ID: 1125678850

View in Genome Browser
Species Human (GRCh38)
Location 15:41517972-41517994
Sequence CTCCATCTTCAGAGGAAGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 411
Summary {0: 1, 1: 0, 2: 5, 3: 38, 4: 367}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125678850_1125678853 0 Left 1125678850 15:41517972-41517994 CCTTCCTTCCTCTGAAGATGGAG 0: 1
1: 0
2: 5
3: 38
4: 367
Right 1125678853 15:41517995-41518017 ATGTAACTTACTGAGCTCTGTGG 0: 1
1: 0
2: 0
3: 14
4: 150
1125678850_1125678854 1 Left 1125678850 15:41517972-41517994 CCTTCCTTCCTCTGAAGATGGAG 0: 1
1: 0
2: 5
3: 38
4: 367
Right 1125678854 15:41517996-41518018 TGTAACTTACTGAGCTCTGTGGG 0: 1
1: 0
2: 2
3: 14
4: 178

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125678850 Original CRISPR CTCCATCTTCAGAGGAAGGA AGG (reversed) Intronic
900547993 1:3239166-3239188 CTCCATCTTCTCAGAAAGGGAGG + Intronic
901040027 1:6358239-6358261 CTGCATCTCCAGAAGAGGGAAGG + Intronic
901060494 1:6469671-6469693 ATCCATCTGCAGTGGCAGGAGGG + Exonic
901592161 1:10353608-10353630 ATCCATGTTGAGAGGAGGGAGGG + Intronic
901957682 1:12798148-12798170 CTCCACCTTCTGACCAAGGAGGG + Intergenic
901965676 1:12863901-12863923 CTCCACCTTCTGATCAAGGAGGG + Intronic
901981074 1:13034279-13034301 CTCCACCTTCTGATCAAGGAGGG + Intronic
902001013 1:13194651-13194673 CTCCACCTTCTGATCAAGGAGGG - Intergenic
902020243 1:13340355-13340377 CTCCACCTTCTGATCAAGGAGGG - Intergenic
902144913 1:14390745-14390767 CTGCATCCTCCCAGGAAGGAAGG + Intergenic
902232910 1:15039401-15039423 GTGCATGTTCAGAGGAACGAAGG + Intronic
903132080 1:21286206-21286228 CACCATTTTCAGCGGCAGGAAGG - Intronic
903735883 1:25529794-25529816 CTCCATCTACAAATGAAGAAAGG - Intergenic
904464779 1:30701322-30701344 CTCCATCTTCAGGAGGAGGAAGG - Intergenic
905105063 1:35559060-35559082 ATCCCTCTGCAGAGGAGGGACGG - Intronic
905387718 1:37615721-37615743 CTGCATCTACAGAGAAGGGATGG + Intronic
906520531 1:46464423-46464445 CTCCCTGTTCAGAGTGAGGAGGG - Intergenic
907584671 1:55606557-55606579 TTCCTTCTTCAAGGGAAGGAGGG + Intergenic
907881187 1:58550513-58550535 CTCCATCTTGAGTGGAATGTGGG - Intergenic
908793936 1:67812537-67812559 TTTCATCTTGAGAGGTAGGAGGG + Intronic
911635914 1:100236212-100236234 CTCCATCTCCTGAGGAAGCTGGG + Intronic
913029199 1:114881531-114881553 CTCCATCAAGAAAGGAAGGAAGG - Intronic
913172134 1:116242735-116242757 CACCACCTTCAGAGGGAGGCTGG - Intergenic
913969478 1:143403628-143403650 ATACATCTTCAGAAAAAGGAGGG + Intergenic
914063855 1:144229227-144229249 ATACATCTTCAGAAAAAGGAGGG + Intergenic
914115295 1:144737127-144737149 ATACATCTTCAGAAAAAGGAGGG - Intergenic
915532641 1:156511988-156512010 CTCCTTCTGTAGAGGATGGAAGG - Intergenic
915828798 1:159105909-159105931 CCCCATCTTCAAACCAAGGATGG - Intronic
915985214 1:160457818-160457840 CTGCATAAGCAGAGGAAGGAAGG + Intergenic
916015054 1:160742333-160742355 CTCCACCTTCAAAGGCAGGCGGG + Intronic
916349917 1:163837374-163837396 TTCCATATTCAGAGACAGGAAGG + Intergenic
917202332 1:172531312-172531334 CTCCAACTGCAGGAGAAGGAAGG + Intergenic
918103793 1:181399110-181399132 CTACAACTTCAGAGGAAGGACGG - Intergenic
918306411 1:183250737-183250759 AATAATCTTCAGAGGAAGGAAGG - Exonic
919481116 1:198091194-198091216 CTCCAACTTCAGTGAAAGCAGGG - Intergenic
920009525 1:202857790-202857812 CCCCATCTTGAGGGGAAGAAAGG + Intergenic
924814104 1:247427514-247427536 ATCTGTCCTCAGAGGAAGGAAGG - Intronic
924814132 1:247427660-247427682 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814146 1:247427733-247427755 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814158 1:247427806-247427828 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814185 1:247427952-247427974 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924814199 1:247428025-247428047 GTCTGTCCTCAGAGGAAGGAAGG - Intronic
924855272 1:247869297-247869319 CTCCCTCTTCAGAGGTGGGGGGG + Intronic
1062984225 10:1752488-1752510 CACCATCCACACAGGAAGGATGG + Intergenic
1063265850 10:4449882-4449904 TTCCATTTTCAGAGGCTGGATGG + Intergenic
1063568935 10:7196754-7196776 CTCTTTCTTCAGAGAAAGTACGG + Intronic
1065440845 10:25752163-25752185 ATCCATTGTCATAGGAAGGAAGG + Intergenic
1066260483 10:33724962-33724984 ATCCACCTTCTGAGGCAGGAGGG - Intergenic
1066290674 10:34011804-34011826 CCCGAACTTCAAAGGAAGGAGGG - Intergenic
1068326234 10:55491428-55491450 CTCCATCTGAAGAGCAAGGTGGG - Intronic
1068876100 10:61998523-61998545 CTCAAGCTTAAGATGAAGGAAGG + Intronic
1069925810 10:71850180-71850202 CTGGATCTGGAGAGGAAGGAAGG - Intronic
1070811199 10:79298942-79298964 CTGCATGCTCAGAGGAAGGCAGG - Intronic
1071432450 10:85617168-85617190 CTCTAGCTTCAGAGGAATGAAGG - Intronic
1072009130 10:91288118-91288140 CACCAACTTCAGTGGGAGGAGGG + Intergenic
1072756751 10:98026633-98026655 CTTCATCTTCAGCGGGAGGAGGG - Intronic
1073340875 10:102743782-102743804 CTTCGTCTTCAGGGGAAGGCGGG + Intergenic
1074057447 10:109935451-109935473 CTCTAACTTCAAAGGAAGGAAGG - Intergenic
1074114283 10:110443952-110443974 CTCCAGCTTCAGAGGGAAAATGG - Intergenic
1075461587 10:122620036-122620058 CTCACACTTCAGAGGTAGGAGGG + Intronic
1076166240 10:128284925-128284947 CTCCATCTTCAGGACAAGGCAGG - Intergenic
1076223650 10:128756108-128756130 CTCCAGCACCAGAGGAAGGAAGG + Intergenic
1076269228 10:129136314-129136336 CCCCCTCTGCAGAGGAAGAAAGG - Intergenic
1076522480 10:131089758-131089780 CTCCTGCTTCAGAGCCAGGAGGG + Intergenic
1077776409 11:5276752-5276774 ATCCATCTTCATGGGAAGGATGG - Intronic
1078544755 11:12239306-12239328 CTCCATGGTCTGAGGAAGGGAGG - Intronic
1078820790 11:14879282-14879304 CTGCATCTTCAGAGGTTGCATGG + Exonic
1079289051 11:19169869-19169891 CTAAATCTGCAGAGGAAGAAAGG - Intronic
1079489333 11:20970091-20970113 CTCTATGTTCAGAGTACGGATGG - Intronic
1079806669 11:24939534-24939556 CTAAATATTCATAGGAAGGAAGG + Intronic
1080128524 11:28766320-28766342 CCTCTTCTTAAGAGGAAGGAAGG - Intergenic
1080161074 11:29177223-29177245 CTCCATCTTCAGAATAAAGTTGG + Intergenic
1080165233 11:29227723-29227745 CTCCATCTTACGAGAAAGGGAGG + Intergenic
1080556446 11:33421673-33421695 CTCCATGTTTTGAGGAAGGAAGG + Intergenic
1081155052 11:39680056-39680078 TTCCATCTGCAGAGGGTGGAGGG + Intergenic
1082066516 11:47905282-47905304 CTCCTTCTTCAGATGACAGATGG + Intergenic
1084955234 11:72687733-72687755 CCCCAGCTACAGAGGAAGAAGGG + Exonic
1085283853 11:75347400-75347422 CTCTTTTTTCAGAGAAAGGAGGG - Intronic
1088704299 11:112447968-112447990 CCCCACCTTCAGACCAAGGAGGG - Intergenic
1088766790 11:112989866-112989888 CTGCATCTTTAGAGGAATTAAGG - Intronic
1088912679 11:114203858-114203880 CTCCATTTTCAGAAACAGGAAGG + Intronic
1089075439 11:115734750-115734772 CTTCCCCTGCAGAGGAAGGAAGG - Intergenic
1089296136 11:117469494-117469516 CTCCACCCTCAGAGGTAGGGAGG + Intronic
1089600503 11:119611598-119611620 CTCCAACTTCCGGGGCAGGACGG - Intergenic
1090237787 11:125162190-125162212 CTTCATCCTCAGAGGGATGATGG + Intergenic
1090609690 11:128459593-128459615 CGTTAACTTCAGAGGAAGGATGG - Exonic
1090647330 11:128776642-128776664 CTCTGTCTTCAGAGGAAAAAAGG + Intronic
1091309727 11:134563738-134563760 CACCATCTTCGGAGGAATGATGG + Intergenic
1092121005 12:6043926-6043948 CTCCATTTTCATAGCATGGAAGG + Intronic
1093441615 12:19204109-19204131 CTCCATGTTAAGAGGCAGGAGGG + Intronic
1093569513 12:20650553-20650575 CTCCATCTTCAGTGGACAGATGG + Exonic
1093858561 12:24135666-24135688 CTGGATGTTCAGAGGATGGAGGG + Intergenic
1095878737 12:47109265-47109287 CTCCATTTACAGAGAGAGGAAGG - Intronic
1096617293 12:52840822-52840844 CTGCACCTTCAGAGGGAGCACGG + Intronic
1097102952 12:56602101-56602123 CTCCATCTTCATAGAGAAGAGGG + Exonic
1097151572 12:56983294-56983316 CTCCATGTTCTGGGGAGGGAGGG - Intergenic
1098608456 12:72423888-72423910 CTCCATCTTCAAAGTCAGCAAGG - Intronic
1099840939 12:87966250-87966272 CACCATCTTCAGACACAGGAAGG - Intergenic
1100650628 12:96584872-96584894 CTCCATCTTTGGAGGAAAGGTGG + Intronic
1101557393 12:105823076-105823098 CCCTATTTTCAGTGGAAGGAGGG + Intergenic
1102701992 12:114847478-114847500 CCCCATCTTCAGAGGCAGACCGG + Intergenic
1104064000 12:125291467-125291489 CTCCATCTTCAGAGCCAGCATGG - Intronic
1104350425 12:128040482-128040504 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1105822040 13:24088413-24088435 CTTCATCTCAAGAGGAAGAAAGG - Intronic
1106509100 13:30397815-30397837 CTCCTTCTACAGAGGGAAGATGG + Intergenic
1108091829 13:46857421-46857443 CTGCATCCTCACAGGATGGAAGG + Intronic
1109011225 13:56947595-56947617 CTCCATCTTCAAAGCCAGCAAGG + Intergenic
1110408383 13:75176273-75176295 CTCCATCTTCAAAGCCAGCAGGG - Intergenic
1110442314 13:75539039-75539061 CTCCACCTTCAAAGCCAGGAAGG + Intronic
1110515636 13:76408945-76408967 CTCCTTTTTCACAGCAAGGAAGG - Intergenic
1111221557 13:85211198-85211220 CTCCAACTGCACAGGAAGTATGG + Intergenic
1112560675 13:100510925-100510947 CTGCACCTCCAAAGGAAGGACGG + Intronic
1114243882 14:20894668-20894690 TTCCATCTTCACAGGCATGAAGG - Intergenic
1114377440 14:22163330-22163352 CTGCATCTTCACAGGAGGGATGG + Intergenic
1114678395 14:24461083-24461105 TTCCATCTACAGAGGTAGCATGG + Intergenic
1115935719 14:38549954-38549976 TACCTTCTTTAGAGGAAGGATGG + Intergenic
1117788549 14:59313721-59313743 CTCCCTTTTAAGAGGAAAGAAGG + Intronic
1119473607 14:74914086-74914108 CTCCATCATCAGTGAAAGGAAGG + Intronic
1119895371 14:78215342-78215364 CTCCTTCATCAGTGGAAGGAAGG + Intergenic
1121492397 14:94369786-94369808 CTCCACCTGTAGAGGCAGGAAGG - Intergenic
1121924367 14:97914521-97914543 CCCCATCTTCTCAGGAAGGGAGG - Intergenic
1122138120 14:99646112-99646134 CTCCACCCTCAGAGGGAAGATGG - Intronic
1123933067 15:25181177-25181199 CTCCATCCCCAGAGAAAGGTGGG + Intergenic
1124545610 15:30624118-30624140 TTTCATCTTAAGAGAAAGGAAGG + Intergenic
1124779128 15:32613513-32613535 TTTCATCTTAAGAGAAAGGAAGG + Intergenic
1125241553 15:37582441-37582463 CCCCACCTTCAGACGAGGGAAGG + Intergenic
1125362084 15:38874926-38874948 TACCACCTTCAGAGGAAAGATGG - Intergenic
1125678850 15:41517972-41517994 CTCCATCTTCAGAGGAAGGAAGG - Intronic
1125987397 15:44067580-44067602 CTGCATCCTCAGAGGGTGGAGGG + Intronic
1126163125 15:45632224-45632246 CTCCATCAAAAAAGGAAGGAAGG - Intronic
1126645042 15:50867449-50867471 CTGGATCTGCAAAGGAAGGAAGG + Intergenic
1126920835 15:53522069-53522091 GTCCATCTTCAGAGGAATCTTGG + Intronic
1127507381 15:59610290-59610312 CTGCTTATTCACAGGAAGGAAGG - Intronic
1127965844 15:63922448-63922470 CCCCTTCTGCAGAGGGAGGATGG - Intronic
1128207679 15:65867818-65867840 CTCCATCTTCAAAGCCAGCAAGG + Intronic
1129678698 15:77646001-77646023 CTCCATCTGCAAAGCAGGGATGG + Intronic
1130029011 15:80295224-80295246 CCCCACCTTCAGACCAAGGAGGG - Intergenic
1130712095 15:86293421-86293443 CTCCATCTTCAAAGCCAGCAAGG + Intronic
1131652899 15:94421594-94421616 CTCCATCTTCAGATCCAGCAAGG + Intronic
1132566670 16:626634-626656 GTCCTTCTTAAGAGGAAGCACGG + Intronic
1133254942 16:4511039-4511061 AACCAGCATCAGAGGAAGGAAGG + Exonic
1133857642 16:9564720-9564742 CTCCATCTGCACTGGAAGGGTGG - Intergenic
1135349304 16:21715305-21715327 CTCCGTCTGGAAAGGAAGGAAGG - Intronic
1136849290 16:33601076-33601098 TTCCATCTGCACAGGAGGGAAGG + Intergenic
1137282726 16:46992288-46992310 CCCCATCTTCAGACTAGGGAGGG - Intergenic
1138029623 16:53550116-53550138 CTCCATCTACAGCCGGAGGAAGG - Intergenic
1138347100 16:56326746-56326768 CTCCATGGGCAGAGGCAGGAGGG + Intronic
1139503738 16:67388619-67388641 CCCCATTTTCACAGCAAGGAAGG + Intergenic
1139670777 16:68491387-68491409 CCCCATCCTCAGGGGCAGGAGGG + Intergenic
1139912641 16:70407609-70407631 CTGCATCTCCTGAGGATGGAAGG - Intronic
1141079977 16:81041864-81041886 CGCAATCTTAAGAGGAGGGAGGG + Intronic
1141681249 16:85545234-85545256 CTCCGTAGTCATAGGAAGGAAGG + Intergenic
1141879464 16:86848146-86848168 CTCCAGATTCAGAGGCAGGCAGG - Intergenic
1142160380 16:88554512-88554534 CTCCATCTTCAGAGCCAGCAGGG + Intergenic
1203110997 16_KI270728v1_random:1449726-1449748 TTCCATCTGCACAGGAGGGAAGG + Intergenic
1142867520 17:2799760-2799782 CTCCCTCTCCAGAGGCAGAAAGG - Intronic
1142947619 17:3446061-3446083 CTCCATCTTCAAAGCCAGCAAGG + Intronic
1143254850 17:5548390-5548412 CTCTATCCTCAGAGGGAGGAGGG - Intronic
1143444666 17:7000424-7000446 CTCCATCTTCAGCATAACGAGGG - Exonic
1144025570 17:11273529-11273551 TTCCAGCTTGAGAGGAAGGCTGG + Intronic
1144328055 17:14200531-14200553 CTCCATTTTCTGAGGAAGGAGGG + Intronic
1144996399 17:19272260-19272282 GGCCATCCTCAGAGGAGGGAAGG + Intronic
1145776060 17:27529790-27529812 TTCCAGCTTCAGAGAAAAGACGG - Intronic
1145975004 17:28978810-28978832 CTGCATCATCAGGGGAGGGATGG + Intronic
1145980715 17:29009791-29009813 CTCCAGCTTCAATGGATGGATGG - Intronic
1146836775 17:36117333-36117355 CTCCCTCTTCCCAGGCAGGATGG + Intergenic
1148089293 17:45013240-45013262 CTCCAACTTCAGTGGGAGGCTGG - Intergenic
1149658046 17:58320479-58320501 CACCATCTTGGGAGGAAGGCGGG - Intronic
1150651108 17:67010771-67010793 CCCCATTTCCACAGGAAGGAAGG - Intronic
1151602337 17:75113934-75113956 CTCCAGGTGCAGGGGAAGGACGG + Intronic
1153347096 18:4038736-4038758 GTCCAACCTCAGAGGCAGGATGG - Intronic
1154083585 18:11280853-11280875 CTGCATCTGCAGAGGAAGTGCGG + Intergenic
1155876980 18:31101146-31101168 CTAAATCTTCGGAGGAAGGAAGG - Intronic
1156401152 18:36741808-36741830 CTCCATCTTCTGGCAAAGGAAGG + Intronic
1156464984 18:37342982-37343004 CTCCTCCTTCAGTGTAAGGACGG - Intronic
1157273476 18:46294131-46294153 CCCCAGCTTCAGACAAAGGAGGG - Intergenic
1157651972 18:49342234-49342256 TTCCATCTTCGAAGGAAGCAAGG + Intronic
1157989416 18:52477189-52477211 CTCCATCTTCTGTGAAAGAATGG + Intronic
1158292720 18:55959598-55959620 CACCCTCTTCAGAGGCAAGAAGG + Intergenic
1158376801 18:56879980-56880002 CTACATCTTACGAGGAAAGACGG + Exonic
1158438151 18:57449048-57449070 CTTCCTCTTCAGAAGAATGAAGG - Intronic
1158661296 18:59390620-59390642 CTTCATCTTCAGAGGAAGTATGG + Intergenic
1160064895 18:75565553-75565575 CTACAGCTTCACAGGAAGGCTGG - Intergenic
1160537247 18:79601261-79601283 CTGGATCTGCAAAGGAAGGAAGG - Intergenic
1161998092 19:7726789-7726811 TTCCATCTTCAAAGGCAGTAGGG - Intergenic
1163498903 19:17663746-17663768 CTCCACCTTGGGAGGAAGGTGGG + Intronic
1163658129 19:18560009-18560031 CTCCATCTCGAAAAGAAGGAAGG - Exonic
1164938650 19:32233962-32233984 TTCCATCTTCTGAGGCAGAAAGG - Intergenic
1165031479 19:33000778-33000800 TTCCATCTGCACAGGAGGGAAGG - Intronic
1166298769 19:41902676-41902698 CTCCAGCTTCCCAGGGAGGAGGG + Intronic
1166345272 19:42161745-42161767 CTTCATCTTCAGGGGCAGAAGGG + Intronic
1167294018 19:48639048-48639070 GTGCATCTGCAGTGGAAGGAGGG + Exonic
1167495939 19:49818743-49818765 CTCCTTGTTCTGAGGGAGGAGGG + Intronic
1168254414 19:55157878-55157900 CTCCAGGATCAGAGGGAGGAGGG - Intronic
925866714 2:8234549-8234571 CTCCACACTGAGAGGAAGGAAGG + Intergenic
925971274 2:9108189-9108211 CACCATCTTCACAGGCAGCAAGG - Intergenic
926221707 2:10940459-10940481 CTCTGTCTTCAAAGAAAGGATGG - Intergenic
927089791 2:19701546-19701568 CTCCATTTTGAGGGCAAGGAAGG + Intergenic
927364151 2:22274709-22274731 CTCCAGTTTCAGAGGAAATAAGG + Intergenic
929585329 2:43110345-43110367 CTGCATCTTCAGAGGAATTAGGG - Intergenic
930980230 2:57516109-57516131 ATCGATATTCAGAGAAAGGACGG + Intergenic
931541389 2:63333406-63333428 CTGGATCTGCAAAGGAAGGAAGG - Intronic
932211039 2:69930775-69930797 CTCCTTCTACAGAGGAAGCTAGG + Intronic
932685528 2:73866057-73866079 CTACTTCTTGAGATGAAGGAAGG + Exonic
934174169 2:89564531-89564553 ATACATCTTCAGAAAAAGGAGGG + Intergenic
934284485 2:91638880-91638902 ATACATCTTCAGAAAAAGGAGGG + Intergenic
935154520 2:100471199-100471221 CACCATCTTCATAGGATGCAGGG + Intronic
937064627 2:119008318-119008340 CTCCATCTAGAGTTGAAGGATGG + Intergenic
937651011 2:124319060-124319082 CTACCTGTTGAGAGGAAGGATGG + Intronic
938232389 2:129672412-129672434 CTCCATCTTCAAGGGTAGAATGG + Intergenic
938780771 2:134582822-134582844 CTCCATCCTGAGAGGAGGAAAGG + Intronic
939004566 2:136770962-136770984 CTTCCTCTTAACAGGAAGGAAGG - Intronic
939077177 2:137617821-137617843 CTACATCCTCAGAGGATGGAAGG + Intronic
940106664 2:150108849-150108871 CTGTATCTTCAGTTGAAGGATGG + Intergenic
940941942 2:159571769-159571791 CTCCATCATAACAGGATGGAAGG + Intronic
943807617 2:192141681-192141703 CCCCATCTTTAGAGGCAGGAAGG + Intronic
944125849 2:196291977-196291999 ATCCACCTACAGAGGAAGTACGG + Intronic
944818954 2:203409547-203409569 CTCCATCTTCATAGTTACGAAGG + Intronic
945529299 2:210930692-210930714 CTCCATCTTCAAAGCCAGGAGGG + Intergenic
945908728 2:215622629-215622651 CATCATCTTTAGATGAAGGAGGG - Intergenic
946082146 2:217130351-217130373 CTCCATTTCCAGAGGACGGAGGG + Intergenic
948282347 2:236757008-236757030 TTCCATCTTGAGAGGAATGTGGG - Intergenic
948318186 2:237046241-237046263 CTCCACCTGTAGAGGAAGCAAGG + Intergenic
948361895 2:237427765-237427787 GTCCATCTTCAGGAGAATGAGGG - Intergenic
1172840384 20:37899512-37899534 CTCCATCTGTAAAAGAAGGAAGG + Intergenic
1173415912 20:42855731-42855753 TTCCATCTTGAAAGGGAGGATGG - Intronic
1174215898 20:48916057-48916079 CTCCATCTTTAAAGGAAAGTTGG - Intergenic
1175674067 20:60931811-60931833 CTCCTGCTACAGAGGAAGTAGGG - Intergenic
1177096443 21:16840646-16840668 CTCCAGCTTCAAATGAAGGTTGG - Intergenic
1177919520 21:27133533-27133555 CTCACTGTTCACAGGAAGGAAGG + Intergenic
1178174167 21:30077194-30077216 GTCCTTATTAAGAGGAAGGAAGG + Intergenic
1178258118 21:31073967-31073989 CTCCATCTTCAAAGCCAGCAGGG + Intergenic
1178460258 21:32796227-32796249 CTCCATCCTCACATGCAGGACGG - Intronic
1179058978 21:37962236-37962258 CTCCTTCTTCTATGGAAGGAGGG - Intronic
1179068845 21:38053042-38053064 ACACATTTTCAGAGGAAGGAAGG + Intronic
1179249117 21:39658063-39658085 CTCCTCCTTCAGTGGAAGGCTGG + Intronic
1179381739 21:40905627-40905649 CTCCATTTTCAGATGCAAGATGG - Intergenic
1181412688 22:22735148-22735170 AAGCATCTTCAGAGCAAGGAGGG - Intronic
1181416024 22:22759270-22759292 AAGCATCTTCAGAGCAAGGAGGG - Intronic
1181645460 22:24229086-24229108 CTCCATCTCCAGAAAAAAGAAGG + Intronic
1181752946 22:25002428-25002450 CTTCCTCCCCAGAGGAAGGAGGG + Intronic
1182141198 22:27959943-27959965 ATCCATATGCAAAGGAAGGAAGG + Intergenic
1182768160 22:32773834-32773856 TTCTATCTGAAGAGGAAGGAGGG + Intronic
1183424200 22:37729823-37729845 TTCCATATTCAGAGGATGAATGG - Intronic
1183865918 22:40704036-40704058 CTCCATTTCCCAAGGAAGGAAGG - Intergenic
1184106104 22:42368427-42368449 CTCCAGCTCCCGAGGAAGGGGGG + Intergenic
1184553116 22:45216078-45216100 CTCTCTCTTCAGAGGGAGGAAGG + Intronic
1184916821 22:47575036-47575058 CCTCAGCTCCAGAGGAAGGAGGG - Intergenic
1185157564 22:49203356-49203378 CTCAAGATGCAGAGGAAGGAAGG + Intergenic
951345464 3:21542925-21542947 CCCAGTCTTCAGATGAAGGAAGG + Intronic
952701124 3:36328696-36328718 CACTATCTTTTGAGGAAGGAGGG + Intergenic
954918096 3:54165497-54165519 CTCCATATATTGAGGAAGGAAGG + Intronic
955375698 3:58394802-58394824 CTCCTTCTTCAGATGGAGGAAGG - Intronic
956804488 3:72795610-72795632 CTCTCTTTTTAGAGGAAGGAGGG + Intronic
956824595 3:72986058-72986080 CTCCATGTTCAGATGAAAAATGG + Intronic
957128871 3:76198199-76198221 CACCATGTTCTGAGGGAGGAGGG - Intronic
957218368 3:77350438-77350460 CTCCATATTCAGTGGAAGTGAGG - Intronic
959385525 3:105701028-105701050 CTCCATCAGCAGAGGGAAGATGG + Intronic
959787343 3:110316670-110316692 CTTCATCTTTATAGGAAGGAAGG + Intergenic
959861921 3:111226149-111226171 CTTCATCTTCAAAGCTAGGAGGG + Intronic
959886674 3:111510451-111510473 CTGCATCTTCACATGGAGGAAGG + Intronic
960721244 3:120626405-120626427 CTCTTTCTTCAGAGGAAGGAAGG - Intergenic
961452086 3:127006808-127006830 CCCCAGCCTCAGAGGAAGGATGG + Intronic
961580202 3:127874724-127874746 CTTCATCTGCAGAGGAAGCCAGG + Intergenic
962785955 3:138768551-138768573 CTCCATCTTCAGGCCAGGGAGGG - Intronic
962859147 3:139381556-139381578 CTCCATTCTTAGAGGAAAGAAGG + Intronic
963122347 3:141786934-141786956 CTCCATCTTCAAAGCCAGCAGGG - Intronic
964438512 3:156678069-156678091 CTGGAGCTTCAGTGGAAGGATGG - Exonic
965579105 3:170248002-170248024 CTGCATATCCAGAGGCAGGATGG + Intronic
968885836 4:3331746-3331768 CTCCATCCCCAGCGAAAGGAAGG + Intronic
969176699 4:5404236-5404258 CACCCACTTCAGAGGAAGCAGGG - Intronic
969595975 4:8149491-8149513 CCACAGGTTCAGAGGAAGGAGGG + Intronic
969828026 4:9773477-9773499 ATACATCTTCAGAAGAAGGAGGG + Intronic
970538640 4:17055551-17055573 CCCCATCTCCAGAGCAAGGTGGG - Intergenic
970821879 4:20226267-20226289 CTCCATCTTCAAAGCCAGTAGGG - Intergenic
971938837 4:33188858-33188880 CTCCACCTTCAGACCAGGGAGGG - Intergenic
972086837 4:35228260-35228282 CTCCAGCTTCAGAGACAAGAGGG - Intergenic
972191917 4:36603522-36603544 CTCCATTTTAAGAAGAATGATGG - Intergenic
973567376 4:52201859-52201881 CTCCATCTTCACAGCCAGCAAGG - Intergenic
975735093 4:77373068-77373090 CTCAATCCCCAGAGTAAGGAGGG + Intronic
976319050 4:83690721-83690743 CTGCATCTTCACATGATGGAAGG + Intergenic
976784530 4:88802886-88802908 CTCCAGTCTCAAAGGAAGGAGGG - Intronic
976964318 4:91017201-91017223 CTCCCTCATCAGGAGAAGGAGGG - Intronic
977555743 4:98485889-98485911 CTTCATTTGCTGAGGAAGGATGG - Intronic
978411845 4:108434483-108434505 TTCAAGCCTCAGAGGAAGGATGG + Intergenic
979145351 4:117239899-117239921 CCCCATCTTCAGACCAGGGAGGG + Intergenic
981972728 4:150685043-150685065 TTACACCTTGAGAGGAAGGAGGG - Intronic
982956472 4:161774313-161774335 TTCCAAGTTCAGAGGAAGCATGG + Intronic
984075366 4:175170945-175170967 CTGTATCTGCAGTGGAAGGAAGG - Intergenic
985002811 4:185502776-185502798 CTCCCTCTTCAAAGAAACGATGG - Intronic
985300642 4:188485360-188485382 CTCCATCTTCAAAGACAGGAAGG - Intergenic
987090859 5:14506896-14506918 CTCCATCTTAAGAGGGAAGCCGG - Intronic
987360070 5:17098576-17098598 CTCCATCTCAAGAAAAAGGAAGG - Intronic
987360334 5:17100541-17100563 CTCCATCTTCAAAGACAGTATGG + Intronic
987385480 5:17325105-17325127 CTCCATCTTCAAAGCCAGCATGG - Intergenic
988131676 5:27114363-27114385 CTCCATCGAAAGAGGAAAGAAGG + Intronic
989299916 5:39878694-39878716 CTCCATCTTCAAAGCCAGCAGGG - Intergenic
991111805 5:62908758-62908780 CTCCCTCTAAAGAGGAAGAAAGG - Intergenic
993117248 5:83733703-83733725 CCCCATCCACTGAGGAAGGATGG + Intergenic
994344540 5:98669012-98669034 CTCCATCCACTGAGGAAGGATGG - Intergenic
995346930 5:111132279-111132301 CTCTTCCTTCAGAGGAAGAAAGG - Intergenic
995476714 5:112555441-112555463 CCTCATCTGCAAAGGAAGGAGGG + Intergenic
996563104 5:124851595-124851617 CTCCGTCTCGAAAGGAAGGAAGG - Intergenic
996624757 5:125557317-125557339 CTCCATCTTCAAAGCCAGCAGGG + Intergenic
998173708 5:139887279-139887301 CTCCTTCTCGAGAGGAGGGAGGG + Intronic
999210664 5:149885884-149885906 CTCCATCTTCAAAGCCAGCAGGG + Intronic
999504413 5:152180087-152180109 CTCTATATTCAGAGGATGTATGG - Intergenic
999907274 5:156155729-156155751 CTCCATCTTGTGAAGACGGAGGG - Intronic
1000289547 5:159857898-159857920 GTCCATGGTCAGAGGGAGGAAGG - Intergenic
1004387497 6:15185305-15185327 CTCCATCAAGAAAGGAAGGAAGG + Intergenic
1004600397 6:17144637-17144659 CCCCATCCCTAGAGGAAGGAGGG - Intergenic
1004634826 6:17456669-17456691 TTCCATCTTTAGAGGAAGAGGGG + Intronic
1004738404 6:18431757-18431779 CTTCATCTTCAAAGGATGGCAGG + Intronic
1005205075 6:23393677-23393699 CTCCATCTCGAAAGGAAGGAGGG + Intergenic
1005420172 6:25640631-25640653 CTCTATGTTCAGAGCATGGAAGG + Intergenic
1005805154 6:29467919-29467941 CTCCATCATCCCAGCAAGGAGGG - Intergenic
1005814618 6:29540738-29540760 CTCCATCATCCCAGCAAGGAGGG - Intergenic
1007176307 6:39900063-39900085 CTCCAGCTCCTGAGGAGGGAGGG - Exonic
1008088390 6:47268050-47268072 CTCCTTCTCCAAAGGATGGAAGG + Intronic
1008538491 6:52526285-52526307 CTCCATTTTTATAGTAAGGAAGG + Intronic
1008555218 6:52666907-52666929 CTACCTCTCCAGAGGCAGGAGGG - Intergenic
1008972343 6:57384236-57384258 CAGCACCTTCAGAGGAAGCATGG - Intronic
1009161253 6:60285760-60285782 CAGCACCTTCAGAGGAAGCATGG - Intergenic
1012159023 6:95859623-95859645 CTACATCGTAACAGGAAGGAAGG + Intergenic
1012369469 6:98485777-98485799 CTCCATCTTCCTGGTAAGGAGGG + Intergenic
1012380994 6:98619475-98619497 CTACATCTACAGATGAAGAAAGG + Intergenic
1013302551 6:108818143-108818165 CTCCTTCAAGAGAGGAAGGAGGG - Intergenic
1013356641 6:109351127-109351149 TTCCATGTTCACAGGAGGGAAGG - Intergenic
1013958269 6:115866429-115866451 GTCTAGCTACAGAGGAAGGAGGG - Intergenic
1015793823 6:136990350-136990372 CTCTATTTTCAGGGGAAGAATGG - Intergenic
1015796433 6:137016486-137016508 GTCCATCTTCAGAGAAACAAAGG - Intronic
1017061570 6:150490127-150490149 AACCATCTTCAGAGGGAGGCTGG - Intergenic
1017268862 6:152482710-152482732 CTCCATTCTCAAAGGAAGGCAGG - Intronic
1018045177 6:159959622-159959644 CTTCCCCTTCAGAGGAAGCATGG - Intergenic
1018126879 6:160690784-160690806 CTCCATATTCAGAGCAAGAAGGG - Intergenic
1018149666 6:160926291-160926313 CTCCATCTTCACAGCATGAAGGG + Intergenic
1018266759 6:162032707-162032729 CTCCTTTTTCAGAGAAAGCATGG + Intronic
1019458339 7:1144250-1144272 GTCCAGCGTCACAGGAAGGACGG - Intergenic
1019701117 7:2475461-2475483 CCCCATCTTGGGAGAAAGGAGGG - Intronic
1021028094 7:15694345-15694367 CTCCATCTTCAGAGCCAGGGTGG + Intergenic
1021867416 7:24971846-24971868 CTCCACCTTCAAAGGAAGGATGG + Intronic
1021891771 7:25193575-25193597 CCCCATCTCAAGAGGAGGGATGG - Intergenic
1022955967 7:35380652-35380674 CTCCATCTTCAGAAGGTGGAGGG - Intergenic
1023030655 7:36087977-36087999 CTCCATCTTCAAAGCCAGCAGGG - Intergenic
1023204673 7:37735088-37735110 CTGCATCTTCATGGGATGGAAGG + Intronic
1024889252 7:54182143-54182165 CTCCCTCTTTAGAGGGAGAATGG - Intergenic
1025983047 7:66423671-66423693 CATCATCTTCAGGGGGAGGAGGG + Intergenic
1026870585 7:73848843-73848865 CTCCATCAAGAAAGGAAGGAAGG - Intergenic
1028310881 7:89334312-89334334 CTCCACGTTCAAAGCAAGGATGG + Exonic
1028439419 7:90841893-90841915 CCTCATCTTCAGTGTAAGGATGG - Intronic
1028442524 7:90880354-90880376 CCCCATCCACTGAGGAAGGATGG - Intronic
1028953588 7:96664435-96664457 CTCCATCTTCAAAGACAGCAAGG + Intronic
1030074586 7:105725449-105725471 CACCATCTGAAGAGGAAGTAAGG - Intronic
1030318062 7:108136668-108136690 CAGCACCTTCAGAGGAAGCATGG + Intergenic
1030360532 7:108590623-108590645 CTCCATCTTCAAAGCCAGCAAGG - Intergenic
1030985239 7:116233839-116233861 CTGCATCTTCACATGGAGGAAGG + Intronic
1031023432 7:116652987-116653009 ATCCACCTTCAGAGGAGGGATGG - Intergenic
1031882400 7:127211709-127211731 CTGCATCTTCACAGGGTGGAAGG - Intronic
1032576599 7:133061123-133061145 CTGCATCCTAAGAGGAAGGCCGG + Intronic
1032896498 7:136256860-136256882 CTCCATCTACAGAGGAACCAGGG - Intergenic
1035528916 8:336176-336198 CTCCTTCTTCAGCAGAAGCATGG + Intergenic
1035966953 8:4203198-4203220 CTCCATCTTCAAAGCCAGCAAGG - Intronic
1037670806 8:21013610-21013632 CACCTTATCCAGAGGAAGGAGGG - Intergenic
1037847728 8:22298810-22298832 CAGCATCTTCTGAGGAAGGGTGG + Intronic
1039165866 8:34679526-34679548 TTCCATCTTGAGTGGCAGGATGG - Intergenic
1040492861 8:47941284-47941306 CTCCCTATTCTGAAGAAGGAGGG + Intronic
1040603732 8:48909835-48909857 CTCCATCTTCAGAGATTAGATGG - Intergenic
1040725651 8:50378962-50378984 CTCCACCTTCAGGGCAGGGAGGG - Intronic
1042470559 8:69182948-69182970 CTTCATCTTCATATGAAGAATGG - Intergenic
1042583499 8:70308922-70308944 CCCCAGCTTCAGGGGAAGGGCGG - Intronic
1043245867 8:78000369-78000391 CTCCATCTTTAGCTGAAGGAAGG + Intergenic
1043385696 8:79745617-79745639 CTGCATCTCCTGAGAAAGGAGGG + Intergenic
1044000100 8:86868984-86869006 CTCCATCTTCAAAGCCAGCAAGG - Intronic
1045119782 8:99023798-99023820 ATCCATCTACAAAGGAATGATGG - Intronic
1045495883 8:102708182-102708204 CTCCATCTTCAAAGCCAGAAGGG - Intergenic
1046259757 8:111752061-111752083 CTCCATCTTCAAAGTCAGCATGG + Intergenic
1046301411 8:112296692-112296714 CTCCATGTTAAGAAGAAGCAAGG + Intronic
1046722115 8:117632154-117632176 CTCCTGGTTCAGAGTAAGGAGGG + Intergenic
1047377649 8:124317808-124317830 CTGCATCTTCAGAGCCAGCAAGG - Intronic
1047616206 8:126564470-126564492 CTTGACCTTCAGATGAAGGAAGG + Intergenic
1047749086 8:127866506-127866528 CTTCAGCATCAGAGGAATGAAGG + Intergenic
1048234520 8:132676422-132676444 CTCCATTTGCAGAAAAAGGAGGG + Intergenic
1048361757 8:133703449-133703471 CTCCATTTTCAGAGAGATGAAGG - Intergenic
1049576254 8:143391291-143391313 CTTCCTCTTGGGAGGAAGGAAGG - Intergenic
1050008513 9:1160274-1160296 TTCCATTTTCAAAAGAAGGAAGG - Intergenic
1050766741 9:9143742-9143764 ATCCATCCTCAGAGAGAGGAAGG + Intronic
1054732183 9:68712586-68712608 CTTCATCTTGACAGGATGGATGG - Intronic
1054923022 9:70560636-70560658 CTCCTTCTTCAGAGGCACCAAGG - Intronic
1054946302 9:70799513-70799535 CTCCTTTTCCAGAGGAAAGAAGG - Intronic
1056036249 9:82609064-82609086 CTCCATCTTCAAAGTCAGCATGG + Intergenic
1057935029 9:99230437-99230459 CTCCTTCTTCAGATGACAGATGG - Exonic
1058092018 9:100815090-100815112 TAACATCTTCAGGGGAAGGAGGG - Intergenic
1058280116 9:103103518-103103540 CTCCACCTTCAGACCAGGGAAGG + Intergenic
1060252178 9:121995269-121995291 CTCGATCTGCAGGCGAAGGATGG + Intronic
1061601030 9:131670224-131670246 ATTCAAGTTCAGAGGAAGGAGGG + Intronic
1061941810 9:133887822-133887844 TTGCATCTTCAGGGGAGGGAAGG + Intronic
1062262213 9:135668461-135668483 CTTCATCATCAGGGAAAGGAGGG - Intergenic
1062725063 9:138068237-138068259 CTGCATCTGCAGAGGAGGAAGGG + Intronic
1186690594 X:11971164-11971186 CTCCAATTTTAGAGTAAGGATGG - Intergenic
1187064125 X:15816257-15816279 AGCCACCTACAGAGGAAGGAAGG - Intronic
1187223810 X:17356264-17356286 GTCCAGCTGGAGAGGAAGGAGGG + Intergenic
1188270893 X:28139417-28139439 CTCCTCCTGCAGAGGAAGGGAGG + Intergenic
1189194634 X:39142506-39142528 TTACATTTTCAGAGGAAAGAGGG - Intergenic
1194775378 X:97956578-97956600 CTCCATCTTCAAACCAATGATGG + Intergenic
1195068117 X:101255543-101255565 CTGCAACTTCAGATGAGGGAGGG - Intronic
1196260922 X:113580357-113580379 CTCTATCTTGAGAGGTGGGAGGG + Intergenic
1199735320 X:150680667-150680689 CTCCATCTTCAAAGCCAGCATGG - Intergenic
1199765010 X:150935089-150935111 CTCCATATTGAGAGGAAGGTGGG - Intergenic
1199881825 X:151979582-151979604 CTTCTTCCTCAGAGGAGGGAAGG + Intergenic
1201924098 Y:19266115-19266137 CTCCATCCTCAGAGGATGTATGG - Intergenic
1202605597 Y:26637235-26637257 ATCCACCTTCACAGGATGGAAGG - Intergenic