ID: 1125677589

View in Genome Browser
Species Human (GRCh38)
Location 15:41511220-41511242
Sequence CTTGGCTGGGCCGCGGCCGG CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 342
Summary {0: 1, 1: 0, 2: 3, 3: 26, 4: 312}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125677589_1125677596 -6 Left 1125677589 15:41511220-41511242 CCGCCGGCCGCGGCCCAGCCAAG 0: 1
1: 0
2: 3
3: 26
4: 312
Right 1125677596 15:41511237-41511259 GCCAAGGGTCGCCCAAGCCTCGG 0: 1
1: 0
2: 0
3: 7
4: 91
1125677589_1125677599 5 Left 1125677589 15:41511220-41511242 CCGCCGGCCGCGGCCCAGCCAAG 0: 1
1: 0
2: 3
3: 26
4: 312
Right 1125677599 15:41511248-41511270 CCCAAGCCTCGGAGCAGCCCTGG 0: 1
1: 0
2: 2
3: 36
4: 284

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125677589 Original CRISPR CTTGGCTGGGCCGCGGCCGG CGG (reversed) Exonic
900180132 1:1307659-1307681 CCGGGCCGGGCCGCGGCCGCCGG - Intronic
900233591 1:1575208-1575230 CTTGTATGAGCCGGGGCCGGAGG - Intergenic
900395086 1:2450168-2450190 CTTGGCTGGGCCTCGACGGGGGG + Intronic
900611741 1:3547172-3547194 CTCGGGTGGGCCGAGGCTGGAGG - Intronic
900786893 1:4655130-4655152 CTTCGCTGTGCCGCCGGCGGAGG + Exonic
900987701 1:6082870-6082892 CTTGGCTGGCCCCAGGCAGGAGG - Intronic
900991938 1:6102062-6102084 CTTAGCTGGGCCTGGGCCGGTGG + Exonic
901067977 1:6503651-6503673 CTTTGCTAGGCCGAGGCGGGTGG - Intronic
901420034 1:9144689-9144711 CCTGGCGGGGCCGCGCGCGGTGG + Intergenic
902444392 1:16452771-16452793 CTGGGCGGGGCGGCGGGCGGGGG - Intronic
903331903 1:22600824-22600846 CCTGGCAGGTCCGCGGGCGGTGG + Intronic
904272219 1:29357512-29357534 CTTGGCTGGGCTGGGGGTGGAGG - Intergenic
904536965 1:31205908-31205930 CTTGTCTGGGCCGGGCGCGGTGG - Intronic
904763125 1:32819322-32819344 CTTGGGGAGGCCGAGGCCGGAGG + Intronic
905565739 1:38963185-38963207 CTTTGCGGGGCCGAGGCGGGTGG + Intergenic
906198826 1:43946701-43946723 CTAGACTCGGCCGCGGCCTGGGG + Intergenic
906290559 1:44617063-44617085 CTGGGCTGGGCCGCGACGTGAGG - Intronic
906609227 1:47190499-47190521 CTTGGCGGGGCAGGGGCAGGTGG - Intronic
906640674 1:47438865-47438887 CGTGGCGGGGCCGCGGCGGCGGG + Exonic
907062058 1:51437724-51437746 CTTTGCGGGGCCGAGGCAGGTGG - Intronic
907364002 1:53945400-53945422 CGTGGAAGGGCCGCGGCGGGAGG - Intronic
909629169 1:77752832-77752854 CTTTGCGAGGCCGAGGCCGGTGG + Intronic
911117067 1:94257114-94257136 CTTGGCTGGGCCGGGCATGGTGG + Intronic
911638884 1:100266375-100266397 CATGGCGGGGCCGCGGGTGGAGG + Exonic
912246272 1:107964887-107964909 CGCGGCTGGGCCGGGGCGGGCGG + Exonic
912514672 1:110210420-110210442 CTTGGCTCGCGCGCGGCAGGGGG - Intergenic
912782992 1:112570924-112570946 CTTAGCGGGGCCGAGGCAGGTGG + Intronic
914702962 1:150150413-150150435 CCTGGCGGGGCCGAGGCCGAGGG - Intronic
915326097 1:155081994-155082016 CTTCCCTGGGCCGCGTCGGGTGG - Intronic
915634623 1:157177558-157177580 CTTGGCGGGGCTGAGGCGGGAGG + Intergenic
915917211 1:159947534-159947556 CTTGGCTCGGCCGGGGGCAGTGG - Intergenic
917932411 1:179831978-179832000 CTTGGCGGGGCAGCTGCAGGTGG + Intergenic
917944286 1:179953513-179953535 CTTTGCGGGGCCGAGGCGGGTGG - Intergenic
921232959 1:213092382-213092404 CTTGTATGGGCCGGGCCCGGTGG + Intronic
922783319 1:228269979-228270001 CCCGGCGCGGCCGCGGCCGGGGG - Intronic
924235895 1:241999314-241999336 ATTGGCTGGGCAGCGGACTGTGG + Intergenic
1063523819 10:6764721-6764743 CTTGGCTGGGCCGGGTCCAGGGG - Intergenic
1063665802 10:8059567-8059589 CTTGGCTGAGCTGCAGCCAGAGG + Intronic
1066023103 10:31320917-31320939 ATAGCCTGGGCTGCGGCCGGCGG - Intronic
1067079010 10:43203264-43203286 CCTGGCTGGGGCACGGGCGGGGG - Intronic
1069695496 10:70382598-70382620 CTCGCCTGGGGCGCCGCCGGCGG - Intronic
1070414260 10:76174874-76174896 CTTTGCTAGGCCGAGGCAGGGGG + Intronic
1071849070 10:89550275-89550297 CTTTGCGGGGCCGAGGCAGGAGG + Intronic
1071997598 10:91163116-91163138 CTTCCCTGGGCCGCGTCGGGCGG - Intronic
1073061290 10:100735366-100735388 CTAGGCTGGGCTGCGGTCCGTGG + Intergenic
1075690093 10:124388770-124388792 CCTGGCTGGGCTGTGCCCGGAGG - Intergenic
1075694394 10:124422881-124422903 CTTTGGGGGGCCGAGGCCGGAGG - Intergenic
1076647419 10:131962773-131962795 CTTGGCTGGGCTGCGGTTGGGGG - Intergenic
1077226993 11:1442877-1442899 CTCGGCTGGGCAGGGGCCAGGGG - Intronic
1078061610 11:8049448-8049470 CTTTGCTGGGCCTCGGCCAGTGG - Intronic
1082283501 11:50297365-50297387 CTTTGAGGGGCCGAGGCCGGCGG - Intergenic
1083322097 11:61854119-61854141 CCTGGCTGGGCTGCGGCCAAGGG - Intronic
1083656882 11:64234315-64234337 CTTGGCGAGGCCGGGGCCGGGGG - Intergenic
1084212498 11:67630452-67630474 CAGGGCCGGGCCGTGGCCGGGGG + Intergenic
1084492647 11:69487037-69487059 CTTGGCTGGGCCGCGCTGGCAGG - Intergenic
1084561683 11:69909138-69909160 CATGGCTGCGCCCCCGCCGGGGG + Intergenic
1086468427 11:87079247-87079269 CTTTGCGGGGCCGAGGCAGGTGG - Intronic
1090202440 11:124866097-124866119 CCTGGCTTGGCCGAGGCCGGCGG - Intronic
1091273053 11:134331748-134331770 CGGGGCGGGGCCCCGGCCGGGGG - Intergenic
1091674037 12:2475054-2475076 CTTTGGTGGGCCGAGGCAGGCGG + Intronic
1092475841 12:8818466-8818488 CTGAGCTGGGCCGGGGGCGGTGG - Intergenic
1094051593 12:26226631-26226653 CTTGGCTGGGCATCGGCTGCAGG + Intronic
1095164392 12:38954903-38954925 CTTTGCGGGGCCGAGGCAGGCGG + Intergenic
1095810995 12:46372937-46372959 CGGGGCTGGGCCGCGGGCGCGGG - Intergenic
1096497688 12:52047865-52047887 CAAGGCTGGGCCGAGGGCGGTGG + Intronic
1096784418 12:54009066-54009088 CGGGGCTGGGGCGCGGGCGGCGG - Intronic
1099973591 12:89524916-89524938 CTTGGCCGGGCCGGGGGCTGGGG + Intronic
1100036475 12:90258596-90258618 CTTGGCGGGGCTGAGGCTGGAGG - Intergenic
1100070829 12:90715296-90715318 CTTTGCGGGGCCGAGGCAGGTGG + Intergenic
1101371949 12:104138316-104138338 CGGGGCGGGGCCGCGGCGGGCGG - Intergenic
1102025767 12:109713757-109713779 TTGGGCTGGGCCGCGGGGGGCGG + Intergenic
1103280786 12:119756515-119756537 CTTGGATGGGCCGCGGGCCAAGG - Intronic
1103595448 12:122022272-122022294 CGGGGCTGGGCCGGGGCAGGCGG - Intronic
1103825069 12:123731580-123731602 CTTTGCTGGGCAGAGGCAGGAGG - Intronic
1104049498 12:125186290-125186312 GAGGGCGGGGCCGCGGCCGGGGG - Intergenic
1104275433 12:127322947-127322969 CTGGGCTGGGCCGTGGTAGGTGG - Intergenic
1105414097 13:20193759-20193781 GTTGGCTGGGCCGGGGGCCGCGG - Intergenic
1105694674 13:22876148-22876170 CTTGGCTGGGCCAGGGGCGGTGG - Intergenic
1106411248 13:29513134-29513156 CTTGCCTGGGTCGGGGCCTGCGG - Exonic
1106767009 13:32923226-32923248 CTTGGAGGGGCCGAGGCAGGAGG + Intergenic
1107865203 13:44696417-44696439 GTGGGCTGGGCCGGGGGCGGTGG + Intergenic
1108382719 13:49869457-49869479 TTTGGCTGGGCTGCGGCTTGGGG + Intergenic
1108518279 13:51222580-51222602 CCGGGCCGGGCCGCGGGCGGGGG + Intronic
1109916232 13:68988279-68988301 CTTTGCGGGGCCGAGGCTGGTGG + Intergenic
1110012660 13:70357298-70357320 CTTGTGTGGGCCGAGGCAGGAGG + Intergenic
1112345955 13:98589694-98589716 CTTTGCCGGGCCGAGGCGGGCGG - Intergenic
1112725508 13:102299611-102299633 CTTGGCTGGACAGCGGGAGGTGG + Intronic
1114659291 14:24334613-24334635 CTTCGCTGGGGGGCGGCCGGGGG + Exonic
1115185072 14:30678079-30678101 CTTCGCGGGGCCGAGGCGGGTGG - Intronic
1115755037 14:36520835-36520857 CATGGCTGAGCTGCGGGCGGAGG - Intronic
1115985765 14:39102838-39102860 CTTCGCTCTGCCGGGGCCGGGGG - Intronic
1118032567 14:61832723-61832745 CTGGGCTGGGCCGGGCACGGTGG - Intergenic
1118294511 14:64556946-64556968 CTTTGCTGGGGGGCGGCGGGTGG - Intronic
1119520097 14:75278868-75278890 GTTCGCTGCGCCGCGGCCGCCGG - Exonic
1119730827 14:76950240-76950262 CTTGGCTCGTCCGGGGCTGGAGG + Intergenic
1120970392 14:90202219-90202241 CTTTGCGGGGCCGAGGCAGGTGG - Intergenic
1121342655 14:93114881-93114903 CTTCCCTGGAACGCGGCCGGCGG + Intronic
1122567779 14:102673856-102673878 CTTGGCGAGGCGGCGGCGGGCGG - Intronic
1122609152 14:102969477-102969499 CTTGGCTGGACCTCGGCATGTGG - Intronic
1122812309 14:104295147-104295169 CTCTGCTGGGCGGTGGCCGGAGG + Intergenic
1122961005 14:105093595-105093617 CTGGGCTGCGCCGCCGCAGGCGG + Intergenic
1123038711 14:105481727-105481749 CTTGGCGGGGCGGGGGGCGGGGG + Intergenic
1125677589 15:41511220-41511242 CTTGGCTGGGCCGCGGCCGGCGG - Exonic
1125921582 15:43528579-43528601 CTTGGCTGGGGCAGGGCCTGGGG - Exonic
1125937518 15:43649315-43649337 CCGGGCTGGGCCGGGGCCGGGGG + Intronic
1127995747 15:64152346-64152368 AGAGGCTGGGCCGGGGCCGGTGG - Intronic
1128350654 15:66886242-66886264 CCTGGCTGGGCTGAGGCTGGTGG - Intergenic
1129443607 15:75600516-75600538 CTTGGGAAGGCCGAGGCCGGTGG - Intronic
1129478498 15:75804307-75804329 CATGGCTGGGCCGGGCGCGGTGG + Intergenic
1131250783 15:90828597-90828619 CTTGGGGAGGCCGAGGCCGGCGG + Intergenic
1132513012 16:353274-353296 CTTGGAATGGCCGCGGCCGTGGG + Intergenic
1132683455 16:1153031-1153053 CGTGGCCGGGGCGGGGCCGGGGG - Intergenic
1132729712 16:1355455-1355477 CTTGCCAGGGCCGAGGCTGGTGG + Intronic
1132732869 16:1371466-1371488 CTTGGCTGTTCAGCGGCTGGAGG + Intronic
1132960800 16:2621601-2621623 CTTGACTGGCCCGGGGCAGGAGG + Intergenic
1133304967 16:4802832-4802854 CTGGCCAGGGACGCGGCCGGCGG + Exonic
1134555538 16:15160741-15160763 CTTTGTGGGGCCGAGGCCGGCGG - Intergenic
1135604165 16:23808800-23808822 CTTTGGGGGGCCGAGGCCGGTGG + Intergenic
1136146694 16:28320545-28320567 CTTGGCTGGGCCGCGGCGCTCGG - Exonic
1136711573 16:32241238-32241260 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136756342 16:32688167-32688189 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1136811770 16:33182207-33182229 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136818246 16:33292287-33292309 CCTGCCTGGGCCGCGGCCGCCGG + Intronic
1136824810 16:33348820-33348842 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1136829876 16:33447591-33447613 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1137603978 16:49775029-49775051 CTTTGCTGGGCTGCGTCTGGGGG - Intronic
1138548787 16:57735899-57735921 CTGGGCTGGGCCGAGCCAGGCGG + Intronic
1139364722 16:66426632-66426654 CGTGGCTGGGCCGCTGGCAGGGG - Intergenic
1140735915 16:77897716-77897738 CTTGGGGAGGCCGAGGCCGGTGG - Intronic
1141183504 16:81770813-81770835 CTTTGCGGGGCCGAGGCGGGCGG + Intronic
1141535206 16:84674348-84674370 CTTGGCTGGGCCGTGGCACACGG + Intergenic
1202990348 16_KI270728v1_random:5175-5197 CCTGCCTGGGCCGCGGCCGCCGG + Intergenic
1203058481 16_KI270728v1_random:948521-948543 CCTGCCTGGGCCGCGGCCGCCGG - Intergenic
1142837808 17:2601683-2601705 CTTTGCGGGGCCGAGGCAGGAGG - Intronic
1144340287 17:14304181-14304203 CTTGGCTGGGCCGCGGGAGGCGG + Intronic
1144519440 17:15944549-15944571 CCTCGCTGGGAGGCGGCCGGAGG + Intergenic
1146508986 17:33429675-33429697 CTAGGCTGGGCTGGGGGCGGTGG - Intronic
1148183109 17:45620679-45620701 CGGGCCGGGGCCGCGGCCGGGGG + Intergenic
1148265742 17:46225012-46225034 CGGGCCGGGGCCGCGGCCGGGGG - Intronic
1148370973 17:47099945-47099967 CGGGCCGGGGCCGCGGCCGGGGG - Intergenic
1148566025 17:48633562-48633584 CTGGACTGGGCCGCGGCCGCTGG - Intronic
1148617682 17:49013430-49013452 CTTGGCTGGGCCGCGGGAGGAGG - Intronic
1149825274 17:59822566-59822588 CTTTGGTGGGCCGAGGCAGGTGG - Intronic
1150292222 17:63988498-63988520 CTGGGGTGGGCCGTGGCTGGTGG - Intergenic
1150465779 17:65391519-65391541 CCTTGCTGGGCCGCGCCCGAAGG + Intergenic
1150793658 17:68221025-68221047 CTTTGCGGGGCCGAGGCGGGTGG - Intergenic
1151960385 17:77402578-77402600 CTGGGCTGGGCTGGGGGCGGTGG - Exonic
1154957912 18:21277213-21277235 CTGGGCTGGGCCGGGCACGGTGG - Intronic
1155486365 18:26347205-26347227 CTTGGCTGGGCCGGGCGCAGTGG - Intronic
1155999594 18:32370187-32370209 CTTTGGGGGGCCGAGGCCGGCGG + Intronic
1156238796 18:35230856-35230878 CTTTGGTAGGCCGAGGCCGGCGG - Intergenic
1156375779 18:36514250-36514272 CTTGGGGAGGCCGAGGCCGGCGG - Intronic
1157764203 18:50285187-50285209 GTTGGGTGGGCAGTGGCCGGCGG + Exonic
1160227405 18:77021724-77021746 CTTTGCGGGGCCGAGGCAGGTGG - Intronic
1160291058 18:77594126-77594148 CTTGGGGAGGCCGAGGCCGGCGG - Intergenic
1160603667 18:80033582-80033604 CTGGGCAGGGCCGCTGTCGGCGG - Intronic
1160842820 19:1154151-1154173 GTCGGGTGGGCCGGGGCCGGGGG + Intronic
1160997612 19:1890862-1890884 CTTTGGGGGGCCGAGGCCGGTGG - Intergenic
1161387800 19:4006032-4006054 CTTTGCGAGGCCGAGGCCGGTGG + Intergenic
1161526877 19:4761553-4761575 CTTGGAGAGGCCGAGGCCGGAGG - Intergenic
1161552464 19:4921646-4921668 CTTGGAGGGGCCGAGGCGGGAGG + Intronic
1161773355 19:6243272-6243294 CTGGGCAGGGCAGGGGCCGGGGG - Intronic
1161933154 19:7354654-7354676 CTTTGCGAGGCCGCGGCAGGAGG + Intronic
1161959617 19:7516373-7516395 CTCGCCTGGGCCAGGGCCGGCGG - Intronic
1162630571 19:11924187-11924209 CTTTGCGGGGCCGAGGCGGGCGG + Intergenic
1162799449 19:13102813-13102835 CCTGGCGGCGCAGCGGCCGGAGG + Exonic
1163678613 19:18668114-18668136 CGTGGCTGGCGCGCGGCCGCCGG - Exonic
1164615778 19:29665948-29665970 CTGGGCAGGGGCGCGGCGGGGGG + Intronic
1166076143 19:40414807-40414829 CTGGGCTGGGCTGAGGCTGGGGG + Intergenic
1166734242 19:45075326-45075348 CTAGGGAGGGCAGCGGCCGGGGG - Intronic
1168252799 19:55149880-55149902 CTTGGCTGGGAAGCGGGAGGGGG - Intergenic
1168294124 19:55370402-55370424 GTCAGCTGGGCCGCGGCCTGGGG + Intronic
925152711 2:1626360-1626382 CTGGGCTGGGCTGTGTCCGGCGG - Intergenic
925390127 2:3488941-3488963 CTGGGCTGGGCGGGGGCTGGAGG - Intergenic
927964956 2:27262778-27262800 CTGGGCTGGCCCTCGGCCCGGGG - Intronic
928769801 2:34692963-34692985 TTTGCCTGGGCCGCGTGCGGTGG - Intergenic
929745320 2:44651438-44651460 CTTTGCTAGGCCGAGGCGGGTGG + Intronic
931512639 2:63017309-63017331 ATTGGCTGGGCCGGGGACGGTGG - Intronic
932303716 2:70686733-70686755 TTTGGTTGGGCAGCAGCCGGAGG + Intronic
932492754 2:72132196-72132218 CTGGGCTGGGCTGAGGCGGGTGG + Exonic
933379629 2:81526483-81526505 CTTGGCAGGGCCGGGCGCGGTGG + Intergenic
933791692 2:85888653-85888675 CCCGGCTGGGGCGCGGGCGGAGG - Intronic
933831920 2:86218175-86218197 CATGGCTGGGCAGTGGCAGGAGG - Intronic
934061411 2:88297670-88297692 CTTGGCTAGGCCGAGGCAGAAGG - Intergenic
935301618 2:101697936-101697958 CCTCGCGGGGCCGCGGGCGGCGG - Intronic
936433423 2:112482930-112482952 CTTGGCGTGGGCGCGGGCGGGGG + Intronic
936447561 2:112607675-112607697 CTTGGCTGGGCCAGGCACGGTGG - Intergenic
937228891 2:120385343-120385365 CTGGGCTGGGCTGGGGGCGGTGG + Intergenic
937625763 2:124042102-124042124 CTTTGCGGGGCCGAGGCAGGTGG - Intronic
940293452 2:152099068-152099090 CGAGGCTGGGCTGCGGACGGAGG + Exonic
941096686 2:161245164-161245186 CCCGGCGCGGCCGCGGCCGGGGG - Intergenic
942031838 2:171970759-171970781 CTTGGGGAGGCCGAGGCCGGAGG - Intronic
942460155 2:176162990-176163012 CTTGGCTGGGCCGGGACCTGAGG - Intronic
945216889 2:207443459-207443481 CTTAGCTGGGCCGGGTGCGGTGG - Intergenic
946248741 2:218400821-218400843 CGTGGCTGGGCCGGGGTGGGGGG + Intronic
946322089 2:218960155-218960177 CTTGGCGGTGCCGCCGCCGTCGG - Exonic
946396530 2:219446159-219446181 CAGGGCTGGGCCACGGCCAGGGG + Intronic
947294375 2:228614650-228614672 CTAGGCTGGGCCGGGCGCGGTGG - Intergenic
947724159 2:232387211-232387233 CTGGGCCCGGTCGCGGCCGGCGG - Intergenic
947741336 2:232486379-232486401 CTGGGCCCGGTCGCGGCCGGCGG - Exonic
948199493 2:236119582-236119604 CTTGGCTGGAGCTGGGCCGGGGG - Intronic
948432641 2:237929855-237929877 CATGGCTGGGCCCTGGCCTGGGG - Intergenic
948464628 2:238146269-238146291 CTTGGCAGGGCCAAGGCAGGAGG + Intronic
948803611 2:240443693-240443715 CTTTGATGGGGCGCAGCCGGTGG + Intronic
948824652 2:240568410-240568432 CTCCGCTCGGCCGCCGCCGGGGG - Intronic
1170624392 20:18020371-18020393 CATGGCTGGGCCGGGTGCGGTGG - Intronic
1170630021 20:18057766-18057788 CTGGGCCGCGCCGCGGCGGGGGG - Exonic
1171958002 20:31474686-31474708 CTTAGCTGGGCCTGGGCCTGAGG - Intronic
1172510029 20:35494259-35494281 CTTGGCTGGGCTGGGTGCGGTGG - Intronic
1173629470 20:44500491-44500513 CTTGGCTGGGGGGCTGCAGGAGG - Intronic
1173880173 20:46406242-46406264 CTGGGCTGGGCAGCGGTCGGAGG - Intronic
1175322793 20:58101180-58101202 CTGGGCTGGGCTGGGGCCCGAGG + Intergenic
1175562295 20:59940378-59940400 CCTGGCTGAGCTGAGGCCGGCGG - Intronic
1175992436 20:62796506-62796528 CTCGGCCGGGCCGCGGCCATGGG + Exonic
1176036754 20:63043364-63043386 CTTGGCTGGGTCCCCACCGGTGG + Intergenic
1176100299 20:63361526-63361548 CTGCGCTGGGCCCCGGGCGGGGG + Intronic
1176122266 20:63459270-63459292 CTTGGCGAGGCCGAGGCAGGAGG + Intronic
1176137528 20:63530694-63530716 CGTGGCCGGGGCGTGGCCGGAGG - Intronic
1176425638 21:6546741-6546763 CTTGGCTGGGCCACGGCGCCCGG + Intergenic
1178880808 21:36448613-36448635 CTTTGCGGGGCCGAGGCGGGTGG - Intergenic
1179701129 21:43155058-43155080 CTTGGCTGGGCCACGGCGCCCGG + Intergenic
1179732307 21:43374674-43374696 CTTGGGTGGGCGGGGGCCGCAGG - Intergenic
1179908807 21:44437427-44437449 ATGGGCTGGGCTGCGGCTGGAGG + Intronic
1179921702 21:44510872-44510894 CTCGGCGGGGGCGGGGCCGGGGG + Intronic
1181094337 22:20495564-20495586 CGTGGCGGGGACGCGGCCGGCGG - Intronic
1182510306 22:30814992-30815014 CTGGGCTGGGCCGGGCACGGTGG + Intronic
1183506962 22:38214748-38214770 CGTGGCGGGCCCGCGGGCGGCGG - Exonic
1183577351 22:38700604-38700626 CTCCGCAGGGCCGCGGCCAGAGG - Exonic
1184184695 22:42856953-42856975 CCTGGCCGGGCCGGGGCGGGCGG - Intronic
1184273290 22:43396829-43396851 CTTGGCTGGGGCAGGGCCTGGGG + Intergenic
1185237954 22:49725456-49725478 CTCGGATGGGGCGCGGCGGGGGG + Intergenic
949553323 3:5130777-5130799 CATGCCTGGGCCGAGGCGGGCGG - Intronic
950570650 3:13797950-13797972 CTTTGCGGGGCCGAGGCGGGTGG + Intergenic
950572824 3:13812402-13812424 CCTGGCTGGGCCCAGGCAGGGGG + Intergenic
950646481 3:14380216-14380238 CTTTGCGGGGCCGAGGCGGGTGG + Intergenic
950773759 3:15332564-15332586 CTCTGCTCCGCCGCGGCCGGAGG - Exonic
951644912 3:24879184-24879206 CTTTGGGAGGCCGCGGCCGGCGG + Intergenic
954795867 3:53161153-53161175 CCTGGCGGGGGCGGGGCCGGCGG + Exonic
955577116 3:60377766-60377788 CTTGGCTGGGCCGGGCGCGGTGG - Intronic
958779424 3:98522984-98523006 CCGGGCCGGGCCGCGGCCCGGGG + Intronic
961372395 3:126439677-126439699 GGTGGCTGGGCCGCGGGCCGAGG + Exonic
961656460 3:128445176-128445198 CTTTGGGGGGCCGAGGCCGGAGG - Intergenic
961706324 3:128788800-128788822 CTTGGGTGGGCAGAGGTCGGTGG - Intronic
963780852 3:149484793-149484815 CTTTGCGGGGCCGAGGCTGGTGG - Intronic
963902531 3:150746148-150746170 CTTGGGTAGGCTGCGGCAGGTGG + Intronic
966910162 3:184555150-184555172 CTTTGCGGGGCCGAGGCGGGGGG + Intronic
968135382 3:196216605-196216627 CTTGCCTGGGCCGGGGTGGGGGG - Exonic
968583415 4:1405171-1405193 CCGGGCTGGGCCGCGGCCACCGG - Intronic
970346799 4:15160125-15160147 CTTTGGGGGGCCGAGGCCGGTGG + Intergenic
972453701 4:39231022-39231044 GTGGGCTGGGCCGGGGACGGTGG + Intronic
972670961 4:41214039-41214061 CTTGGCAGGGCCTGGGGCGGGGG - Intronic
972908140 4:43777193-43777215 CTTTGCGAGGCCGAGGCCGGTGG + Intergenic
972957011 4:44405553-44405575 CCTGGCTGGGCCGGGTGCGGTGG - Intronic
973613698 4:52659363-52659385 GGAGCCTGGGCCGCGGCCGGCGG + Intergenic
973636033 4:52862590-52862612 CTTGACCAGGCGGCGGCCGGCGG - Exonic
978721659 4:111917394-111917416 CTTGGCTGGGCCGGGTGCAGTGG + Intergenic
979536254 4:121823732-121823754 CTGGCCTGGGCTGCGACCGGCGG - Exonic
981199074 4:141957310-141957332 CTTGGCAGGGCTGAGGCAGGAGG - Intergenic
981234407 4:142398130-142398152 CTTGGGGAGGCCGAGGCCGGCGG + Intronic
982457255 4:155625192-155625214 TTTGGCTGGGCCGTGCACGGTGG + Intergenic
987856906 5:23431525-23431547 CTTGGCTGGGCTGGGCACGGTGG + Intergenic
987927715 5:24364187-24364209 CTTGGCTGGGCAGCAGCAGCTGG - Intergenic
988949379 5:36241800-36241822 GTGGGCCGGGCCGCGGCCGCGGG + Intronic
990050543 5:51494535-51494557 CTTTGCGGGGCCGAGGCGGGCGG - Intergenic
990215889 5:53531325-53531347 CTTTGGGGGGCCGAGGCCGGTGG + Intergenic
995118923 5:108515308-108515330 CTTTGCGGGGCCGAGGCGGGCGG - Intergenic
996404245 5:123090439-123090461 CTTGACGGGCCCGGGGCCGGAGG - Exonic
997198892 5:131997810-131997832 CTTGGCTGGGCAGCAACCAGAGG + Intronic
997539412 5:134649099-134649121 GCTGGCTGGGGCGCCGCCGGAGG - Exonic
997548837 5:134734827-134734849 CTGGGCTCGGCCGGGGACGGTGG + Intergenic
1000357987 5:160419159-160419181 CCTGGCGGGGCCGGGGGCGGAGG + Exonic
1001972195 5:175965710-175965732 CTTGGCTTGGCCGGGCACGGTGG - Intronic
1002026450 5:176399085-176399107 CTTGGGGAGGCCGAGGCCGGTGG - Intronic
1002190795 5:177476410-177476432 CGTGGCTGGCCCGGCGCCGGGGG - Intergenic
1002245245 5:177878067-177878089 CTTGGCTCGGCCGGGCACGGTGG + Intergenic
1002279046 5:178120324-178120346 CCTGGCTGGCCCGGGGCCCGGGG - Exonic
1002376083 5:178789936-178789958 CTTGTCTGGGCCGGGCGCGGTGG + Intergenic
1002496255 5:179613856-179613878 CTTGGCTGGGAAGGTGCCGGAGG - Intergenic
1002600587 5:180352408-180352430 CCTGGCTGGGCCGCCTCCGCTGG - Intronic
1002882846 6:1268056-1268078 CTTAGCTGGGCCGGGCACGGTGG + Intergenic
1003638263 6:7854551-7854573 CTTGGCGAGGCCGGGGCAGGCGG + Intronic
1004450303 6:15739190-15739212 CTTTGCGGGGCCGAGGCGGGTGG + Intergenic
1004480847 6:16018035-16018057 CTTGGGTGGGGCGAGGCAGGTGG + Intergenic
1004991112 6:21139749-21139771 CTTTGCGGGGCTGAGGCCGGAGG - Intronic
1005508193 6:26488724-26488746 CTTGCCTGGGCCGTGCCCAGTGG + Intergenic
1006449579 6:34098491-34098513 CCTGGCTGGGCCTAGGCTGGTGG - Intronic
1006814459 6:36840571-36840593 CTTGGCGAGGCCGCGGCTGGCGG - Intergenic
1007462067 6:42026274-42026296 CTTGGCAGGGGGGCGGCGGGGGG - Intronic
1007473566 6:42105453-42105475 GTGGGCTGGGCCGAGGCAGGAGG + Exonic
1007785342 6:44276479-44276501 CGTGGCGGTGCAGCGGCCGGTGG - Exonic
1010428190 6:75749214-75749236 CTCGGCGGGGCGCCGGCCGGCGG + Intronic
1011463157 6:87627240-87627262 CTTTGCGGGGCCGAGGCGGGTGG - Intronic
1011601116 6:89061250-89061272 CTTTGCGGGGCCACGGCAGGAGG + Intergenic
1013130370 6:107226956-107226978 TTTGGCTGGGCCGGGCGCGGTGG - Intronic
1015054452 6:128883094-128883116 TTTGGCCGGGCCGCCGCCTGAGG - Intergenic
1019230306 6:170554714-170554736 GCTGGCTGGGCGGCGGCAGGCGG + Intronic
1019343963 7:520687-520709 CTGAGCTGCGCCTCGGCCGGAGG - Intergenic
1019403944 7:872843-872865 CTTTGCGGGGCCGAGGCAGGCGG + Intronic
1020986760 7:15145069-15145091 CTTTGCGGGGCCGAGGCGGGCGG - Intergenic
1022475511 7:30707140-30707162 CTTGGCTGGGACACGCCCAGGGG + Intronic
1026569102 7:71513946-71513968 CTTTGCAGGGCCGAGGCAGGAGG + Intronic
1026897029 7:74015260-74015282 CTTGGCGGGGCTGAGGCTGGAGG - Intergenic
1026974705 7:74490328-74490350 CTGGGCTGGGCAGCGGGAGGGGG - Intronic
1027877522 7:83789329-83789351 CTTTGCGGGGCCGAGGCGGGCGG - Intergenic
1029200338 7:98835205-98835227 CTGGGCTGGGCCATGGCTGGAGG - Intergenic
1029491901 7:100875306-100875328 CTTGGTGCGGCCGCGGCCGTTGG - Exonic
1031362950 7:120868691-120868713 CTTGGGGAGGCCGAGGCCGGAGG + Intergenic
1034451199 7:151138204-151138226 CTGGGCTGGCCCGCGCCCTGAGG + Exonic
1034455536 7:151167899-151167921 GTTGGTTGGGCCGCGGGGGGCGG - Intronic
1039503043 8:38031651-38031673 CTTGGCTAGGTGGCGGGCGGGGG + Intronic
1041026691 8:53693832-53693854 CTTTGCGAGGCCGCGGCAGGAGG - Intergenic
1041161062 8:55044308-55044330 CTTGGCTGGCCTGGGGCCTGTGG - Intergenic
1045098946 8:98825892-98825914 CTTCTCTGGGCCGCCGCCGCAGG - Intronic
1046447464 8:114341535-114341557 CTTGGGGAGGCCGAGGCCGGTGG - Intergenic
1046937295 8:119896739-119896761 CTTTGCGGGGCCGAGGCAGGAGG - Intronic
1047851008 8:128858088-128858110 CTTGCCTGGGCCGGGTGCGGTGG - Intergenic
1048411829 8:134182931-134182953 CTTTGCGGGGCCGAGGCGGGCGG - Intergenic
1048847679 8:138615958-138615980 CCTGGCTGGGCTGGGGCTGGGGG - Intronic
1049175099 8:141187466-141187488 TTTGGCGGGGCCGAGGCGGGAGG - Intronic
1049519781 8:143082186-143082208 ATTTGCTGTGCCGCGGGCGGAGG + Intronic
1049639962 8:143711087-143711109 CTGGGCTGGGCAGAGGCCTGGGG - Intronic
1049697863 8:143992387-143992409 CGTGGCTGGGCTGTGGCCGCAGG + Intronic
1051640435 9:19219950-19219972 CTTTGCAGGGCCGAGGCGGGTGG + Intergenic
1058431793 9:104926966-104926988 CTTGGGGAGGCCGAGGCCGGTGG + Intronic
1058908128 9:109498003-109498025 CCTGGCGGGGCCGGGGCGGGAGG - Intronic
1060200837 9:121651214-121651236 CCTGGCTGGGCCAGGGCCTGCGG + Intronic
1060498061 9:124132520-124132542 CTTTGCAGGGCCGAGGCAGGTGG - Intergenic
1060517892 9:124277155-124277177 CTTGGCTGGGCCGGGTGTGGTGG + Intronic
1061325225 9:129859789-129859811 CTTTGCTGGGCCAAGGCAGGAGG + Intronic
1061536594 9:131254144-131254166 CTTTGCTGGGCCCCGGACCGGGG + Intergenic
1061945646 9:133907031-133907053 CCTGGCTGGCCGGCGGCGGGGGG + Intronic
1062356097 9:136163701-136163723 CTTGGCTGGGCTGAGGTGGGAGG - Intergenic
1185469413 X:373712-373734 CAGGGCCGGGCCGGGGCCGGCGG + Intronic
1186496462 X:10015583-10015605 CTTGGCTGAGCGGCGGCCGGCGG + Exonic
1186787241 X:12964968-12964990 CTTGACTGGGCCGGGCGCGGTGG - Intergenic
1189980369 X:46504584-46504606 CTTTGCGGGGCCGAGGCGGGTGG - Intronic
1194260394 X:91687174-91687196 CTTGGTTGGGCCGGGCGCGGTGG - Intergenic
1199529246 X:148828586-148828608 GTTGGATGGGCCGTGGCCTGAGG + Intronic
1200185446 X:154179988-154180010 CTTGTGTCGGCCGCGGGCGGTGG - Intergenic
1200191100 X:154217128-154217150 CTTGTGTCGGCCGCGGGCGGTGG - Intergenic
1200196853 X:154254929-154254951 CTTGTGTCGGCCGCGGGCGGTGG - Intergenic
1200202505 X:154292047-154292069 CTTGTGTCGGCCGCGGGCGGTGG - Intronic