ID: 1125674127

View in Genome Browser
Species Human (GRCh38)
Location 15:41493677-41493699
Sequence CGGGGAAGTCCAGCCTCCGT AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 77
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 72}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125674127_1125674139 20 Left 1125674127 15:41493677-41493699 CCTACGGAGGCTGGACTTCCCCG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125674139 15:41493720-41493742 GAGCCTTCTCTCCCTCGCAGGGG 0: 1
1: 0
2: 0
3: 41
4: 174
1125674127_1125674138 19 Left 1125674127 15:41493677-41493699 CCTACGGAGGCTGGACTTCCCCG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125674138 15:41493719-41493741 AGAGCCTTCTCTCCCTCGCAGGG 0: 1
1: 0
2: 0
3: 13
4: 151
1125674127_1125674141 26 Left 1125674127 15:41493677-41493699 CCTACGGAGGCTGGACTTCCCCG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125674141 15:41493726-41493748 TCTCTCCCTCGCAGGGGCCCTGG 0: 1
1: 0
2: 4
3: 32
4: 264
1125674127_1125674143 30 Left 1125674127 15:41493677-41493699 CCTACGGAGGCTGGACTTCCCCG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125674143 15:41493730-41493752 TCCCTCGCAGGGGCCCTGGGAGG 0: 1
1: 0
2: 3
3: 35
4: 339
1125674127_1125674137 18 Left 1125674127 15:41493677-41493699 CCTACGGAGGCTGGACTTCCCCG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125674137 15:41493718-41493740 GAGAGCCTTCTCTCCCTCGCAGG 0: 1
1: 0
2: 1
3: 8
4: 104
1125674127_1125674142 27 Left 1125674127 15:41493677-41493699 CCTACGGAGGCTGGACTTCCCCG 0: 1
1: 0
2: 0
3: 4
4: 72
Right 1125674142 15:41493727-41493749 CTCTCCCTCGCAGGGGCCCTGGG 0: 1
1: 0
2: 2
3: 33
4: 270

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125674127 Original CRISPR CGGGGAAGTCCAGCCTCCGT AGG (reversed) Intronic
900167137 1:1248311-1248333 GGGGGAGGCCCAGCCTCCCTCGG - Intergenic
900167159 1:1248377-1248399 GTGGGAAGTCCAGCCTCCCTTGG - Intergenic
900167219 1:1248575-1248597 TTGGGAAGTCCAGCCTCCCTTGG - Intergenic
900167302 1:1248839-1248861 GTGGGAAGTCCAGCCTCCCTCGG - Intergenic
900167582 1:1249631-1249653 GGGGGAGGCCCAGCCTCCCTCGG - Intergenic
902533369 1:17104847-17104869 GCGGGAAGTCCAGCCTCTGCGGG - Intronic
905596753 1:39214249-39214271 CAGAAAAGTCCAGCCTCTGTGGG - Intronic
920363838 1:205437673-205437695 CTGGGAAGTTGAGCCTCAGTGGG - Intronic
921842055 1:219839263-219839285 CTGGGAAGTCTAGCATCCTTAGG - Intronic
922549329 1:226482530-226482552 CGCGGAAGTCCAGCCTCTGGTGG + Intergenic
1069425458 10:68284898-68284920 CAGGGCAGTGCAGCCTCCATTGG + Intronic
1071874543 10:89830338-89830360 CGGGGAAGTAAGGCCACCGTTGG - Intergenic
1072968998 10:100000468-100000490 CGGGAAAATGCAGCCTCCGCAGG + Intronic
1076438716 10:130464468-130464490 CAGGGCAGCCCAGCCTCCATGGG - Intergenic
1077411250 11:2404945-2404967 CGGGGCTGGCCAGCCTCCCTCGG - Exonic
1077443075 11:2577765-2577787 AGGGGACGCCCAGCCCCCGTGGG - Intronic
1089015133 11:115159428-115159450 AGGGGAAGGCCAGCCTCACTGGG - Intergenic
1098888471 12:75983906-75983928 CTGGGATGTCCAGTCTCAGTAGG + Intergenic
1123904360 15:24907223-24907245 CCTGGAAGTCCTTCCTCCGTAGG - Intronic
1125547099 15:40513831-40513853 AGGGGGAGCCCAGCCTCCCTTGG - Intergenic
1125674127 15:41493677-41493699 CGGGGAAGTCCAGCCTCCGTAGG - Intronic
1125921435 15:43527944-43527966 CAGGGAAGTCCAGACTGGGTCGG - Exonic
1127287076 15:57541615-57541637 AAGGGCAGTCCAGCCTCCTTAGG - Intronic
1128751654 15:70154464-70154486 CGGAGAAGCCCAGCCTGGGTGGG - Intergenic
1130330353 15:82917544-82917566 CGGGGAAGATCCGCCCCCGTGGG + Intronic
1131062622 15:89413247-89413269 CGGGGAAGCCCAGCTTATGTGGG - Intergenic
1134124538 16:11607378-11607400 AAGGGAAGTCCAGCCTTCTTGGG - Intronic
1139709978 16:68768652-68768674 TGTTGAAGTCCAGCCTCCATAGG + Intronic
1141446644 16:84063025-84063047 CGCGGGAGTCCCGCCTCCGCTGG + Intronic
1147999524 17:44379729-44379751 GGGGCCATTCCAGCCTCCGTGGG + Exonic
1152133824 17:78492533-78492555 CGTGGAAGGCCAGCCTCCCCAGG - Intronic
1152920942 17:83066346-83066368 CAGGGAAGGCCAGCCTGCGGCGG - Intergenic
1158434862 18:57428457-57428479 CGAGGGAGTCCAGCCTCGGCGGG - Intergenic
1162076940 19:8194190-8194212 GGGGGAAGTCCAGCCTAGTTGGG + Intronic
1162798193 19:13097550-13097572 CGGAGCAGTCCAGCCGCCGGGGG - Intronic
925907595 2:8548479-8548501 TGGGGCAGTCCAGCCTCCTGGGG - Intergenic
927782158 2:25948261-25948283 AGGGGAAGTCCAGGCTGGGTGGG + Intronic
936066662 2:109337596-109337618 CTAGGAAGTCCATCCTCCATTGG + Intronic
936399171 2:112152775-112152797 CTGGCAAGTCCAACCTCCGCAGG - Intronic
938697586 2:133848574-133848596 CAGTAAATTCCAGCCTCCGTTGG + Intergenic
940637986 2:156320829-156320851 AGGAAAAGTCCAGCTTCCGTCGG - Intergenic
946488180 2:220121100-220121122 GGGGTGAGTCCAGCCTCTGTGGG + Intergenic
1178056621 21:28806592-28806614 CCAGGCAGTCCAGCCTCTGTGGG - Intergenic
1179075764 21:38120319-38120341 CTGGCAAGTCCAGAATCCGTAGG + Exonic
1180057951 21:45368712-45368734 CTGGGACGTCCAGGCACCGTGGG + Intergenic
1180194185 21:46183515-46183537 CGGGGGAGACCAGCCTGCGGGGG + Exonic
1180194256 21:46183726-46183748 CGGGGGAGACCAGCCTGCGGGGG + Exonic
1180194291 21:46183831-46183853 CGGGGGAGACCAGCCTGCGGGGG + Intronic
1182338825 22:29603418-29603440 CGGGAAAGTCCTGCCTACCTTGG + Intergenic
1184205088 22:42997099-42997121 GAGGGAAGGCCAGCCTCAGTGGG - Intronic
1185375532 22:50481321-50481343 TGGGGAAGTCCGGCCCCCGCAGG + Intergenic
952729128 3:36620565-36620587 CGGGGAAATCCAGCTCCAGTAGG - Intergenic
959513201 3:107236941-107236963 CTGGGAATTCCAGCCTAGGTAGG - Intergenic
968189884 3:196660042-196660064 CTGACAAGTCCAGCCTCCGCAGG - Exonic
968765035 4:2463664-2463686 GGGTGAAGTCCTGCCTCCATTGG - Intronic
968879640 4:3292560-3292582 CGAGGAAGTCCCGCTCCCGTTGG - Intergenic
979486419 4:121275747-121275769 CAGGGAAGTCCAGCCTGAGAAGG - Intergenic
979751880 4:124289288-124289310 CTGGGAAGTGCAGCCTCTGGTGG - Intergenic
984818286 4:183858096-183858118 TGGGGAAGTGCAGGCTCCCTGGG + Intronic
997952423 5:138252955-138252977 TGGGGAAGTCCAGCTACCATAGG + Exonic
999223586 5:150001177-150001199 CGGGTAAGTCCCGCCTTCGAGGG + Exonic
999451397 5:151680981-151681003 TGGGTAAGTCCAGCCTCCAGAGG + Intronic
1002573136 5:180155376-180155398 GGGGGAACTGCAGCCTCCCTAGG + Intronic
1015886361 6:137922562-137922584 CGGGGAAGACATGCCTCCTTAGG + Intergenic
1016014215 6:139167041-139167063 CGGAGAGGTCCAGCCGCCGAAGG - Exonic
1018370077 6:163159971-163159993 TGGGGAAAGCCAGCCTCTGTCGG - Intronic
1020037518 7:4973861-4973883 TGGGGGAGTCAAGTCTCCGTAGG + Intergenic
1023248574 7:38233249-38233271 CGGGGCAGCCCAGCTTGCGTTGG + Intergenic
1034259022 7:149742601-149742623 GGGGGAAGGGCAGCCTCCTTCGG + Intergenic
1035398358 7:158549565-158549587 AGGCGAAGCCCAGCCTCCGCAGG - Intronic
1049268970 8:141684135-141684157 TGGGGAAGCCCACCCTCCTTGGG + Intergenic
1053007232 9:34612331-34612353 CGGGGAAGTCCTGCGTCTGAAGG + Intergenic
1053312444 9:37028010-37028032 TGGGGAGGTCCAGCCCGCGTGGG - Intronic
1059418376 9:114175773-114175795 CGGGGAGGAACAGGCTCCGTGGG - Intronic
1059469702 9:114495432-114495454 CTGGAGAGTCCAGCCTCCCTGGG + Intronic
1061714405 9:132509861-132509883 CCAGGAAGCCCAGCCTCCCTGGG + Intronic
1062288204 9:135783024-135783046 GGGGGAAGTGTGGCCTCCGTGGG + Intronic