:879011-879033 CTGCTGGGACATGTGGGGCTGGG - Intronic
1160781399 19:879229-879251 CTGCTGGGGCATGTGGGGCTCGG - Intronic
1162435056 19:10653431-10653453 TTCCTGGAAAAATTGGGGCTGGG - Intergenic
1163582645 19:18147602-18147624 CTGCTGGGACATCAGGGGCTGGG - Exonic
1165022268 19:32934716-32934738 CTCTTGGCACATTTCAGGCTTGG - Intronic
1165073108 19:33267035-33267057 CTTCAGGCAAACTTGGGGCTCGG + Intergenic
1167592230 19:50410253-50410275 CTCCTGGCATATGAGGGCCTCGG + Intronic
1202702714 1_KI270713v1_random:515-537 CTCCAGGAACATGTGGGGCATGG + Intergenic
925534552 2:4902262-4902284 CTCCTGACATCTTTGAGGCTCGG - Intergenic
926516904 2:13858169-13858191 CTCCTGGAACATTTTGTGGTTGG - Intergenic
929402575 2:41602473-41602495 TTCCTGGCACATTTGGGAGTGGG + Intergenic
932625039 2:73290861-73290883 CTTCTGGCACATATGGTCCTGGG + Intergenic
934039312 2:88114883-88114905 CTCCTGGCCCAGTTGAGACTGGG - Intergenic
935547437 2:104416175-104416197 CTCCTGGTACATTTGGACTTCGG + Intergenic
936166257 2:110122268-110122290 CACTTGTCACATTTGTGGCTGGG + Intergenic
936568586 2:113597877-113597899 CTCCTGTCACAGTTTGAGCTGGG - Intergenic
936675991 2:114714637-114714659 CTCATGGCATATTTAGGGTTTGG + Intronic
941548650 2:166886562-166886584 CTGTTGGCACATTTGGGGTTTGG - Intergenic
943750414 2:191504244-191504266 TTCCAGGCACATGTGGGGCAAGG + Intergenic
944824045 2:203462946-203462968 ATCCTGGCACTTTGGAGGCTGGG + Intronic
946822969 2:223648966-223648988 CTCCTGTCATTTTTGGGTCTTGG + Intergenic
946860914 2:223999665-223999687 CTCCTGGCCCTTTTGGGGTAGGG + Intronic
948201229 2:236130911-236130933 CTGCTGGGACCCTTGGGGCTGGG - Exonic
1169827431 20:9784658-9784680 CTCCTGCAAAATTTGAGGCTTGG - Intronic
1174042387 20:47709169-47709191 CACCTGCCACAATTTGGGCTGGG - Intronic
1174185353 20:48702493-48702515 CACCTGGCACAAGGGGGGCTGGG - Intronic
1174262519 20:49306951-49306973 CTCCTGGCACATCAGGGAGTTGG - Intergenic
1175069692 20:56322782-56322804 CTCCAGGCACCACTGGGGCTGGG + Intergenic
1175150223 20:56928126-56928148 CTCCTGGCTCAGTGGGGGTTTGG - Intergenic
1175803427 20:61813944-61813966 CTCCTGCTACATATTGGGCTGGG - Intronic
1176057550 20:63156570-63156592 TTCCTGGCCCTTTTGTGGCTAGG + Intergenic
1176332483 21:5560878-5560900 CTGCTGGGGGATTTGGGGCTGGG - Intergenic
1176395274 21:6260073-6260095 CTGCTGGGGGATTTGGGGCTGGG + Intergenic
1176441883 21:6729031-6729053 CTGCTGGGGGATTTGGGGCTGGG - Intergenic
1176466145 21:7056100-7056122 CTGCTGGGGGATTTGGGGCTGGG - Intronic
1176489706 21:7437878-7437900 CTGCTGGGGGATTTGGGGCTGGG - Intergenic
1180600482 22:17012250-17012272 CTCCTGGCACAGGTGCTGCTTGG + Intergenic
1181431708 22:22885381-22885403 CTCCTTGGATATTCGGGGCTGGG - Intronic
1181820603 22:25472463-25472485 CACCTGGCACAATTGGCCCTGGG + Intergenic
1182812912 22:33132918-33132940 GTCCTGGGACATTTAGGGCAAGG + Intergenic
1184108865 22:42383757-42383779 CCCTGGGCACATTTGGGGTTGGG + Exonic
1184654858 22:45935926-45935948 CTGCTGGTACACTTGGGTCTCGG + Intronic
1185284271 22:49993390-49993412 CTCCTGGCAGGTGTGGGGGTGGG + Intergenic
952327568 3:32335002-32335024 CTGCTGGCACATTTGGGGGCTGG + Intronic
954810128 3:53242420-53242442 CTCCTGGCAGTTTGGGGCCTGGG + Intronic
955390659 3:58520119-58520141 CTCCTGTCTAATTTGGGGGTGGG + Intronic
961108201 3:124260315-124260337 GTGCTGCCACATTTGGGCCTGGG - Intronic
961213417 3:125142284-125142306 CTCTTAGCCCATCTGGGGCTGGG - Intronic
964195755 3:154062618-154062640 TTCCAGGCACATGTGGGGCAAGG - Intergenic
965638553 3:170809405-170809427 CTCCTCCCACAAATGGGGCTAGG - Intronic
969481734 4:7450002-7450024 CCCCTGGGACACGTGGGGCTGGG + Intronic
969576105 4:8036622-8036644 CTACTGGCTCTTTTGTGGCTGGG - Intronic
971033204 4:22663639-22663661 CGCATGGCACAGCTGGGGCTTGG + Intergenic
972262219 4:37420758-37420780 GTCCTGGCTTATTTGGGACTGGG + Intronic
973293286 4:48490547-48490569 CTCCTGGCGCAGGTGGGGCCGGG + Exonic
976802492 4:89008238-89008260 CTGTGGGCACATTGGGGGCTAGG - Intronic
980205056 4:129707635-129707657 TTCCTTGAACAGTTGGGGCTTGG + Intergenic
980689889 4:136281505-136281527 CGCCAGGCACATGTGGGGCAAGG + Intergenic
982318774 4:154058236-154058258 CTTCTGGCCCCTCTGGGGCTAGG - Intergenic
989486704 5:41998879-41998901 ATCTTAGCACATTTGAGGCTCGG + Intergenic
990810347 5:59715659-59715681 CCACTGGCCCATGTGGGGCTAGG + Intronic
993885246 5:93408480-93408502 CTGCTTGCACATTTGGGGTGTGG - Intergenic
994174746 5:96699516-96699538 CTCCTGTCACATGTAGGACTGGG + Intronic
995256958 5:110057954-110057976 ATCTTAGCACATTTGGGGCTTGG - Intergenic
996916380 5:128716728-128716750 CTCCTGGTACTTTTGGGGGATGG + Intronic
996972452 5:129388167-129388189 CTTCTGGAACACTTGGGGCCTGG - Intergenic
1001036406 5:168299895-168299917 CTCCAGCCACATGTGGTGCTAGG + Intronic
1001924206 5:175624435-175624457 CTGCTGGGACAGTTTGGGCTGGG + Intergenic
1003356067 6:5371633-5371655 CTCTTGTCATATTTGGGGATAGG + Intronic
1004442722 6:15669470-15669492 CTCCAGGCACAGTTGGTTCTTGG - Intergenic
1007697645 6:43743953-43743975 TTCCTGGCACAGCTGGGCCTGGG - Intergenic
1007764100 6:44150877-44150899 CTCAAGGTATATTTGGGGCTTGG + Intronic
1013269740 6:108534702-108534724 CTTCTGCCACATGTGGAGCTTGG - Intergenic
1013501699 6:110758472-110758494 CTCCTTCCTCATTTGGGGATGGG - Intronic
1014528400 6:122528967-122528989 CTACTGTCACATTTGGGACTAGG + Intronic
1018010382 6:159664793-159664815 CTTTTTGCACATTTGGGCCTTGG - Intergenic
1019444928 7:1066337-1066359 CGCCTAGCAGATTTGGGGCCAGG + Intronic
1019517714 7:1447092-1447114 CTCCTGCCCCATTAGGGGCATGG + Intronic
1020005501 7:4781880-4781902 TGCCTGGCACACTTGAGGCTGGG + Intronic
1020080935 7:5285281-5285303 GTCCTGCCACATCTGGAGCTGGG - Intronic
1022569488 7:31437657-31437679 ATCCTGTCACATTAGGGGATGGG - Intergenic
1025020523 7:55476334-55476356 CCCCTGGCACCCGTGGGGCTGGG - Intronic
1025707413 7:63880294-63880316 CCACTGGCAGATTGGGGGCTGGG + Intergenic
1026613828 7:71884242-71884264 TTCCTGGGACTTTTGGGGATGGG + Intronic
1031824558 7:126546914-126546936 CACCTGGCACAGTTGGTACTGGG + Intronic
1031842811 7:126766766-126766788 CTCCTTGCACTTTTGGTGTTAGG + Intronic
1032246468 7:130217876-130217898 ATCCAGGCACAGTTGGGGCTAGG + Intergenic
1035182517 7:157099616-157099638 CCCCTGGCGAGTTTGGGGCTAGG - Intergenic
1037577201 8:20218606-20218628 CTGCTTTGACATTTGGGGCTTGG + Intronic
1039018425 8:33179042-33179064 TGCCTGGCATATTTGGGGCAAGG - Intergenic
1039579430 8:38651580-38651602 CTCCTGGCTCATTTGGAACCAGG - Intergenic
1040871184 8:52101208-52101230 CTCCAGGCAGAGATGGGGCTGGG + Intergenic
1042173971 8:66021089-66021111 CTCCTGGCACCTGTGTTGCTGGG + Intergenic
1048438947 8:134445689-134445711 CTCCTGGCACACCTGATGCTGGG + Intergenic
1049883941 9:15648-15670 CTCCTGTCACAGTTTGAGCTGGG + Intergenic
1050071338 9:1817780-1817802 GAACTGGCACATTTGGGGTTAGG - Intergenic
1050604636 9:7288034-7288056 TTGCTGGCTCATTTGGGTCTAGG + Intergenic
1051588053 9:18747933-18747955 ATCCAGGCACACTTGAGGCTGGG + Intronic
1057381006 9:94567502-94567524 CTGCTGGCAGAGCTGGGGCTTGG + Intronic
1057511651 9:95684847-95684869 CTGCTGGCAAATCTGGGGCTGGG - Intergenic
1058681385 9:107443375-107443397 CTCCTGGCTCCTCTGGGCCTTGG + Intergenic
1061590606 9:131595185-131595207 GTCATGGCACAGCTGGGGCTAGG + Intronic
1061919066 9:133772245-133772267 CTCCTTGCTCGTTTGGGGCCCGG + Intronic
1203429609 Un_GL000195v1:79454-79476 CTGCTGGGGGATTTGGGGCTGGG + Intergenic
1187253207 X:17618043-17618065 CTGCTGACACATTTGGGTCGCGG + Intronic
1187365875 X:18665464-18665486 AGTCTGGCACATTTGTGGCTTGG - Intronic
1188567738 X:31545755-31545777 CTCCTGATACATTTGGGGGCAGG - Intronic
1189057687 X:37715868-37715890 CCCCTGGCCCATTTGGAGGTGGG - Intronic
1189578836 X:42384256-42384278 CTGGTGGAACATTTGGGGCCAGG + Intergenic
1190708602 X:53049674-53049696 CTCATGGGACATTTGGGATTGGG - Intronic
1194123193 X:89985704-89985726 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1196585084 X:117419620-117419642 CTTCTGGCACCTATGGGTCTAGG - Intergenic
1197376062 X:125682942-125682964 CTCTGGACACACTTGGGGCTTGG + Intergenic
1197771601 X:130092859-130092881 CCCCTGGCATACTTGGGGATTGG + Intronic
1197941340 X:131793308-131793330 CTCCTGGCGCATTTGTCTCTGGG - Intergenic
1198772692 X:140147786-140147808 CTCCTGCCTCAATGGGGGCTGGG + Intergenic
1199090037 X:143680853-143680875 CTCCTTGGACCTTTAGGGCTTGG + Intergenic
1200401865 X:156024511-156024533 CTCCTGTCACAGTTTGGGCTGGG - Intergenic
1200476054 Y:3643150-3643172 CTGCTGGCATATTGGGCGCTTGG - Intergenic
1200834193 Y:7717040-7717062 ATTCTGGCAGATTTGGGGGTTGG - Intergenic