ID: 1125674041

View in Genome Browser
Species Human (GRCh38)
Location 15:41493374-41493396
Sequence GGGCTTCTTCGGGAAGCCGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 131
Summary {0: 1, 1: 0, 2: 2, 3: 8, 4: 120}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125674023_1125674041 18 Left 1125674023 15:41493333-41493355 CCCTGGGGCAGAGTCTCCACTTG No data
Right 1125674041 15:41493374-41493396 GGGCTTCTTCGGGAAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 120
1125674024_1125674041 17 Left 1125674024 15:41493334-41493356 CCTGGGGCAGAGTCTCCACTTGG No data
Right 1125674041 15:41493374-41493396 GGGCTTCTTCGGGAAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 120
1125674022_1125674041 29 Left 1125674022 15:41493322-41493344 CCTCAGCTAGTCCCTGGGGCAGA No data
Right 1125674041 15:41493374-41493396 GGGCTTCTTCGGGAAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 120
1125674029_1125674041 2 Left 1125674029 15:41493349-41493371 CCACTTGGGTGCACGCCCTGGGG No data
Right 1125674041 15:41493374-41493396 GGGCTTCTTCGGGAAGCCGGGGG 0: 1
1: 0
2: 2
3: 8
4: 120

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125674041 Original CRISPR GGGCTTCTTCGGGAAGCCGG GGG Intronic
902130321 1:14254780-14254802 GAGCTTCTGCGGGAAGCCTCAGG + Intergenic
903341019 1:22654322-22654344 GGGCTTCCTGGGGAAGCCAGGGG - Intronic
906057645 1:42929275-42929297 GAGCATCTTCGAGAAGGCGGGGG - Exonic
907444604 1:54499682-54499704 GGGCGTCTGCGGGAGGCTGGGGG + Intergenic
915282241 1:154830438-154830460 GGGCTTCTTCAGAGAGCAGGTGG - Intronic
918132340 1:181640487-181640509 GGGCTTCTTCAGGAAACCAGTGG + Intronic
920285070 1:204873423-204873445 GGGCTTCTTCTCTAAGCCTGGGG - Intronic
921012992 1:211161449-211161471 GGGCTTCTTCAGTATGCTGGAGG + Intergenic
922752875 1:228079149-228079171 GGGGTCATTCGGGAAGCCGGTGG - Intergenic
923119544 1:230978199-230978221 CGGCATCCTCGGGAGGCCGGCGG + Intronic
924436491 1:244048397-244048419 GCGGCTCTTCGGGAAGGCGGAGG - Intergenic
1063240407 10:4163578-4163600 GGGCTTCTTCTGGTACCCAGAGG - Intergenic
1065533628 10:26697741-26697763 CGGCTGCTCCTGGAAGCCGGCGG + Exonic
1067031422 10:42880536-42880558 GGGCTTCTGCGGGCAGTGGGCGG - Intergenic
1067224771 10:44368472-44368494 GGGCTTATTCTAGAAGCCGGAGG - Intergenic
1067235777 10:44448001-44448023 GGGCCTGTTGGGGAAGCTGGGGG - Intergenic
1070261818 10:74863817-74863839 TGGCTTCTTAGGGAAGTTGGAGG + Intronic
1071651635 10:87398067-87398089 AGGCTTCTTCGGGCAGGTGGTGG - Intergenic
1073205098 10:101764875-101764897 GGGCTTGTTAGAGAAGCTGGAGG + Intergenic
1073290493 10:102410899-102410921 GGACTTCATCGGGAACCTGGAGG - Exonic
1076838774 10:133034344-133034366 GGGATTCTGTGGGAAGCCTGTGG - Intergenic
1077081304 11:725878-725900 GGGCTGCTCCAGGAAGCTGGGGG - Intronic
1079085209 11:17440244-17440266 GGGCTTCTCCCGATAGCCGGGGG - Intronic
1080861238 11:36151994-36152016 GGGCTGGTTTGGGAAGCTGGTGG - Intronic
1083745038 11:64730664-64730686 GGGCTTCTGCGGAAAGCCCTGGG - Intronic
1083935463 11:65867714-65867736 GGGTTTCTGCAGGAAGACGGGGG - Intronic
1084166931 11:67379473-67379495 TGGCTTCCCCGGGAAGCAGGGGG - Intronic
1084598382 11:70130774-70130796 AGGCTCACTCGGGAAGCCGGGGG - Intronic
1086953814 11:92915924-92915946 GGGCATCTTCGGGATGTCGAGGG - Intergenic
1092139587 12:6173769-6173791 GGGCTTCTACTGGAACCCAGGGG - Intergenic
1095683697 12:45008003-45008025 TGGCTTCTTCTGGAGGCCGTAGG - Intergenic
1095981644 12:47977800-47977822 GGGCTGCTTCCGGAAGGAGGAGG - Intronic
1098213315 12:68188584-68188606 GGGCTCCTTCAGGAAACCTGGGG + Intergenic
1102568472 12:113812625-113812647 GGGCTTATTAAGGAAGCTGGAGG + Intergenic
1108593597 13:51932191-51932213 GGGCATCTTGGGGTGGCCGGGGG - Intergenic
1113767108 13:112888476-112888498 GGGCCTCCTGGGGAAGCCAGAGG + Intergenic
1120567860 14:86081773-86081795 GGGCTTCTTCTGGAAGCTTTAGG + Intergenic
1121445373 14:93975336-93975358 GTGGCTCTTCGGGAAGCCAGGGG - Intronic
1123627742 15:22239163-22239185 GGGCCCCTTCGGGATGCTGGCGG - Intergenic
1123907288 15:24933437-24933459 GGGATTCTTGGGGAAAACGGTGG + Intronic
1124247282 15:28081744-28081766 AGGCTTCCTCGGGGAGCCGGTGG - Exonic
1124689478 15:31810124-31810146 GGGCAGCTTCGGGAGGCCAGAGG + Intronic
1125674041 15:41493374-41493396 GGGCTTCTTCGGGAAGCCGGGGG + Intronic
1127566497 15:60194260-60194282 GGGCCTCTTCAGGTAGCCTGTGG - Intergenic
1129823445 15:78619775-78619797 GGGCAGCTTGGGGAAGCGGGAGG + Intronic
1130115718 15:81002577-81002599 GGGCCGCTTCGGGGAGGCGGGGG + Exonic
1132141470 15:99400394-99400416 GGGCTTCTTGGAGAAACCTGAGG - Intergenic
1133226572 16:4343588-4343610 GTGTTTCTTCCTGAAGCCGGTGG - Intronic
1136279861 16:29201903-29201925 GGGGTTCATCGCGAAGCGGGTGG - Intergenic
1138350545 16:56344212-56344234 GTGCTTGATCGGGAAGCTGGGGG + Exonic
1140877041 16:79162420-79162442 GGGCTTCTTCTGGATTCCGTAGG + Intronic
1141976216 16:87518190-87518212 GGGCCCCTTCGGGATGCTGGCGG + Intergenic
1142084253 16:88168011-88168033 GGGGTTCATCGCGAAGCGGGTGG - Intergenic
1143636115 17:8164436-8164458 GGGCTTCTGTGGGGAGCGGGTGG - Intergenic
1145919302 17:28598696-28598718 GGGCTTCTTAGGGAGGGAGGAGG - Intronic
1146496188 17:33324598-33324620 AGGCTTCCTCGGGAAGCAGCAGG - Intronic
1152338887 17:79713619-79713641 TGGCTTCTTCTGGAGGCTGGGGG - Intergenic
1152647472 17:81476138-81476160 GGGCTTCTGCGTGAGGCAGGGGG + Intergenic
1157752996 18:50194928-50194950 CGGCGCCTGCGGGAAGCCGGCGG - Exonic
1160190145 18:76708710-76708732 AGGCTGCTCCGGGAAGCCGCAGG + Intergenic
1160330661 18:77988465-77988487 GGGCTTCTCAGAGAAGACGGTGG + Intergenic
1161143003 19:2659868-2659890 GGGCTTATTCAGGAAGCTTGTGG - Intronic
1164516787 19:28943586-28943608 GTGCTTTTTCGAGAAGCTGGTGG + Intergenic
1165719267 19:38067431-38067453 GGGCTCCTTCTGGATGCTGGAGG + Intronic
1165994981 19:39837646-39837668 TGGCTTCTTCCAGAAGCCTGCGG + Intronic
1167455910 19:49596673-49596695 GGCCTCCTTCTGGAGGCCGGGGG + Exonic
926086952 2:10026464-10026486 GGGCATCCTCGGGAAGAAGGAGG + Intergenic
926754577 2:16224954-16224976 GGGATCCTTCAGGCAGCCGGGGG + Intergenic
929533889 2:42768559-42768581 AGGCCTCTACGGGAAGCCTGTGG + Intronic
929824382 2:45298938-45298960 AGGCTCCTCCGGGAAGCCAGAGG - Intergenic
934733002 2:96671212-96671234 GGGTTTCTTCCTGAAGCCAGTGG + Intergenic
935815535 2:106843248-106843270 GCGCTTCCGCGGGAAGCGGGAGG - Exonic
936086363 2:109472265-109472287 GGGCTGCTCCAGGAAGACGGTGG + Intronic
938083434 2:128382485-128382507 GGGCTTCTGGGGGAATCCTGAGG + Intergenic
941526539 2:166613130-166613152 GGGCTTATACGGGATGCCTGTGG - Intergenic
942454844 2:176130539-176130561 GGGCGCGTGCGGGAAGCCGGCGG - Exonic
943618189 2:190117738-190117760 GGCTTTCTTCGGGGAGCCAGAGG - Intronic
946449328 2:219766222-219766244 GGGCTTCTTTGGGATGACAGGGG + Intergenic
948429884 2:237912490-237912512 GGGCTCCTTTGGGGAGCCAGAGG - Intergenic
948926522 2:241102209-241102231 GGGCTTCTCCGGGTCGCAGGCGG - Intronic
1169113015 20:3045539-3045561 AGGCTTCTACGGGAGGCGGGGGG + Intronic
1171122624 20:22579559-22579581 AGGCTTGTTGGGGAAGGCGGCGG + Intergenic
1171377422 20:24702928-24702950 GGACTTCTTCAGGGAGCCTGAGG + Intergenic
1174168902 20:48604258-48604280 GGGCTTCTGCAGGAGGCAGGAGG + Intergenic
1174622690 20:51888310-51888332 GACTTTCTTCGGGAAGCCGAGGG + Intergenic
1176059483 20:63166147-63166169 GGCCTCCTCCTGGAAGCCGGTGG + Intergenic
1176250179 20:64116872-64116894 GGGCCTCTTCCTGAAGCCTGAGG + Intergenic
1176271955 20:64239946-64239968 GGGTCTCTTCGGAAAGCAGGAGG + Intronic
1178668556 21:34570005-34570027 TGGCTTCTTCTGGAAGCTGGTGG + Intronic
1179365940 21:40758714-40758736 TGGTTTCTTGGGGAAGCTGGGGG + Intronic
1179958104 21:44752226-44752248 GGGCTCCGTCGGGCAGCCTGGGG - Intergenic
1180103594 21:45601910-45601932 GGGCTTGGTCAGGAAGCCGTTGG + Intergenic
1183328520 22:37207143-37207165 GGGCTTCTTCGGGCCGCTGCTGG - Exonic
1183708322 22:39488394-39488416 CGGCTTCTTCTGGAAGCAGCCGG + Exonic
1184067022 22:42126872-42126894 GGGCCACTTTGTGAAGCCGGAGG - Exonic
1184069748 22:42140576-42140598 GGGCCACTTTGTGAAGCCGGAGG - Intergenic
1184844361 22:47072150-47072172 GGGCTTCTTTGGGAATTAGGAGG + Intronic
1185302559 22:50090115-50090137 GGCCTTCTTCTGGAGGACGGCGG + Exonic
950161079 3:10761696-10761718 GAGCTGCTTGGGGAAGCCAGGGG - Intergenic
953878481 3:46679538-46679560 CGGCTTCTTCAGGAAGCCCTTGG + Intronic
956452221 3:69386078-69386100 CGGCTTCTGCTGGCAGCCGGGGG + Intronic
970192822 4:13531388-13531410 GGGCCTCTTCCGGAGGCCTGCGG - Intergenic
975281517 4:72568225-72568247 CGGTTTTTTCGGGCAGCCGGAGG - Intronic
981069980 4:140524360-140524382 GGGGTTCTGCGGGAACCCGGGGG + Intronic
985535867 5:465460-465482 GGGCGGCCTCGGGAAGCCGGCGG - Intronic
985907983 5:2856261-2856283 GGGCTTCTTTGGGAAGAATGAGG - Intergenic
996315377 5:122155101-122155123 GTGTTTCCTCGGGAAGCTGGGGG - Intronic
997391526 5:133520929-133520951 GTGCTTCTTCAGGAAGCAGCAGG - Intronic
1004720498 6:18264358-18264380 GGGCTGCTTCGGGACGCCGGAGG - Intronic
1005474790 6:26197134-26197156 GGGCTTCTTCACGCCGCCGGTGG + Exonic
1008473057 6:51905808-51905830 GGGCTTCTTCAGCAAGCCACAGG + Intronic
1018472065 6:164106251-164106273 GGGCTTCTCCAAGAAGCAGGCGG - Intergenic
1018945677 6:168345774-168345796 GGGCCCCTGGGGGAAGCCGGGGG + Intergenic
1019538894 7:1542736-1542758 GGATCTCTTTGGGAAGCCGGAGG - Exonic
1019707876 7:2505056-2505078 GGGCCTCTGCGGGGAGGCGGTGG - Intergenic
1020120460 7:5500441-5500463 GGGCCTCTGCTGGAAGCTGGCGG - Intronic
1023830953 7:44038816-44038838 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1029741287 7:102493125-102493147 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029759277 7:102592294-102592316 GGGCGTCTTCGCGAAGCTGAGGG + Exonic
1029776646 7:102688204-102688226 GGGCGTCTTCGCGAAGCTGAGGG + Intergenic
1033143661 7:138851846-138851868 GTGCTTCTTCTGGAATCCGCAGG + Intronic
1046354901 8:113069837-113069859 TGGCTTCTAAGGGAAGCAGGTGG - Intronic
1047115241 8:121834555-121834577 GTGCCTCTTCTGGAAGCCTGAGG - Intergenic
1049052590 8:140210477-140210499 GGGATTCTTCAGGCAGACGGGGG - Intronic
1049327389 8:142029991-142030013 GGGCTTTCTCGGGCAGCCGCGGG - Intergenic
1057587551 9:96343115-96343137 GGACTTCTTCAGGAAGTCGCGGG - Intronic
1057840621 9:98483111-98483133 GGGCCTCTTGGGAAAGCTGGTGG - Intronic
1060374702 9:123107729-123107751 GGGCTTATTCGGGTAGCCGGTGG - Intergenic
1061190702 9:129081095-129081117 GGGCTTCTTCGAGCAGCCAATGG - Exonic
1186486045 X:9935212-9935234 GAGCTTCTCCCGGGAGCCGGGGG + Intronic
1193329655 X:80222197-80222219 GGGCCTGTTCAGGAAGCAGGGGG + Intergenic