ID: 1125675838

View in Genome Browser
Species Human (GRCh38)
Location 15:41502256-41502278
Sequence CGGGGCGGGAGCGGGGGATC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 605
Summary {0: 1, 1: 0, 2: 3, 3: 60, 4: 541}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125675838_1125675861 25 Left 1125675838 15:41502256-41502278 CCCGATCCCCCGCTCCCGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 541
Right 1125675861 15:41502304-41502326 CCTCGCCGTCCCCTGCAACTGGG 0: 1
1: 0
2: 1
3: 6
4: 166
1125675838_1125675859 24 Left 1125675838 15:41502256-41502278 CCCGATCCCCCGCTCCCGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 541
Right 1125675859 15:41502303-41502325 GCCTCGCCGTCCCCTGCAACTGG 0: 1
1: 0
2: 0
3: 9
4: 178
1125675838_1125675862 28 Left 1125675838 15:41502256-41502278 CCCGATCCCCCGCTCCCGCCCCG 0: 1
1: 0
2: 3
3: 60
4: 541
Right 1125675862 15:41502307-41502329 CGCCGTCCCCTGCAACTGGGAGG 0: 1
1: 0
2: 0
3: 9
4: 92

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125675838 Original CRISPR CGGGGCGGGAGCGGGGGATC GGG (reversed) Intronic
900119147 1:1041117-1041139 CGGGGCGGGAGCGGGGGCGGGGG + Intronic
900182123 1:1315744-1315766 GGGGGCGGGAGCGAGGGAGGTGG + Intronic
900191795 1:1355207-1355229 AGGGGCGGGAGCTGGGGGGCGGG + Intronic
900244549 1:1631230-1631252 CGGGGCGGGGGTGGGGGATTGGG - Intergenic
900287688 1:1909286-1909308 CGGGGCGGGGCCGGGTGATCCGG + Intergenic
900586736 1:3436319-3436341 CGGGATGGGACTGGGGGATCCGG - Exonic
900898752 1:5502866-5502888 TGGGGCGGGGGCGGGAGCTCTGG + Intergenic
901066124 1:6495413-6495435 CGGGAGGGGAGCGGGGGGTGGGG + Intronic
901443495 1:9293195-9293217 GGGGCCGGGCGCGGGGGAGCGGG + Intronic
902286261 1:15410342-15410364 CGGAGCGGGATCCGGGGATCGGG - Intronic
902336913 1:15759115-15759137 GGGAGCGGGAGCCGGGGACCCGG + Intronic
902951012 1:19882741-19882763 CGGGCCGGGAGCGAGGGAGGCGG + Intronic
903297141 1:22350951-22350973 CGGGGTGGGGGCGGGGGAGGGGG - Intergenic
903777173 1:25800432-25800454 TGGGGCGGGAGCGCGGGAGCGGG + Intronic
903828834 1:26162858-26162880 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
903855744 1:26336795-26336817 CGGGGCGGGCCCGGGCGAGCCGG - Intronic
903907215 1:26695958-26695980 CGGGGAGGGAGGGAGGGAGCGGG - Intergenic
904468027 1:30719339-30719361 CGGGGCTGGGTGGGGGGATCCGG + Intronic
904618951 1:31764146-31764168 GGGCGGGGGAGCGGGGGAGCGGG - Intronic
904775249 1:32902101-32902123 CGGGGCGGGGGGGGGGGTGCGGG - Intergenic
904837727 1:33349815-33349837 CGGGGCGGGAGCGCGGGCGGCGG + Intronic
904899279 1:33843791-33843813 CAGGGCGTGAGGAGGGGATCAGG - Intronic
905553045 1:38859372-38859394 CGGGGAGGGGGCGGGGGACTGGG + Intronic
905802517 1:40854309-40854331 GGGGGCGGGGGCGGGGGGGCGGG - Intergenic
906044405 1:42817061-42817083 CGGGGCGGGGTCGGGGGGCCGGG - Intronic
906315552 1:44784516-44784538 CAGGGCGGGAGCGGGGACGCGGG + Intronic
906488163 1:46247490-46247512 CGGGGCGGGGGCGGGGGTGGCGG - Intergenic
906535843 1:46550521-46550543 CTGGGCGGGGGCGGGGGGTGGGG + Intronic
907012676 1:50978060-50978082 GGAGGCGGGAGCGGGGGGGCGGG + Intergenic
907689143 1:56645245-56645267 CGGGGCGGGCGCGGGGTCCCGGG - Intronic
908477776 1:64505875-64505897 CGGGGACGAAGCGGGGGACCCGG - Intronic
908792687 1:67798537-67798559 CGGGGTGGCAGAGGGGGATGGGG - Intronic
908979260 1:69934494-69934516 CGGGGGGGGGGCGGGGGGTGGGG + Intronic
909078383 1:71080644-71080666 CGGGGCGGGGGAGGGGGGTGGGG + Intronic
910188874 1:84574541-84574563 CGGGGCGGGCGTGGGAGGTCGGG + Intergenic
910856668 1:91702761-91702783 CTGGCCGGGAGCGGTGGCTCAGG + Intronic
910981238 1:92961538-92961560 CGCGGCGGGGGCGGGGGAGTGGG - Intergenic
911144816 1:94541849-94541871 CGGGCCGGGGGCGGGGAGTCGGG - Intergenic
911621202 1:100067802-100067824 GGGGGCGAGAGTGGGGGAACTGG - Intronic
914869077 1:151458681-151458703 AGGGGCGGGGGCGGGGGCGCGGG - Intronic
915467107 1:156104229-156104251 CGGGTGGGGAGCGGTGGCTCAGG + Intronic
915490040 1:156245748-156245770 AGGCGCGGGAGCGCGGGGTCTGG - Intronic
915571442 1:156747247-156747269 CGGGGCGGGGGGGGGGGGGCGGG - Intronic
915629208 1:157138575-157138597 CGGGGCGGATGCGCGGGATGCGG - Intergenic
915972915 1:160366869-160366891 GGGGCGGGGAGCGGGGGAGCAGG - Intergenic
917080418 1:171252219-171252241 TGGGGTGGGATCGGAGGATCTGG - Intronic
917777055 1:178349078-178349100 CGGGCCGGGCGCGGTGGCTCAGG - Intronic
919486935 1:198157347-198157369 CGGGCCGGGAGAGGGAGGTCGGG + Intronic
919712074 1:200738836-200738858 GGGGGCGGGGGCGGGGGTTGGGG + Intergenic
920190419 1:204190410-204190432 CGGGGCGGGGGCGGGGGGCGGGG - Exonic
920215727 1:204360372-204360394 TGGGGGGGGGGCGGGGGATGGGG - Intronic
920336048 1:205246050-205246072 CGGGGCGTGAGCAGGGCATCTGG + Intronic
921104170 1:211959480-211959502 CGGGGAGGGAGCAGGTGAGCCGG - Intronic
922116357 1:222618010-222618032 CGGGGCGGGGACGGGGGGGCTGG - Intergenic
922315064 1:224434634-224434656 CGGGGCGGCTGCGGGGGCGCGGG + Intronic
922757128 1:228102790-228102812 CTGGGCGGGAGCGGGGCTGCGGG - Intronic
924436559 1:244048611-244048633 GGGGGCGGGCGCGGGGGAGGGGG - Intergenic
924539896 1:244970754-244970776 CGGGGCGGGAGGAGGGGAAGAGG - Exonic
1062857048 10:784667-784689 CGGGGCGGGAGGTGGGGGGCAGG - Intergenic
1064234972 10:13565370-13565392 CGGAGCAGGAGCAGGGGATGGGG - Intergenic
1064712359 10:18140531-18140553 CGGGACGGGGCCGGGGCATCGGG - Intergenic
1065186519 10:23174598-23174620 CGGGGCGGGGGCGGGGGATTGGG - Intergenic
1065590347 10:27256752-27256774 CGGGGCGGGAGCGGGGGTGGGGG - Intergenic
1065590361 10:27256776-27256798 CGGGGCGGGAGCGGGGGTGGGGG - Intergenic
1065590375 10:27256800-27256822 CGGGGCGGGAGCGGGGGAGGGGG - Intergenic
1065590387 10:27256820-27256842 CGGGGCGGGAGCGGGGGGGGCGG - Intergenic
1065636958 10:27743332-27743354 CGGAGCGGGAGCGGGGTGGCCGG - Exonic
1067711841 10:48656274-48656296 GGGGGCGGGGGGGGGGGATGCGG + Intergenic
1067969941 10:50958388-50958410 GGGGGGGGGAGCGGGGGGTGGGG + Intergenic
1073207425 10:101776286-101776308 CGGGGCGGGGGCGGGGCGGCCGG + Intronic
1073217286 10:101843573-101843595 CCGGGCGGGAGCGGGGCGCCGGG - Intronic
1073392803 10:103193186-103193208 CGGGGAAGGAGCGGGCGAACGGG - Intronic
1073717797 10:106127873-106127895 TGGGGAGGGAGCAGGGCATCAGG - Intergenic
1075616134 10:123891866-123891888 CGGGGCGGGCGCAGGGGGGCCGG + Intronic
1075795821 10:125118719-125118741 GGGGGTGGGAGGGGGGGATGGGG + Intronic
1076146558 10:128126545-128126567 CGGGGAGGGGGCGGGGAAACCGG + Intergenic
1076707094 10:132307991-132308013 CGGGGCAGGGGCGGGGCTTCTGG + Intronic
1076908205 10:133373589-133373611 TGGGGCGGGGGCGGGGGCGCGGG - Exonic
1077253774 11:1571855-1571877 GGGGGCGGGCGCCGGGGATGGGG - Intronic
1077675061 11:4187823-4187845 CGGGGCCTGAGCGGGGGCTGGGG + Intergenic
1079055955 11:17207317-17207339 CGCGGTGGGAGTGGGGGGTCCGG + Intronic
1080657100 11:34266760-34266782 GGGGGTGGGGGAGGGGGATCTGG - Intronic
1081636772 11:44727043-44727065 CGGGGCCGGGGCTGGGGCTCGGG - Intronic
1081663553 11:44903191-44903213 GGGGGCAGGAGGGGGGAATCAGG + Intronic
1081870349 11:46380328-46380350 TGGGGCAGGAGCGGGGGCTGGGG - Exonic
1081979033 11:47254750-47254772 CAGGGTGGGAGAGGGGGAACAGG - Intronic
1081981707 11:47270497-47270519 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1082105388 11:48215785-48215807 CGGGCCGGGAGCAGTGGCTCAGG - Intergenic
1083418997 11:62543070-62543092 GGGGGCTGGAGCGGAGGTTCTGG - Intronic
1083571229 11:63763257-63763279 CCGGGCGGAGACGGGGGATCGGG - Exonic
1083618117 11:64036224-64036246 CGGGGCGGGGGCCGGGGGCCCGG + Intronic
1083648371 11:64186147-64186169 AGGGGCGGGAGCCGGGGTCCCGG + Intronic
1083828747 11:65217738-65217760 CAGGGCGGGGGCGGGGGGACAGG + Intergenic
1083886503 11:65575978-65576000 CGGGGCAGGAGCGCGGGGGCGGG - Intergenic
1083900804 11:65642379-65642401 TGGGCCGGGATCGCGGGATCAGG + Intronic
1083936507 11:65872548-65872570 CGGGGCGGGGGCGGGGTGGCCGG - Intronic
1084145221 11:67261624-67261646 GAGGGCGGGGGCGGGGGTTCGGG + Intergenic
1084284065 11:68120689-68120711 CGGGGCGGAGGCCGGGGACCGGG - Intronic
1084650280 11:70485533-70485555 CCCGGCGGGGGCGGGGGAGCGGG + Intronic
1084940693 11:72611371-72611393 TAGGGTGGGAGCTGGGGATCGGG - Intronic
1085544179 11:77301703-77301725 CGGGGCGGGAGGGGGCGGCCTGG + Intergenic
1085645002 11:78217133-78217155 AGAGGCAGGAGTGGGGGATCAGG - Exonic
1088939489 11:114439305-114439327 CGTGGCGGGGGTGGGGCATCTGG + Intronic
1089014325 11:115154186-115154208 CGGGACGGGAGCGCGGGACCGGG - Intergenic
1089160079 11:116430460-116430482 AGTGGCGGGGGCGGGGGGTCAGG - Intergenic
1089418797 11:118315679-118315701 GGAGGAGGGAGCGGGGGATCAGG - Exonic
1089556229 11:119317182-119317204 CGGGGCGGGCCCGGGCGCTCCGG - Intronic
1089796661 11:120986293-120986315 CGGGGCGGGAGGGGAGGGGCGGG + Exonic
1091460813 12:642667-642689 CGGGCTGGGAGTGGGGGATCCGG + Intronic
1091587814 12:1826395-1826417 CGGGGGGGGGGGGGGGGCTCTGG - Intronic
1091740802 12:2959351-2959373 CGCGGCGGGAGGGAGGGAGCCGG - Intronic
1092861894 12:12725641-12725663 CCGGGCGGGCGCGGGGGCTGGGG - Intergenic
1093518186 12:20015940-20015962 AGGGCCGGGAGCGGTGGCTCAGG - Intergenic
1096241330 12:49961800-49961822 CGGGGCCGGCGCGGGGGGGCAGG - Intergenic
1096750652 12:53756783-53756805 GGGGTAGGGAGCAGGGGATCTGG + Intergenic
1097267543 12:57755032-57755054 CGGGGCGGGCGCCGGGGAGCGGG - Intronic
1097929422 12:65168203-65168225 CGGGGCGGGGGGCGGGGGTCAGG - Intergenic
1101639727 12:106579327-106579349 GGGGGTGGGAGGGAGGGATCAGG - Intronic
1102116004 12:110403458-110403480 CGGTCTGGGAGCGGGGGCTCAGG - Intronic
1102854120 12:116278008-116278030 CGGGGCGGGACCGTGGGTCCCGG + Intergenic
1103096513 12:118136632-118136654 TGTGGGGGGAGAGGGGGATCCGG - Intronic
1103568716 12:121830313-121830335 GGGGGCGGGCGCGGGGGGCCGGG - Exonic
1104772002 12:131369392-131369414 GAGGGCAGGAGCTGGGGATCCGG - Intergenic
1105502888 13:20988343-20988365 CGGGGCGGGGGCGGGGGCGGGGG + Exonic
1106075567 13:26458034-26458056 CGGAGCGGGGGCGGGGGCTCAGG - Intergenic
1106340105 13:28819774-28819796 TGGGGCGGGGGCGGGGGCTGGGG + Intergenic
1107787760 13:43971579-43971601 TGGGGCAGGAGCGGGGGCTGGGG - Intergenic
1108292717 13:48976590-48976612 GGGGGCGGGGGCGGGGGCTGGGG + Exonic
1108518310 13:51222692-51222714 CCAGGAGAGAGCGGGGGATCCGG - Intronic
1111672510 13:91348176-91348198 CGGGGCGGGAGGGTGGGAGGGGG + Intergenic
1111764743 13:92514133-92514155 TGGGGCGGGGGCGGGGGGGCAGG - Intronic
1112050652 13:95641877-95641899 CGCGGCGGGAGGCGGGGATGGGG + Intronic
1112402444 13:99087594-99087616 CGGGGCGGGAGCGGGCCCTTAGG - Intergenic
1113418559 13:110151696-110151718 CGGGGCTGCAGCTGGGGCTCGGG + Intronic
1113660465 13:112103841-112103863 GGGGGCGGGGGCGGGGGCGCGGG + Intergenic
1113730816 13:112640159-112640181 TGGTGCGGGAGCATGGGATCAGG + Intergenic
1113962324 13:114132774-114132796 CGGGGCGGGGGCGGGGGCCGAGG - Intergenic
1114270706 14:21098425-21098447 CGGGCCGGGGGCGGGGGGGCCGG - Exonic
1114270731 14:21098462-21098484 AGGGCCGGGGGCGGGGGACCGGG - Exonic
1114516378 14:23302403-23302425 CGGTGCGTGAGCGCGGGATCGGG + Exonic
1115028276 14:28766943-28766965 GGGGGGGGGAGCGGGGGGTGGGG + Intergenic
1115398584 14:32934899-32934921 CGGGGCGGCCGCGGGGGTGCCGG + Intergenic
1116435051 14:44887149-44887171 GGGGGCGGGAGTGGGGAAACTGG + Intergenic
1116817918 14:49599935-49599957 CGGGGCCGGGGCGGGGGCTCCGG + Intronic
1116861792 14:50001333-50001355 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1116861797 14:50001345-50001367 GGGGGCGGGGGCGGGGGTGCAGG + Intronic
1117029202 14:51651790-51651812 CGGGTCGGGGGCGGGGTCTCAGG + Intronic
1117744460 14:58854190-58854212 CGGGCCGGGTGCGGTGGCTCAGG - Intergenic
1118932427 14:70255059-70255081 CGGGGAGGGGGTGGGGGCTCAGG - Intergenic
1118932442 14:70255091-70255113 CGGGGAGGGGGTGGGGGCTCAGG - Intergenic
1119303653 14:73590569-73590591 CACGGCGGGGGCGGGGGCTCAGG + Intergenic
1121321518 14:92994358-92994380 AGGGGCGGGAGAGTGGGATGAGG + Intronic
1121645750 14:95516423-95516445 CGGCGCGGGGGCGGGGGCCCCGG - Intronic
1121935792 14:98017318-98017340 CTGGGCTTGAGTGGGGGATCCGG - Intergenic
1122325834 14:100880218-100880240 GGGGGCGGGGGCGGGAGCTCAGG + Intergenic
1122904342 14:104795163-104795185 CGGGCCTGGAGCTGGGGCTCGGG - Intronic
1122959214 14:105086991-105087013 CCGGGCGCGGGCGGGGGAACTGG - Intergenic
1123037983 14:105479066-105479088 GGGGGCGGGGGCGGGGGTCCGGG - Intronic
1123037985 14:105479072-105479094 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1123541870 15:21300020-21300042 AGGGGTGGGAGTGGGGGATTGGG + Intergenic
1123741510 15:23284877-23284899 CGGGGCGGGTGTGGTGGGTCTGG - Intergenic
1123745487 15:23317681-23317703 CGGGGCGGGTGTGGTGGGTCTGG + Intergenic
1124267493 15:28250044-28250066 CGGGGCGGGTGGGGTGGGTCTGG - Intronic
1124277759 15:28340998-28341020 CGGGGCGGGTGTGGTGGGTCTGG + Intergenic
1124957224 15:34367313-34367335 CGCGGCGGGCGCGGAGGAGCAGG - Intergenic
1125328956 15:38564384-38564406 CGGGGAGGGAGCTGGGGCTGAGG - Intronic
1125675838 15:41502256-41502278 CGGGGCGGGAGCGGGGGATCGGG - Intronic
1126849093 15:52786836-52786858 GGGGGCGGGGGTGGGGGATGGGG + Intronic
1127875185 15:63105986-63106008 CAGGCCGGGAGCGGTGGCTCAGG - Intergenic
1127982722 15:64046382-64046404 CGCGGCGGGAACGGGGGACGCGG + Intronic
1128061210 15:64737022-64737044 AGGGGTGGGAGCGGGGGTTGGGG - Intergenic
1128153550 15:65377868-65377890 CGGGGCCGGGGCTGGGGCTCCGG + Exonic
1129154615 15:73709981-73710003 AGGGGTGGGAGCAGGGGCTCCGG + Intronic
1129360934 15:75023667-75023689 CGGCGCGGGAGGGGAGGTTCGGG + Intronic
1129423991 15:75451706-75451728 CGGGGCGGGGTCGGGGGAGTGGG - Intronic
1129424616 15:75454680-75454702 TGGGGCGGGGGCGGGGGCGCGGG - Intronic
1129791199 15:78341621-78341643 CCGGGCGGGCGCGGGGGATACGG - Intronic
1130072896 15:80664018-80664040 GGGGGTGGGAGCTGGGGATCAGG + Intergenic
1131004223 15:88963312-88963334 CGGGGCAAGAGAAGGGGATCTGG + Intergenic
1132683441 16:1153008-1153030 CGGGGCGGGCGGGGGGGTACTGG - Intergenic
1132698433 16:1212200-1212222 CGGGGCGGGAGTGGAGGGGCTGG - Intronic
1132735181 16:1382447-1382469 CGGGGCGGGGGCAGGGGCACAGG - Intronic
1132843614 16:1990216-1990238 AGGGGCGGGAGCGGGGGCCCGGG - Intronic
1132889459 16:2196669-2196691 CGGGGCGGGGGCGCGGCACCTGG + Intergenic
1132907032 16:2287989-2288011 GGGGGCGGGACGGGGGCATCGGG - Intronic
1132934910 16:2475260-2475282 GGGGGCGGGAGCGTGGGGGCCGG + Intronic
1133036521 16:3036784-3036806 CGGGGCGGGGGCAGGGGAACCGG - Intronic
1133053878 16:3135124-3135146 CGGGGCGGGGACGGGGCCTCTGG + Exonic
1133282101 16:4672469-4672491 CGTGGCGGGAGCGGAGCACCTGG + Intronic
1133332958 16:4987768-4987790 GGGCGCGGGAGCTGGGGACCAGG + Intronic
1134851000 16:17478946-17478968 GGGGGCGGGAGTGGGAGATGGGG + Intergenic
1136146593 16:28320022-28320044 CGGGGCGGGCGCTGGAGAGCTGG + Intronic
1136535591 16:30897125-30897147 TGGGGCGGGGGCGGGGCACCGGG + Intronic
1137374892 16:47944150-47944172 TGGGGTGGGAGCCGGGGGTCAGG + Intergenic
1137644949 16:50065929-50065951 CGGGGCGGGGTGGGGGGAACTGG - Exonic
1138178597 16:54928376-54928398 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1138273841 16:55716610-55716632 CGGGGCGGGGGCGGGGGGAGGGG + Intergenic
1139470990 16:67178144-67178166 CGGGGTGGGGGCGGGGCTTCGGG - Intronic
1140215130 16:73000973-73000995 CGGGGTGGGATTGGAGGATCTGG - Intronic
1140663990 16:77212429-77212451 CGGGGGCGGAGCGGGGGACCTGG - Intronic
1140949891 16:79806833-79806855 CGGGGTGGGGGGGGGGGGTCAGG + Intergenic
1141490354 16:84368428-84368450 CGGGGCGGGGCCGGGTGAGCCGG + Intergenic
1142005503 16:87687835-87687857 CGGGGCGCCATCGGGGGATGGGG + Intronic
1142029703 16:87832382-87832404 CTGGGAGGGGGTGGGGGATCTGG - Exonic
1142042027 16:87900337-87900359 TGGGGCGGCAGGGGGTGATCTGG + Intronic
1142201100 16:88761529-88761551 CGGGGTGGGGGCGGGTGAGCTGG + Intronic
1142352735 16:89587336-89587358 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1142403526 16:89873560-89873582 GGGGTCGGGGGCGGGGGAGCTGG - Intergenic
1142582594 17:951559-951581 GGGGGCGGGGGCGGGGGTTGGGG + Intronic
1142848133 17:2691934-2691956 CGGGGCGGGGGCGGGGCCGCGGG - Intronic
1143492268 17:7291400-7291422 CGGGGCGGGAGGGGAGGTGCGGG - Intronic
1143537259 17:7549019-7549041 CGGGGCGGGAGGGGGCGCTGGGG - Exonic
1143586751 17:7854312-7854334 CGGGTCGGGAGTGGGGGGACTGG - Exonic
1143893544 17:10120093-10120115 CGGGGCGGGGGCAGGGGGACAGG - Intronic
1145227521 17:21142678-21142700 CGGGGCGGGGGAGGGGGGTGAGG - Intronic
1145243608 17:21253332-21253354 CGGGGCTGGAGCGCGGGCGCAGG + Exonic
1145750658 17:27353398-27353420 CGGGGTGGGGCCGGGGGATCCGG + Intergenic
1145980014 17:29005762-29005784 GGGGGCGGGAGCGGGGCCCCAGG - Intronic
1146271364 17:31487955-31487977 CGGGGCGGGGGCGGGGGCGGAGG - Intronic
1146772142 17:35578685-35578707 CGGGGCGGGAGCGGAAGCTCAGG - Intronic
1146935061 17:36808206-36808228 CGGGGATGGAGCGGGAGAGCCGG - Intergenic
1147044292 17:37742306-37742328 CCGGCCGGGAGCCGGGGACCGGG + Intronic
1147440223 17:40443352-40443374 CGGGGCGGGCGAGGGGGAGAGGG - Intergenic
1147705527 17:42422580-42422602 CGGGCCGGGCGCGGGAGCTCTGG + Intronic
1148048715 17:44759081-44759103 CGGGGCGGGGGCGCGGGGCCGGG - Exonic
1148173109 17:45540303-45540325 CGGGCCGGGTGCGGTGGCTCAGG + Intergenic
1148183968 17:45627887-45627909 GGGGGCCGGAGAGGGGGATCAGG + Intergenic
1148276160 17:46305147-46305169 CGGGCCGGGTGCGGTGGCTCAGG - Intronic
1148298277 17:46522722-46522744 CGGGCCGGGTGCGGTGGCTCAGG - Intronic
1148551917 17:48555666-48555688 CGGGGCGGGGGCGGGGGGGCGGG - Intronic
1148755767 17:49972239-49972261 CGGTGCCGCCGCGGGGGATCTGG - Intronic
1149833679 17:59893365-59893387 CGGGGCGGCGGCGCGGGCTCAGG + Intronic
1150404314 17:64887226-64887248 CGGGCCGGGTGCGGTGGCTCAGG + Intronic
1151313914 17:73310828-73310850 CTGGGCGGGAGCCGGGGCTGAGG - Intronic
1151511916 17:74566010-74566032 CGGGGAGGGGGCGGGGGGGCAGG + Intergenic
1151711421 17:75809094-75809116 GGGGGCGGGGGCGGGGGGGCGGG + Intronic
1151732161 17:75917953-75917975 AGGAGCGGGAGCTGGGGATCCGG - Exonic
1151797095 17:76353631-76353653 CGGGGCGGGCGCGCGGGACGCGG + Exonic
1151822500 17:76504287-76504309 TGGGGAGGCAGCGGGGGCTCAGG + Intergenic
1152226814 17:79096615-79096637 CCGGGAGGGAGGGTGGGATCAGG - Intronic
1152354078 17:79798214-79798236 CGGGCCGGGCGCCGGGGTTCGGG - Intronic
1152479095 17:80538050-80538072 GGGAGCGGGAGCGGGGGAGGGGG + Intergenic
1152527684 17:80898645-80898667 CGGGGGGGGAGCGGGGGCAGGGG - Intronic
1152552098 17:81035024-81035046 CCGGGCGGGGGCGGGTGGTCGGG + Intergenic
1152654959 17:81515033-81515055 CGGGGCGGGAGCCGGGCGTGGGG + Intronic
1152658296 17:81530153-81530175 AGGGCAGGGAGCTGGGGATCGGG + Intronic
1152675249 17:81636880-81636902 CCGGGCGGGAGCGGGGACGCCGG - Intronic
1152697497 17:81804314-81804336 CGGGGCGGGCGCGGCGGGGCCGG + Intronic
1152711221 17:81871247-81871269 CGGGGCGGAGGCGGCGGGTCGGG - Intronic
1152735817 17:81996309-81996331 GGGGGCGGGAGAGGGTGAGCCGG + Intronic
1152748415 17:82051638-82051660 CGGGGCCGGGGCGGGGGTCCGGG + Exonic
1152778457 17:82216064-82216086 AGGGGCGGGAGGGGGCGATGTGG - Intergenic
1152921378 17:83068192-83068214 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921392 17:83068226-83068248 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921555 17:83068668-83068690 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152921625 17:83068842-83068864 GGGGGCGGCAGCGGGGGTCCCGG + Intergenic
1152924374 17:83080497-83080519 CGGGGCAGGGGCGGGGGGCCCGG - Intronic
1203163983 17_GL000205v2_random:77255-77277 CCGGCCGGGTGCGGTGGATCAGG - Intergenic
1154005772 18:10526234-10526256 GGGGGCGGGAGGGAGGGCTCAGG + Intronic
1154113432 18:11590231-11590253 GGGGGCTGGAGTGGGGGATCAGG + Intergenic
1154216555 18:12420528-12420550 GGGGGCGGGAGTGGGGGAGTCGG - Intronic
1155128155 18:22901326-22901348 CGGAGCGGGGGCGGGGGGTGGGG - Intronic
1155654399 18:28177294-28177316 TGGGGAGGGGGCGGGGGAACAGG + Exonic
1156275780 18:35581677-35581699 GGGGGCGGGCGCGGCGGAGCGGG + Intronic
1157610104 18:48950614-48950636 CGGGGCGCGCGCGGGGGCCCGGG + Exonic
1159221666 18:65472952-65472974 CGGGCCGGGCGCGGTGGCTCAGG - Intergenic
1160080753 18:75725213-75725235 TGGGGCGGGGGCGGGGGGTGGGG - Intergenic
1160499601 18:79395521-79395543 AGGGGCGGGAACGGGGAATCCGG - Intergenic
1160500779 18:79400351-79400373 CGGGGCGGGAGCCGGGGTCGCGG - Intronic
1160597758 18:79988799-79988821 CGGGGCGGGAGCGTGGGGGCAGG - Intronic
1160680309 19:409076-409098 CGGGGCTGGCGCGGGGGACGCGG + Exonic
1160724854 19:613566-613588 CGGGGCCGGGGCCGGGGATGGGG + Intronic
1160768775 19:821348-821370 CGGGGCAGGACCGGGGTGTCCGG - Intronic
1160835432 19:1122615-1122637 GGGGGCGGGAGCGGGGGTGGGGG - Intronic
1161041238 19:2111714-2111736 CGAGGAGGCAGCGGGGGAGCCGG - Exonic
1161141320 19:2649865-2649887 GGGGGCCGGGGCTGGGGATCGGG - Intronic
1161210247 19:3062098-3062120 GGGGCCGGGAGCCGGGGGTCGGG + Intronic
1161266367 19:3366529-3366551 CGGGGCGGGGGGGGGGGTTGGGG + Intronic
1161270682 19:3387808-3387830 TGGGGCGGGAGAGGGTGACCCGG + Intronic
1161292835 19:3504775-3504797 AGGGCTGGGAGAGGGGGATCAGG - Intergenic
1161428214 19:4216203-4216225 GGGGGCTGGAGTGGTGGATCAGG - Intronic
1162033069 19:7925676-7925698 CGAGGCGCGGGCGGGGGATGGGG - Intronic
1162312382 19:9914659-9914681 CGGGCCGGGAGCGGGGTCCCCGG - Intronic
1162413092 19:10517986-10518008 GGGGGCGGGAGCGGGAAATTGGG - Intergenic
1162481257 19:10928336-10928358 CGGGGCGGGAGTGGGAGATCCGG + Intronic
1162802445 19:13118718-13118740 CGGGGCAGGTACCGGGGATCCGG + Intronic
1163505345 19:17702518-17702540 CGGGGCGGGGGAGGGGGACAAGG + Intergenic
1163531091 19:17849238-17849260 CGTGGGGGGACAGGGGGATCAGG + Intergenic
1163708707 19:18832650-18832672 CGCGGCCGGAGCGGGGGACCCGG - Intronic
1164309435 19:24033317-24033339 CGGGGCGGGGGCAGGGGGTGGGG + Intergenic
1164648140 19:29873752-29873774 CGGCGCGGGCGCGGGGGCGCGGG - Intergenic
1165157454 19:33796815-33796837 CGGGGCGGGAGGGGTGGGTGGGG + Intronic
1165373597 19:35425873-35425895 CTGGGCTGGAGCTGGGGAGCTGG + Intergenic
1165738458 19:38192321-38192343 GGGGTCGGGAGCGGGGGACAGGG - Intronic
1166068388 19:40373589-40373611 AGGGGGGGAAGCGGGGGAGCGGG + Intronic
1166094195 19:40529461-40529483 CGGGGCGGGCGGTGGGGATAAGG + Intronic
1166104202 19:40589510-40589532 CGGGGTGGGATGGGGGGACCAGG + Intronic
1166361270 19:42253929-42253951 CGGGGCGGGGACGGGGGAGGGGG - Intronic
1166785359 19:45363957-45363979 CTGGGGGGCAGCGGGGGGTCGGG + Intronic
1166892097 19:46000079-46000101 CGGGAGGGGAGAGGGGGCTCAGG + Intronic
1166978151 19:46617168-46617190 GGGGGTGGGAGCGCGGGAGCTGG + Intergenic
1167074463 19:47240197-47240219 GGGGCGGGGAGCGGGGGAGCGGG - Intergenic
1167268278 19:48493966-48493988 CGGGGCGGGAGCGCCGGGGCCGG - Exonic
1167862537 19:52297122-52297144 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1168056089 19:53866166-53866188 GGGTCCGGGAGCTGGGGATCCGG - Intergenic
1168064046 19:53909390-53909412 CGGGGCGGGGGCGGGGGGCGCGG + Exonic
1168307312 19:55442641-55442663 CGGGGCGGGCGCGGCGGCCCGGG - Exonic
1168336571 19:55600503-55600525 CGGGGCGCGAGCGCGGGAGCAGG - Intronic
1168536031 19:57171926-57171948 GGGGGCGCGAGCGGGGGTCCGGG + Intergenic
1168645923 19:58059360-58059382 CGGGCCGGGTGCGGGGGGTCCGG + Intronic
926474753 2:13308425-13308447 TGGGGCGGGAGGGGAGGCTCAGG + Intergenic
927157941 2:20232345-20232367 AGGGGCGGGGGGGGGGGAGCTGG + Intergenic
927168761 2:20350937-20350959 CGCGGCGGCAGCGCGGGAGCAGG - Intronic
927714243 2:25342016-25342038 AGGGGTGGGAGGGGGGGACCCGG - Intronic
928093872 2:28392539-28392561 CGGGGGGTGAGCGGGGGACTGGG + Intronic
928392230 2:30918719-30918741 CGGGCAGGGAGGGGGGTATCAGG + Intronic
928421206 2:31138698-31138720 CGGGGCGGGAGCGGTGCACTCGG + Intronic
929966911 2:46542991-46543013 CGGGGCCGGGGCGGGGGCTCCGG + Exonic
929983187 2:46699483-46699505 CGGCGCGGGGGCCGGGGAGCAGG - Intronic
930011518 2:46941399-46941421 CCGGGCGGCAGCGGGGGCCCGGG - Exonic
930135917 2:47904973-47904995 AGGAGCGGGAGAGGGGAATCGGG - Intronic
931364446 2:61606664-61606686 CGGGGGGGTGGCGGGGGAGCGGG + Intergenic
931649385 2:64454455-64454477 CGGGGCGGGGGCGGGGGCGCGGG - Exonic
932399018 2:71466785-71466807 CAGGGCGGGAGCGGGAGCACCGG - Exonic
932725720 2:74178546-74178568 CGAGGCGGGGGCGGGGTAGCTGG - Intronic
932812134 2:74834457-74834479 CGGGCCGGGAGCTGGGAGTCCGG - Exonic
933752480 2:85611867-85611889 CGGGGCGGTACCGAGCGATCTGG + Exonic
934090967 2:88550066-88550088 CGGGGCTGGGGCAGGGAATCTGG - Intergenic
934125895 2:88889758-88889780 CGGGGGGAGAGCGGGGGCTAGGG - Intergenic
934530918 2:95088028-95088050 CGGGGCGGGGGTGGGGGAAGAGG + Intronic
934576208 2:95403012-95403034 CGGGGCTGGAGCTGGGCATATGG + Intronic
934636251 2:95992213-95992235 CGAGGCGGGAGGACGGGATCTGG + Intergenic
934797397 2:97113213-97113235 CGAGGCGGGAGGACGGGATCCGG - Intergenic
934993186 2:98935863-98935885 CGGGGTGGGCGCGGGGGCACCGG - Intronic
935592479 2:104855372-104855394 CGGGGCGGGGGCGGGGAAGGAGG + Intergenic
937261146 2:120587411-120587433 CGGGCCGGGGCAGGGGGATCCGG - Intergenic
938296399 2:130182149-130182171 AGGGGCGGGAGCGCGGGGACGGG - Exonic
938455668 2:131460943-131460965 CGGGGCCGGGGCGGGGGCTCCGG + Intergenic
940009549 2:149039039-149039061 CGGGACGGGAGCAGGGGGCCGGG + Intronic
942324059 2:174760545-174760567 CTGGGGGGGAGAGAGGGATCGGG + Intronic
943682868 2:190786369-190786391 GGGGGGGGGAGCGGGGGCTGGGG - Intergenic
944743498 2:202634776-202634798 CGGGGAGGGAGCGGAGGAAATGG - Intergenic
946329553 2:219001704-219001726 CGGGGCGGGAGCGGAGGGCCCGG + Intergenic
946373524 2:219294826-219294848 AGGGGTGGGAGCGTGGGGTCTGG + Intronic
947398797 2:229713413-229713435 CGGGGCGTGAGCAGGGCACCGGG - Intronic
948046856 2:234951939-234951961 GGGGGCGGGGGCGGGGGCGCGGG - Intergenic
948492062 2:238320305-238320327 CGGGGCGGGGAAAGGGGATCTGG - Intergenic
948697309 2:239738203-239738225 CGGGGCCGGGGCCGGGGATGGGG - Intergenic
948781672 2:240325340-240325362 TGGGGAGGGAGCGGGGAAGCAGG - Intergenic
948824856 2:240569122-240569144 CGGGGCGGGCGCCGGGGCTGCGG + Intronic
1168760484 20:347060-347082 CGGGGCGGGGGAGGGGGCGCCGG - Exonic
1170286166 20:14711706-14711728 TGGGGCTGGGGCGGGGGATTTGG - Intronic
1171377307 20:24702433-24702455 AGGGGCAGGAGCAGGGGATGGGG + Intergenic
1171473643 20:25390914-25390936 CGGGGCGGGGCCGGGGGAGGGGG - Exonic
1172100455 20:32481959-32481981 CGGGGCGGGGGGGGGGGAGCAGG + Intronic
1172100937 20:32483649-32483671 CGGGGCGGGGGCGGGGGGGAGGG + Intronic
1172112652 20:32556445-32556467 CAGGGCTGGAATGGGGGATCAGG - Intronic
1172118028 20:32583453-32583475 GGAGGGGGGAGCGGGGGAGCGGG + Intronic
1172474570 20:35226999-35227021 CGGGGCCGGGGCGCGGGCTCGGG + Intronic
1172536186 20:35675117-35675139 GGGGGCAGGAGCGGGGTATGCGG - Exonic
1172873910 20:38152773-38152795 CGGGGCGGGAACTGTGGAGCTGG - Intronic
1174133218 20:48360173-48360195 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1174143097 20:48430720-48430742 AGGGGTGGGAGAGGAGGATCAGG + Intergenic
1174558447 20:51412976-51412998 GGCGGCGGGAGCGGGGGATGGGG - Intronic
1174656388 20:52175847-52175869 GGGGGCGGCAGCGGGGGTGCGGG - Intronic
1174764064 20:53235132-53235154 CGGGGCGGGGGGGGGGGAATGGG + Intronic
1175839726 20:62019313-62019335 CGGGCAGGGAACGGGGGAGCTGG - Intronic
1176140281 20:63541931-63541953 CGGGGCTGGAGCTGGTGTTCGGG - Intronic
1176148008 20:63574067-63574089 CGGGGGCGGAGGGGGGGGTCCGG - Intronic
1176380666 21:6110943-6110965 CGGAGGGAGAGCGGGAGATCGGG - Intergenic
1176875650 21:14124405-14124427 CGGGGCGGGGTCGGGGGAGGTGG - Intronic
1178434583 21:32547014-32547036 CAGGGCTGGCGCAGGGGATCTGG + Intergenic
1178534910 21:33403353-33403375 CGGGGCGGGGGCGGGGGCGCGGG + Exonic
1179243847 21:39613105-39613127 CTGGCCGGGAGCGGGGGGCCGGG + Intronic
1179437169 21:41369837-41369859 CGGGGCGGGAGCGGGGGCGGGGG - Intronic
1179664841 21:42903993-42904015 TGGGGCGGCAGAGGGGCATCTGG + Exonic
1179742806 21:43427297-43427319 CGGAGGGAGAGCGGGAGATCGGG + Intergenic
1180064468 21:45405546-45405568 CGGGGCGGGGGTGAGGGAGCCGG - Intronic
1180103033 21:45598765-45598787 CGAGGGGGGAGGGCGGGATCAGG + Intergenic
1180156647 21:45981586-45981608 CGGGGCGGGAGGGGAGGGGCGGG - Intergenic
1180198156 21:46209506-46209528 GGGGGCTGAAGAGGGGGATCAGG - Intronic
1180224775 21:46385902-46385924 AGAGGCGGGAGCGGGAGAACCGG + Exonic
1180891452 22:19291807-19291829 CGGGGCAGGGGCGGGGGAAGGGG - Intergenic
1181028664 22:20139697-20139719 CTGGGCGGGAGCAGTGCATCAGG - Intronic
1181096334 22:20507655-20507677 GGCGGCGGGAGCTGGGGAACAGG + Exonic
1181442351 22:22943203-22943225 AGGGGCTGGAGCAGAGGATCTGG + Intergenic
1182249927 22:28992166-28992188 CGGGGCCGGGGCGGGGGGTTGGG - Intronic
1183214983 22:36473732-36473754 CAGGGCGGGAGCGGTGGGTGTGG + Intronic
1183411044 22:37655326-37655348 CGGGGCTGGAGGGGAGGAGCGGG - Exonic
1183415101 22:37677245-37677267 CAGGGAGGGAGCGGGGGAGGGGG - Intronic
1183545915 22:38454889-38454911 CGGGGCCGGAGCGGCGGGCCCGG + Intronic
1183702520 22:39458035-39458057 CTGGGCGGGTGCGGGGGCTGCGG + Intronic
1184220362 22:43096034-43096056 CGGGCCGGGTGCGGTGGCTCAGG + Intergenic
1184236769 22:43187175-43187197 CGGGGCGGGGGGGGGGGCGCTGG - Intergenic
1184561942 22:45268618-45268640 GGGGGCGGGCGAGGGGGATGGGG - Intergenic
1185038008 22:48489748-48489770 CGGGGCCGGAGGAGGGGGTCCGG - Intronic
1185255284 22:49828020-49828042 CGGGCTGGGAGTGGGGGGTCGGG + Intergenic
1185289066 22:50014959-50014981 CGGAGCGGGTGCGGGGGTGCTGG + Intergenic
1185313747 22:50170252-50170274 CGCGGCGGGAGCGGGGCCGCCGG + Intergenic
1185330604 22:50250573-50250595 GGGGGCGGGAGGCGGGGACCTGG + Intronic
1185338277 22:50280431-50280453 CGGGGCGGCCGCAGGGGCTCTGG - Intronic
949238147 3:1836145-1836167 GGGGGCGGGAGTGGGGGAGATGG + Intergenic
949970437 3:9398366-9398388 GGGGTAGGGAGTGGGGGATCGGG - Intronic
950438495 3:12994163-12994185 GGGGGCGGGGGCGGGCGCTCGGG + Intronic
950474488 3:13206966-13206988 GGTGCCGGGAGCTGGGGATCAGG - Intergenic
950650848 3:14405693-14405715 CTGGGCAGGAGCTGTGGATCTGG + Intronic
950841765 3:15974788-15974810 CGGGGCTGGAGGGGGGAAGCAGG - Intergenic
952451870 3:33440404-33440426 CGGGGCGGGGCCGGGGGAGGCGG - Intronic
953432018 3:42847752-42847774 AGGGGTGGGGGTGGGGGATCTGG + Intronic
953557541 3:43958580-43958602 CGGGCTGGGAGAGGGGGTTCTGG + Intergenic
953562064 3:43999246-43999268 GGGGGCGGGGGCGGGCGGTCAGG - Intergenic
953909187 3:46883206-46883228 CGGGCCGGGGGCGGGGGGCCCGG + Intronic
954337674 3:49929335-49929357 CGGGGCGGGGGTGGGGGAGTGGG + Intronic
954366846 3:50151013-50151035 GGGGGCTGGAGAGGGGGCTCGGG - Intergenic
954613621 3:51958756-51958778 CTGGGCGGCAGTGGGGGAGCAGG - Intronic
954690934 3:52395236-52395258 CGGGGCAAGGGAGGGGGATCTGG - Intronic
954717637 3:52534235-52534257 AGGGGGAGGAGCGGAGGATCTGG - Intronic
954779114 3:53046176-53046198 TGGGGCGGGAGCGGGGCAGCCGG - Intronic
954794934 3:53156642-53156664 CGGGGCGGGAGGGTGGGGCCCGG + Intronic
955356594 3:58237472-58237494 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
955356604 3:58237496-58237518 GGGGGCGGGACCGGGCGCTCGGG + Exonic
955368873 3:58333372-58333394 GGGGGCGGGGGCGGGGGCTGCGG + Intronic
955387713 3:58492368-58492390 CGGGGCCTGGGCGGGGGTTCCGG + Intronic
957040666 3:75333251-75333273 CTGGGAGGGAGCCGGGGGTCTGG - Intergenic
959462504 3:106644107-106644129 GGGAGCGGGCGCGGGGGAGCAGG - Intergenic
960914369 3:122681194-122681216 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
961186248 3:124917749-124917771 GGGGGCGGGGGCGGGGGAGGCGG + Intronic
961383552 3:126510979-126511001 AGGGGCAGGAGGGGGCGATCAGG - Intronic
962272335 3:133987132-133987154 CGGGGCGGGGGCGGGGGGGGGGG - Intronic
962367645 3:134796616-134796638 AGGGGCGGGAGGCGGGGAGCTGG - Intronic
965520076 3:169662566-169662588 CGGGGTGGGGGCGGGGGCACGGG - Intronic
966381385 3:179348014-179348036 GGGGGTGGGATTGGGGGATCCGG + Intronic
966919388 3:184602062-184602084 CGGGGCGGGAGGGGAGGCTGGGG + Intronic
967849490 3:194071200-194071222 CCGGGCGGGAGCCGGGAAACAGG - Intergenic
968092973 3:195909600-195909622 CGGGGCGGGAGGGGAGGGCCGGG - Intronic
968213347 3:196867813-196867835 CGGGGCGGGAGCGCCGGAAGCGG + Intergenic
968473158 4:791173-791195 CGGGGCGGGGGGCGGGGAGCGGG + Intronic
968556226 4:1247762-1247784 CGGGGAGGGGGGGGGGGCTCGGG + Intronic
968596890 4:1490330-1490352 CGGGGTGGGGGCCGGGGCTCCGG - Intergenic
968775436 4:2536964-2536986 CGGGGCGGCGGCGGCGGCTCGGG + Intronic
969240383 4:5893128-5893150 CGGGGCCGGGGCGGGGCCTCTGG + Intergenic
969272300 4:6111128-6111150 CGGGGCTGGGGCCTGGGATCTGG - Intronic
969597833 4:8158897-8158919 CCGGGCGGCAGCGGGGGCGCGGG - Intergenic
969715960 4:8868253-8868275 CGGGCCGGGAGCGGTGCAGCGGG - Exonic
972770977 4:42196857-42196879 GGGGGCGGGGGCGGGGGGTGGGG - Intergenic
973288533 4:48446465-48446487 GGGGGTGGGAGAGGGGGATGTGG - Intergenic
974134069 4:57792335-57792357 CGGGCCGGGCGCGGTGGCTCAGG - Intergenic
974424200 4:61719882-61719904 GGGGGCGGGAGCGGTGGCTCAGG - Intronic
976579695 4:86721687-86721709 GGGGGAGGGAGCGGGGGAGAGGG - Intronic
978998013 4:115179519-115179541 CACGGCGGGGGCGGGGGCTCAGG + Intergenic
979785524 4:124712278-124712300 GGGAGCGGGAGCGGGGCATGGGG - Intronic
979785676 4:124712789-124712811 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
980130380 4:128811663-128811685 CGGGGCGGGCGCGGCGGGCCGGG - Intronic
981529066 4:145734593-145734615 CAGGGCGGGAGTGGGGAAACAGG - Intronic
983919809 4:173333826-173333848 CGGGGCGCGGGCGGGGGCGCGGG - Intronic
984609476 4:181821241-181821263 AGGGCCAGGAGCGGGGAATCTGG - Intergenic
984638936 4:182142991-182143013 GGGGGCGGGAGCTAGGGAGCCGG + Intergenic
984881260 4:184411818-184411840 CAGGGCAGGAGTGGGGCATCGGG - Intronic
985006014 4:185535672-185535694 CGCGGCGGGCGCGGGGGCTTCGG + Intergenic
985472260 5:53555-53577 GGGGGCGGGGGCGGGGAATTAGG + Intergenic
985660862 5:1155923-1155945 CGGGGCGGGCGCGGGAGGCCGGG + Intergenic
985713862 5:1445259-1445281 AGGGGCGGGGGCCGGGGACCGGG - Intronic
985714242 5:1446537-1446559 CGGGGCGGGCGCAGGGGGTGGGG - Intergenic
986330521 5:6713658-6713680 CGGGGCGGGCGCGGGGGCCGCGG - Intergenic
986767267 5:10939370-10939392 AGGGCCGGGCGCGGTGGATCAGG - Intergenic
987342842 5:16953672-16953694 CGGGGCGGGGCCGGGGGTTGTGG + Intergenic
990743693 5:58937221-58937243 GGGGGCGGGAGCAGGGGAGGGGG + Intergenic
990743708 5:58937250-58937272 GGGGGCGGGAGCAGGGGAAGGGG + Intergenic
990955320 5:61333343-61333365 CGGGGCGGGGGAGGGGGCGCGGG + Intronic
992813082 5:80408417-80408439 CGGCCCGGGAGCGGGGAACCGGG - Intronic
993386346 5:87267761-87267783 CGGAGCGGGGGCGGGGGGCCGGG - Intergenic
993646993 5:90474416-90474438 CGAGGCGGGGGCGTGGGATGCGG + Exonic
993905701 5:93621216-93621238 AGGGGCGGGACCGGGTGGTCGGG - Intronic
996091467 5:119355936-119355958 CGGGGCGGGAGAGCGGGTTCTGG - Intronic
997083352 5:130766631-130766653 CAGGGCTAGAGCAGGGGATCTGG - Intergenic
997305047 5:132830568-132830590 CGCGGCGGGGGCGGGGGAGCGGG - Intronic
997581087 5:135017551-135017573 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
997634950 5:135398474-135398496 CCGGGCTGGTGCGGGGGACCGGG - Intronic
1000330218 5:160199808-160199830 CTGGGCTGGTGCGGGGGTTCAGG - Intronic
1002046318 5:176543446-176543468 CGGGGCCGGGGCGGGGGTCCTGG - Intronic
1002211125 5:177600065-177600087 CGCGGCCGGAGCGGCGGACCCGG + Intergenic
1003291276 6:4780407-4780429 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1003536409 6:6979397-6979419 CGGGGCGTGTGCCGGGGGTCAGG - Intergenic
1003624576 6:7729315-7729337 CGGGGTGGGGGCGGGGGGTGAGG - Intronic
1004234230 6:13860143-13860165 AGGGGCGGGAGCCGGGGCTGCGG + Intergenic
1004891914 6:20109195-20109217 GGAGGCAGGAGCGGGGGATGCGG - Intronic
1005626817 6:27670071-27670093 CGTGGCGGGAGTGGTGGATTGGG + Intergenic
1005871097 6:29974924-29974946 AGGGACGGGAGCAGGGGATGAGG + Intergenic
1006089752 6:31621186-31621208 CGGGGCGGCAGCCGGGGAGGGGG - Intronic
1006333662 6:33409966-33409988 GGAGGCGGGAGCGGGGGCTGAGG + Intergenic
1006430641 6:33993588-33993610 CGGGGCGGGGGTGGGGGACGGGG - Intergenic
1006642708 6:35497087-35497109 CGGGGCGGGGGTGGGGGCTGCGG + Intergenic
1006933124 6:37699151-37699173 CGGGGCGGGATCGGAGGCGCGGG - Intronic
1007391618 6:41552709-41552731 CGGGCCGGCAGCTGGGGATCCGG + Intronic
1007431428 6:41779664-41779686 CGGGGCTGGGGGCGGGGATCCGG - Intronic
1007774979 6:44219788-44219810 CGGGGCGGGGCCGGGGGGCCTGG + Intronic
1010142157 6:72623263-72623285 CGGGGAGGCAGCGGGGAACCTGG + Intronic
1010716288 6:79233897-79233919 CGGGGCGGGAGCGGTGGAGTTGG - Intronic
1011226611 6:85114979-85115001 GGGGGCGGGGGCGGGGGCGCCGG + Intergenic
1011640435 6:89412185-89412207 CGGGGCGGGGGAGGGGGCTTCGG - Exonic
1014143078 6:117966132-117966154 CGGGGCGGGAGTGGGGGGGGGGG - Intronic
1016340900 6:143060787-143060809 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1016958405 6:149648750-149648772 CTGGGCGGGAGCGGCGGAAGAGG + Exonic
1017446610 6:154511770-154511792 CGGGGCGGGGGTGGGGGGTTGGG - Intergenic
1017616429 6:156251514-156251536 CAGGGCTGGCGCGGGGGATCTGG + Intergenic
1018191031 6:161309029-161309051 CTGGGCAGAAGCGGGGGCTCAGG + Intergenic
1018856467 6:167678756-167678778 CGGGGCGGGAGGCCGGGATGCGG - Intergenic
1018950854 6:168378003-168378025 CGGGGGGTGAGCGGGAGAACGGG - Intergenic
1018959946 6:168441119-168441141 GCGGGCGGGAGGGGAGGATCCGG + Intergenic
1019343915 7:520544-520566 CGGCGCGGGAGTGGGGGACTGGG - Intergenic
1019472707 7:1229850-1229872 CGAGGCGGGCGCGGAGGATGAGG + Intergenic
1019556544 7:1634305-1634327 CGGGGATGGAGAGGGAGATCCGG - Intergenic
1020140191 7:5607596-5607618 CGGGGAGGATGCGGGGGAACAGG - Intergenic
1020274329 7:6615599-6615621 CGGGCCGGGGGCGGGGGCGCGGG - Exonic
1020987780 7:15157558-15157580 AGGGGTGGGAGTGTGGGATCGGG - Intergenic
1021332894 7:19360404-19360426 CGGGGCAGGGGAGGGGGATAGGG - Intergenic
1023412587 7:39902624-39902646 AGGGCCGGGAGCGGTGGCTCAGG + Intergenic
1023842373 7:44104619-44104641 CGGGGAGGGCGCGGGGGGTCAGG - Exonic
1026638655 7:72105814-72105836 GGGGGAGGGAGAGGGGGATAGGG + Intronic
1027128280 7:75572824-75572846 GGGGGCGGGTGCGGGGCAGCAGG - Intronic
1028963283 7:96773940-96773962 GGGGGTGGGAGCTGGGGATGGGG + Intergenic
1028989532 7:97034610-97034632 CGGGGCGGGGGGGGAGAATCAGG - Intergenic
1029238625 7:99143478-99143500 GGGGGCAGGTGCGGGGGAACGGG + Intronic
1029238697 7:99143674-99143696 CGGGGCGGGCGAGGGGGCGCCGG + Intronic
1029453711 7:100656468-100656490 CGCCGTTGGAGCGGGGGATCCGG - Intergenic
1029745026 7:102512004-102512026 CGGGGCTGGAGGGCGGGATCGGG + Intronic
1029763018 7:102611165-102611187 CGGGGCTGGAGGGCGGGATCGGG + Intronic
1030215999 7:107044610-107044632 CGGGGCGGGGGCGGGGCGCCCGG + Intergenic
1031361830 7:120857371-120857393 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1031689177 7:124766204-124766226 CGGGGCGGGAGTGGGGGGTGGGG + Intergenic
1032020723 7:128405990-128406012 GGGGGCGGGGGCGGGGGCTGCGG + Intronic
1032194046 7:129779757-129779779 GGGGCCGGGAGCGGGGGGGCGGG - Intergenic
1033282763 7:140017621-140017643 AGGGGAGGGAGCGGGTGTTCTGG + Intronic
1034497958 7:151433290-151433312 TGGGGAGGGAACGGGGGACCAGG + Intronic
1034621995 7:152463800-152463822 CGGGGCGAGGGCGGGGAATTAGG + Intergenic
1034964100 7:155381238-155381260 CGGGGCTGGAGAAGGGGATTCGG + Intergenic
1035573219 8:687836-687858 CGGGGCGGGACCGCTGCATCCGG - Intronic
1036785317 8:11681492-11681514 CGGGGGGGGGGGGGGGGATGGGG + Intronic
1038359734 8:26865028-26865050 GGAGGCGGGAGCGCGGGAGCCGG + Exonic
1040549680 8:48428520-48428542 GGGGGCGGGAGCGGGGGAGGGGG + Intergenic
1041690374 8:60680362-60680384 CGGGGCGGGCGCGGCGGCGCGGG + Intronic
1043527478 8:81112166-81112188 CGGGGCGGGAGGGGGCGAGCCGG + Intergenic
1045674103 8:104589093-104589115 CGGGGTGGGAGCAGGCGAGCCGG - Intergenic
1045734107 8:105275183-105275205 TGGGGCGGGAGTGGGGGAGTGGG - Intronic
1047208296 8:122820541-122820563 GGGAGCGGGAGCGGGGGATGGGG + Intronic
1047615411 8:126558523-126558545 CGGGGCGGGGGCGGGGCTCCCGG - Intergenic
1047998600 8:130358696-130358718 CGGGGAGGGACCGGGGGGGCGGG - Intronic
1049272625 8:141703977-141703999 TGGGGAGGGAGTGGGGGCTCTGG - Intergenic
1049387082 8:142348512-142348534 TGGGGCGGGAGCGGGGGCCAGGG - Intronic
1049387110 8:142348580-142348602 TGGGGCGGGAGCGGGGGCCAGGG - Intronic
1049387138 8:142348648-142348670 TGGGGCGGGAGCGGGGGCCAGGG - Intronic
1049390564 8:142367515-142367537 CGGGGCGGGGGAGGGGGAGGGGG + Intronic
1049620915 8:143597962-143597984 TGGGGCGGGCGCGGGGGGCCCGG - Exonic
1049679011 8:143908377-143908399 CGGGCCGGGTGCGGTGGCTCAGG + Intergenic
1049708139 8:144052114-144052136 CCGGGTGGGAGCCGGGGCTCGGG - Intronic
1049746900 8:144266791-144266813 CGGGCCGGGGGCGGGGGGCCAGG + Exonic
1051130148 9:13851532-13851554 CGGGCCGGGCGCGGTGGCTCAGG + Intergenic
1051206327 9:14693143-14693165 CGGAGCGGGGGCCGGGGATGGGG + Intronic
1053163486 9:35829316-35829338 CGGGGCGGGGGCCGGGGACCTGG - Intronic
1055091320 9:72366377-72366399 CGGGGTGGGAGCGGGGGTGGGGG + Intergenic
1055265990 9:74497161-74497183 TGGGGCGGGGGCTGGGGACCAGG - Intergenic
1056154153 9:83817837-83817859 CGGGGCGGGGGCGGGGGCGGGGG + Intronic
1056659539 9:88534426-88534448 GGGGGCGGGGGCGCGGGATGTGG + Intergenic
1056676335 9:88679630-88679652 CGGGGGAGTAGCGGGGGATGGGG + Intergenic
1056942515 9:90967458-90967480 CTGGGCGGGGGCGGGGGGTCTGG - Intergenic
1057047062 9:91894106-91894128 CGGGGCTGGAGTTGGGGAGCAGG - Intronic
1058005149 9:99906588-99906610 CGGGGCGGGGGCGGGGGCGGGGG + Intergenic
1060140028 9:121201669-121201691 CCGGGCGGGAGGGGGGCGTCAGG + Exonic
1060200935 9:121651557-121651579 CGCGGCGGGGGCTGGGGACCCGG - Intronic
1060217222 9:121745635-121745657 CGGGGCGGGGGTGGGGGGTGGGG + Intronic
1060283490 9:122228878-122228900 CGGGCCGGGGGCGGGGGCTGAGG - Intronic
1060302209 9:122381385-122381407 CGGGCCAGGAGCTGGGCATCTGG - Exonic
1060555000 9:124503610-124503632 CGGGGCGGGAGCGTGGGGCCTGG - Intronic
1060572898 9:124659275-124659297 AGGGGCGGGAGCGGGGGGGCGGG + Intronic
1060770113 9:126326616-126326638 CGGGGCGGCGGCGCGGGCTCGGG + Intergenic
1061187150 9:129061260-129061282 CGGGTCTGGAGAGTGGGATCGGG - Exonic
1061262624 9:129488523-129488545 CGGGGCGGGGGCGGGGACGCCGG - Intergenic
1061293718 9:129666175-129666197 CGGGGCCGGGGCGCGGGGTCCGG + Intronic
1061347938 9:130042448-130042470 CGGGGCGAGCGCCGGGGGTCGGG - Intronic
1061540780 9:131277100-131277122 CGGGGCGGGCGCGGGGGGCGGGG - Intergenic
1061608945 9:131733354-131733376 CGGGGCGGGGGCGGGGGGGGGGG + Intronic
1062424137 9:136498236-136498258 GGGGGCGGGGGTGGGGGTTCTGG + Intronic
1062500421 9:136849691-136849713 CGGGGCGGGGGCGGGGCTGCGGG + Intronic
1062655993 9:137604963-137604985 CGGGGCAGGAGCCGGGGGTGGGG + Intergenic
1185506435 X:634837-634859 GGGGGCGGGGGCGGGGGGCCCGG + Intronic
1185832550 X:3316075-3316097 GGGGCCGGGCGCGGCGGATCAGG + Intronic
1189310318 X:40013705-40013727 CGGAGCGGGAGCGGGGGAGGGGG - Intergenic
1189310624 X:40014929-40014951 CGGGGCGGGGGCGGGGGCGGGGG - Intergenic
1189323015 X:40097544-40097566 CGGGGCGGGCTCGGGGCCTCCGG + Intronic
1190712705 X:53081649-53081671 AGGGGCCGAAGCGGGGGATGGGG + Intergenic
1193360622 X:80574709-80574731 CGGGCCGGGAGCTGGGAGTCCGG + Intergenic
1195239274 X:102935043-102935065 GGGGGCGGGGGCGGGGGAGGAGG + Intergenic
1195369280 X:104157041-104157063 CGAGGCGGGGGCGGGGGAGGCGG - Intergenic
1197753258 X:129979928-129979950 CGGGGGAGGGGCGGGGCATCCGG + Intergenic
1198791774 X:140354326-140354348 TGGGGCGGGGGCGGGGGAACAGG - Intergenic
1198807080 X:140503663-140503685 CGGGGCGGGAGTGGGGGTGGGGG + Exonic
1200058751 X:153474719-153474741 GGGGGCGGGGGCGGGGGCGCGGG + Intronic
1200128464 X:153829204-153829226 CGGGGCGGGGGCGGGGGCGGGGG - Intronic
1200128967 X:153830803-153830825 CGAGGCGGGAGCGCGGGCGCTGG - Intergenic
1200284448 X:154806431-154806453 CGGGGGGGGAGGGGGGGGTGGGG + Intronic
1200291706 X:154881584-154881606 CGGAGCGGGGGCGGGGGAGGGGG + Intronic
1200338544 X:155377323-155377345 CGGAGCGGGGGCGGGGGAGGGGG + Intergenic
1200347925 X:155463369-155463391 CGGAGCGGGGGCGGGGGAGGGGG - Intergenic
1202368634 Y:24183060-24183082 CGGGGCTGGGGCGGGGCCTCAGG - Intergenic
1202502151 Y:25487057-25487079 CGGGGCTGGGGCGGGGCCTCAGG + Intergenic