ID: 1125675723

View in Genome Browser
Species Human (GRCh38)
Location 15:41501669-41501691
Sequence CCTGAAGCGCTGCTCGGAGC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 138
Summary {0: 1, 1: 0, 2: 1, 3: 9, 4: 127}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125675715_1125675723 17 Left 1125675715 15:41501629-41501651 CCTCAGGGAGTTTTAAGGCGGCG 0: 1
1: 0
2: 0
3: 2
4: 26
Right 1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 127
1125675712_1125675723 22 Left 1125675712 15:41501624-41501646 CCGGTCCTCAGGGAGTTTTAAGG 0: 1
1: 0
2: 1
3: 26
4: 289
Right 1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 127
1125675720_1125675723 -10 Left 1125675720 15:41501656-41501678 CCAGCGGGCTGATCCTGAAGCGC 0: 1
1: 0
2: 0
3: 2
4: 81
Right 1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG 0: 1
1: 0
2: 1
3: 9
4: 127

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125675723 Original CRISPR CCTGAAGCGCTGCTCGGAGC CGG Exonic
900296618 1:1955108-1955130 CCTGCAGCTCAGCGCGGAGCTGG - Intronic
900614371 1:3558033-3558055 GCTGAACCACTGCACGGAGCGGG - Intronic
900616409 1:3567566-3567588 CCTGCAGGGCTGCGCGGTGCTGG - Intronic
901805632 1:11736637-11736659 CCTGAAACGGTGCTGGGACCCGG - Intronic
902504437 1:16930135-16930157 CAAGAAGAGGTGCTCGGAGCTGG + Exonic
902514631 1:16983522-16983544 GCTGAACTGCTGCTCTGAGCCGG - Intergenic
902823291 1:18956383-18956405 CCGGGAGCCCTGCCCGGAGCTGG - Exonic
903609598 1:24600742-24600764 CTTCAAGCGCAGCTCGGGGCAGG + Intronic
905996022 1:42381012-42381034 CCGGCAGCGCTGCTCCGAGCAGG + Exonic
913190881 1:116412006-116412028 CCTGAGTCGCTGCTTGGAGGAGG + Intergenic
921110948 1:212035954-212035976 TCCCAACCGCTGCTCGGAGCTGG + Intronic
1063602554 10:7495577-7495599 CCTGAATTGCTGCACTGAGCCGG - Intergenic
1070645988 10:78202925-78202947 TCTGAGGCCCTGCTCTGAGCTGG - Intergenic
1073863108 10:107770287-107770309 TCTGAAGATCTGCTCAGAGCAGG - Intergenic
1076683165 10:132185736-132185758 CCGGCAGCGCTGCGCGGAGCTGG - Intergenic
1076838012 10:133030966-133030988 CCTCAAAGGCAGCTCGGAGCCGG - Intergenic
1078466675 11:11555175-11555197 CCTGATGGGCTGCTCAGGGCGGG + Intronic
1083424710 11:62577245-62577267 CCTGAGTCTCTGCTCTGAGCTGG - Exonic
1085346008 11:75768638-75768660 CCTGAGGCTCTGCTTGGCGCGGG - Intronic
1085395544 11:76205424-76205446 ACTGAAGCGCTGCTGGGAGTTGG - Intronic
1085579402 11:77637477-77637499 CCTGGAGGCCTGCTGGGAGCGGG - Intronic
1091100389 11:132867498-132867520 CCTGAAGCTCTGCTGGCAGAGGG - Intronic
1091259712 11:134224719-134224741 CTCGCAGCGCTGCTCGGCGCTGG + Exonic
1091302325 11:134515434-134515456 CCCAAAGCGGTGCTCGGTGCTGG - Intergenic
1094445400 12:30524231-30524253 CTTGAAGCCCTGCTCAGTGCTGG - Intergenic
1100679829 12:96907247-96907269 CCGGAAGCCCAGCGCGGAGCCGG + Intronic
1102475352 12:113185215-113185237 CTCGAGGCGCTGCCCGGAGCCGG + Intronic
1104943311 12:132404819-132404841 CCTGCAGAGCTGCTGGGAGCAGG - Intergenic
1105202732 13:18194117-18194139 TCTGAAGCGCTGCCCCGAGGCGG + Intergenic
1106178868 13:27354152-27354174 CCTGGAGGGCTGCTCTGAGCAGG - Intergenic
1107654268 13:42575023-42575045 GCTGGAGGGCTGCGCGGAGCGGG + Intronic
1107935409 13:45341522-45341544 CCTGGAGAGGTGCTGGGAGCTGG + Intergenic
1113879991 13:113619659-113619681 TCTGAAGTGCTGCTCGGGGCCGG + Intronic
1113914404 13:113862233-113862255 CTTGCAGGGCTGCGCGGAGCGGG + Intronic
1118019398 14:61695602-61695624 CCTGAGGAGAGGCTCGGAGCCGG + Intronic
1118438345 14:65791240-65791262 CCAGAAGCGCTGTTCGGGGGTGG + Intergenic
1123696204 15:22880801-22880823 CCTGCAGCGGTGCTGAGAGCTGG - Intronic
1124637074 15:31372121-31372143 CATGAAGCGCTTCTCGCAGATGG - Exonic
1125675723 15:41501669-41501691 CCTGAAGCGCTGCTCGGAGCCGG + Exonic
1129226967 15:74175751-74175773 CTGGAAGCGCGGCTGGGAGCTGG - Exonic
1129783158 15:78288097-78288119 CCTCAAGGGCTGCTTGGAGGAGG - Intronic
1129785804 15:78309391-78309413 CCTGACTCTCTGCTCTGAGCAGG + Intergenic
1130305047 15:82707893-82707915 CTTGAAGGGCTGCTTCGAGCGGG - Intronic
1132143456 15:99412989-99413011 GCTGAGGCCCTGCTCTGAGCTGG - Intergenic
1132692844 16:1189259-1189281 CCTGAAGCCCTGCCAGGGGCTGG - Intronic
1133739320 16:8639789-8639811 CCTGGGGGGCTGCTCGGAGGAGG - Intronic
1136567676 16:31079914-31079936 GCTGAAGGGCCGCTCAGAGCTGG - Exonic
1136585809 16:31183977-31183999 CCCGAGGTGCTGCTGGGAGCTGG - Exonic
1139779491 16:69339175-69339197 CCTGCAGCTCTGCTGGAAGCTGG + Exonic
1141280654 16:82627563-82627585 GCCGAAGCGCTGCTCGGGTCCGG + Intronic
1142164726 16:88580047-88580069 CCTGAAACGCTGCTGGGCGTGGG - Intronic
1145996990 17:29110531-29110553 CCTGGAGGGCGGCTCGCAGCTGG - Exonic
1146759161 17:35460811-35460833 CCTGGCGCGCTACTCGGAGAAGG + Intergenic
1148085930 17:44993850-44993872 CCTGCAGTGCTGGTGGGAGCTGG - Intergenic
1148859917 17:50599456-50599478 CCTGGAGCGCTGCAAGCAGCTGG + Exonic
1150447454 17:65238137-65238159 CCTGAAGGGCTGCCCAGGGCAGG - Intergenic
1151708290 17:75784382-75784404 CTTGGAGCACTGCTCTGAGCTGG + Intronic
1152234875 17:79133304-79133326 AGTGAAGCTCTGCTAGGAGCTGG - Intronic
1161979631 19:7623833-7623855 GCTGATGAGCTGCTCGAAGCGGG + Exonic
1162725584 19:12688270-12688292 GCTGAAGTTCTGCACGGAGCAGG + Intronic
1164642493 19:29836638-29836660 CCTGCAGGGCTGCCCAGAGCTGG - Intergenic
1165871339 19:38975585-38975607 CCTGGCGGGCTGCTCGGAGGCGG + Exonic
927251243 2:20996631-20996653 CTTGAAGCACTGCTCAGATCTGG + Intergenic
927591401 2:24360679-24360701 CCTGAAGGTCTGCTCCGAGTCGG + Exonic
932455827 2:71849370-71849392 CCTGAAGAGCTGTTAGGAGCAGG + Intergenic
933709471 2:85314995-85315017 CCTGAGGCTCTCCTGGGAGCAGG + Intergenic
933870661 2:86562889-86562911 CCCGAAGCGTTGTTTGGAGCGGG - Intronic
936404068 2:112187066-112187088 CATGAAGAGCTGCTCTGACCCGG - Intronic
936786994 2:116105483-116105505 TCTGAAGCTCTGCTGGCAGCTGG + Intergenic
938219913 2:129557115-129557137 CCTGCACAGCTGCTTGGAGCAGG + Intergenic
945492892 2:210476691-210476713 CCTGAAGCCCTTCTCGGCCCTGG + Exonic
947736914 2:232459853-232459875 CCTCAAGCGCTCCTTGGATCTGG - Exonic
948561937 2:238860118-238860140 CCTGAAGCGGTCCACCGAGCGGG - Intronic
948581098 2:238987720-238987742 CCCCAGGCGCTGCCCGGAGCGGG - Intergenic
1169193649 20:3672391-3672413 CCGAGAGCGCGGCTCGGAGCTGG + Intronic
1170890030 20:20368667-20368689 CCCGCCGCGCTGCTCGGAGGGGG + Exonic
1174475962 20:50795517-50795539 CCTGAGGCGCCGCTCGGCCCGGG - Intronic
1175375669 20:58522009-58522031 GCAGAAGAGCTGCTTGGAGCAGG + Intergenic
1175883162 20:62272036-62272058 CATGAAGGGATGCTCAGAGCAGG + Intronic
1175954180 20:62599831-62599853 CCAGGAGCGCTTCCCGGAGCGGG + Intergenic
1176715221 21:10343888-10343910 TCTGAAGCGCTGCCCCGAGGCGG - Intergenic
1180603127 22:17036067-17036089 TCTGAAGCGCTGCCCCGAGGCGG + Intergenic
1180614620 22:17119564-17119586 CCTGGAGGGCTGCTGGGACCGGG - Exonic
1180876955 22:19178994-19179016 CTTGACCCACTGCTCGGAGCTGG - Intergenic
1181557082 22:23677394-23677416 CCTGATGAGCAGCTCAGAGCAGG + Intergenic
1181580490 22:23825311-23825333 CCTGAAGCTGTGCTCGGAGCTGG + Exonic
1181697294 22:24600146-24600168 CCTGATGAGCAGCTCAGAGCAGG - Intronic
1182129353 22:27839616-27839638 CCAGAATCGCTGCTCTGAGGTGG + Intergenic
1182840041 22:33381937-33381959 TCTGTAGCACTGCTCGGAGCGGG + Exonic
1183248945 22:36714660-36714682 CCTGAAGCTCAGCAAGGAGCTGG - Intergenic
1183753620 22:39738179-39738201 CCTGAGGCCCTAATCGGAGCTGG + Intergenic
1184089640 22:42285427-42285449 ACTGGTGCGCTGCTCGGAGGGGG - Intronic
949966761 3:9363218-9363240 CCTGAAGTCCGGCTCGGCGCCGG - Exonic
950045243 3:9945149-9945171 CCTGAAGTGCTGTTAGGAGAAGG + Intronic
950421602 3:12902909-12902931 CCTGCACCCCTGCTGGGAGCAGG + Intronic
950569956 3:13793629-13793651 CCTGATTCCCTGCCCGGAGCTGG - Intergenic
950849796 3:16051469-16051491 GCTGAAGCGCTGTTTGGTGCTGG + Intergenic
953023072 3:39128356-39128378 CCTGCAGCGTTGCCTGGAGCTGG + Exonic
969630554 4:8333358-8333380 CCTGAGGTTCTGCTTGGAGCAGG - Intergenic
976629054 4:87219218-87219240 CCTGGAACGCTGCTTGGAGATGG - Intronic
981165095 4:141548408-141548430 CCTAGAGAGCTGCTAGGAGCTGG - Intergenic
982278346 4:153659380-153659402 CCTTAACCGCTGCTCCGCGCTGG + Intergenic
985636013 5:1036272-1036294 CCCCCAGCCCTGCTCGGAGCGGG + Exonic
990513257 5:56508700-56508722 CCTGAAATCCTGCTTGGAGCAGG - Intergenic
990780533 5:59356913-59356935 CCTGAGGCCCCGCACGGAGCAGG + Intronic
992678244 5:79127198-79127220 CCTGAAGGCCTGTTGGGAGCTGG + Intronic
997297477 5:132777101-132777123 CCTGGAGCGCTTCTCGGTGAGGG - Exonic
1002176153 5:177402624-177402646 CCTGGAGCGCTGCTCAGCCCCGG - Exonic
1002519622 5:179784397-179784419 CCTGAAGCCCAGCTTGCAGCAGG + Intronic
1002918410 6:1547659-1547681 CCTGAAGCGGTGCTCTGCGTGGG - Intergenic
1003195866 6:3914031-3914053 CCTGAAGGGCTGCTCTGGCCAGG + Intergenic
1004222599 6:13759388-13759410 CCTTCAGAGCTGCTCTGAGCTGG - Intergenic
1006898194 6:37484034-37484056 CCTGCAGAGCTGCTCTGGGCAGG + Intronic
1011017398 6:82772078-82772100 CCTGAAGCAATACTGGGAGCTGG + Intergenic
1019285896 7:222717-222739 CCTGGAGTGCTGCTTGGTGCTGG + Intronic
1020163909 7:5793607-5793629 CCGCAAGCGCTGCACGCAGCCGG - Intergenic
1023810367 7:43906668-43906690 CCTGGAGCGCGTCCCGGAGCGGG - Exonic
1024232706 7:47374860-47374882 CCTGATGAGCTCCTAGGAGCAGG + Intronic
1025021384 7:55483164-55483186 CCTGTAGCGCTTCTCAGTGCAGG + Intronic
1026600955 7:71776860-71776882 CCTGCAGCTGTGCTCGGACCTGG - Intergenic
1029124200 7:98285864-98285886 CCTGAAGCCATGCTCAGCGCAGG - Intronic
1035160924 7:156949607-156949629 CGTGCAGAGCTGCGCGGAGCCGG - Intergenic
1035748675 8:1979784-1979806 CCTGAAGTGCAGCTGGGTGCAGG + Intronic
1038480105 8:27896006-27896028 CCAGAAGCTCTGCTTAGAGCTGG + Intronic
1041862806 8:62533494-62533516 CCTGAAGCCCTGTTAGGAGGTGG - Intronic
1044427404 8:92068424-92068446 CCTGCAGCTCTGCTCTGTGCAGG + Intronic
1046770382 8:118111756-118111778 TGCGAAGCGCTGCTCGGGGCCGG - Exonic
1048291545 8:133185234-133185256 CTGGAAGCCCTGCTCAGAGCTGG + Intergenic
1049212254 8:141392171-141392193 CCCGAAGCCGTGCCCGGAGCGGG - Intronic
1053512966 9:38705146-38705168 GCTGAAGCACTTCTCTGAGCAGG - Intergenic
1055397433 9:75890685-75890707 CCTCGCGCGCTGCTCGGAGCCGG + Exonic
1061954257 9:133953458-133953480 CCTGCACCCCGGCTCGGAGCTGG + Intronic
1062313937 9:135956156-135956178 CCGTGAGCGCTGCTCGGAGGTGG - Intronic
1062624644 9:137437238-137437260 CCTGCAGGGCTGCTTGGAGGAGG - Exonic
1062653311 9:137589718-137589740 CCTGAAGCCCTGCTGAGAACTGG + Intronic
1186475282 X:9852453-9852475 CTTGAAGGTCTGCTCCGAGCTGG + Intronic
1192481831 X:71492636-71492658 CCTGATCCGCAGCTAGGAGCCGG - Intronic
1201891167 Y:18945537-18945559 ACTGAAGAGCTGCTTTGAGCGGG + Intergenic