ID: 1125681100

View in Genome Browser
Species Human (GRCh38)
Location 15:41530694-41530716
Sequence GGATGGACAGAGCCAGAGCT GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 430}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125681091_1125681100 21 Left 1125681091 15:41530650-41530672 CCATCTTTCCCCCAGCACTGTGA 0: 1
1: 0
2: 3
3: 54
4: 433
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430
1125681089_1125681100 26 Left 1125681089 15:41530645-41530667 CCCTGCCATCTTTCCCCCAGCAC 0: 1
1: 0
2: 5
3: 45
4: 509
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430
1125681095_1125681100 10 Left 1125681095 15:41530661-41530683 CCAGCACTGTGAGCAGAGAGAGA 0: 1
1: 1
2: 4
3: 38
4: 331
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430
1125681094_1125681100 11 Left 1125681094 15:41530660-41530682 CCCAGCACTGTGAGCAGAGAGAG 0: 1
1: 2
2: 4
3: 48
4: 350
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430
1125681092_1125681100 13 Left 1125681092 15:41530658-41530680 CCCCCAGCACTGTGAGCAGAGAG 0: 1
1: 1
2: 8
3: 50
4: 590
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430
1125681093_1125681100 12 Left 1125681093 15:41530659-41530681 CCCCAGCACTGTGAGCAGAGAGA 0: 1
1: 0
2: 2
3: 65
4: 340
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430
1125681090_1125681100 25 Left 1125681090 15:41530646-41530668 CCTGCCATCTTTCCCCCAGCACT 0: 1
1: 0
2: 1
3: 24
4: 372
Right 1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG 0: 1
1: 0
2: 2
3: 37
4: 430

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125681100 Original CRISPR GGATGGACAGAGCCAGAGCT GGG Intronic
900120216 1:1045637-1045659 GGCTGGGCAGAGCCAGGGTTGGG + Intronic
900338498 1:2176637-2176659 TGGAGGACAGAGCTAGAGCTGGG - Intronic
900600125 1:3499281-3499303 GGCTGGTCAGAGCCAGGGGTGGG + Intronic
900938647 1:5783262-5783284 GGAAGGACAGTGCCGGAGCCTGG - Intergenic
901462167 1:9398321-9398343 GGAGAGACAGGCCCAGAGCTGGG + Intergenic
901967935 1:12883307-12883329 GGGTGGACATGGCCAAAGCTTGG + Exonic
902017240 1:13318473-13318495 GGGTGGACATGGCCAAAGCTTGG - Exonic
902043816 1:13511092-13511114 GGATGGACAGGTTCAGAGCAAGG - Intronic
903350714 1:22714896-22714918 GGATGGAAAGAAGCAGAACTGGG - Intronic
903460329 1:23516382-23516404 GGCTGGGCAGAGTCAGGGCTGGG + Exonic
903882434 1:26520617-26520639 GAAGGGAGAGAGCCAGAGATTGG - Intergenic
904256545 1:29258438-29258460 GGAGGGACAGGGCCAGGGCAAGG - Intronic
904581075 1:31544744-31544766 GGATGGACATTGTCAGAGATGGG + Intergenic
905459542 1:38113665-38113687 GAAAGGACAGATCCAGAGCCAGG + Intergenic
905732932 1:40308457-40308479 GGCTGGGCTGAGCCAGAGCAGGG + Intronic
908299876 1:62753381-62753403 GGCTGGCCAAGGCCAGAGCTGGG + Intergenic
910739882 1:90503600-90503622 GTGGGGACAGAGCCAGTGCTGGG - Intergenic
911935262 1:103961184-103961206 GGATGTCCAGAGCCATGGCTGGG + Intergenic
912331379 1:108823178-108823200 GGATGGCAAGAGGCTGAGCTGGG - Intronic
912381516 1:109250237-109250259 GGATGGACAGAGCCAGCCCATGG - Exonic
912410769 1:109479446-109479468 GCATGGACAGGGCCAGGGCCAGG + Exonic
914689486 1:150012773-150012795 GGATGGTCAGAGCAAGAAATAGG - Intergenic
915611664 1:156998438-156998460 AGATGGCCAGAGGCAGAGCCAGG - Intronic
915612223 1:157003599-157003621 GGTTGGTGAGAGCCAGAGCTAGG + Intronic
915897867 1:159825387-159825409 GAAAGGAGAGAGCCAGAGGTTGG - Intergenic
915949056 1:160175754-160175776 GAATGGAAACAGCCAGGGCTTGG - Intronic
916839334 1:168583877-168583899 GGCTGTAGAGAGCCAGGGCTTGG + Intergenic
917966432 1:180182114-180182136 GGGTGGAGGGAGCCAGGGCTGGG - Intronic
918129062 1:181608997-181609019 AGATGGCCACACCCAGAGCTGGG + Intronic
919428306 1:197461421-197461443 GGATGGAAAGAGCCTGGGGTGGG + Intronic
919859093 1:201726916-201726938 AGATGGGCAGAGCCATAGCATGG + Intronic
919883556 1:201916664-201916686 GGATGGATGGGGCCAGAGGTGGG + Intronic
920345095 1:205301372-205301394 GTGGGGCCAGAGCCAGAGCTGGG + Intergenic
921796684 1:219352773-219352795 GGATGAACAGAGCCTAAGCTGGG - Intergenic
922505615 1:226123829-226123851 GGATGGCCACAGCCACAGCCGGG + Intergenic
923536670 1:234857893-234857915 GGTTGGAGAGGACCAGAGCTTGG + Intergenic
923543343 1:234905857-234905879 GGATGCACTAAGCCAGAGCCGGG - Intergenic
1063676625 10:8146193-8146215 GAAAGGACACAGCCAGAGCCAGG + Intergenic
1063876393 10:10483962-10483984 GGAGGGACAGAGAGAGAGATGGG - Intergenic
1064323001 10:14323158-14323180 GGATGGAGAAAGACAGAACTGGG + Intronic
1064346907 10:14540733-14540755 GGAATTTCAGAGCCAGAGCTTGG - Intronic
1065155215 10:22862683-22862705 GGATGGCCGCAGCCAGGGCTTGG - Intergenic
1066409155 10:35149308-35149330 AGAGGCACAGAGCCAGAGCATGG + Intronic
1067082897 10:43221605-43221627 GGATGGACAGGGCCTGACCCAGG + Intronic
1067105614 10:43364076-43364098 GCTTGGACAGATCCAGAGATTGG + Intergenic
1069045948 10:63743103-63743125 AGAGGGACAGAGCTTGAGCTGGG + Intergenic
1069543907 10:69315811-69315833 GGATGGACAGAGCACTGGCTGGG + Intronic
1069941842 10:71962045-71962067 AGATGGGTAGAGCCAGAGCAGGG + Intergenic
1070118804 10:73555542-73555564 CAATGGACAGAGACAGAGATGGG + Intronic
1070665788 10:78342464-78342486 GGGTGGGCAGAGACAGGGCTGGG + Intergenic
1070680601 10:78446373-78446395 GGATGGGCAGAGCCAGGGCATGG + Intergenic
1071358887 10:84825579-84825601 TGATGGTCAGAAACAGAGCTTGG + Intergenic
1072729284 10:97834317-97834339 GGTTGAACATAGCCAGAGATTGG - Intergenic
1075653747 10:124147504-124147526 GGCTGGAGAGCTCCAGAGCTTGG - Intergenic
1075914906 10:126158566-126158588 GGATGCACAGAGCCGGGGGTGGG + Intronic
1077094609 11:793996-794018 GTCTGGACTGGGCCAGAGCTCGG + Intronic
1077099709 11:816710-816732 GGATGGACTGAGTCTGGGCTGGG - Intergenic
1077143856 11:1036248-1036270 GGAGGGAGAGCGCCAGGGCTGGG + Intronic
1077600875 11:3573638-3573660 CGAGGGACAAAGCCAGAGCAGGG + Intergenic
1077921885 11:6647450-6647472 GGAGGGACAGAGCCAGGCCCGGG - Intronic
1078159198 11:8826230-8826252 GGATGGTCAGAGCCCCAGCTGGG - Intronic
1078277680 11:9865783-9865805 GGAGTGACAGAGCCAGAGATGGG + Intronic
1081348501 11:42019880-42019902 GGTTGGACAGAGGGAGAACTTGG + Intergenic
1081499230 11:43649535-43649557 GGAAGGACACAGCCATGGCTGGG + Intronic
1083150186 11:60787044-60787066 GGGAGGACAGGGACAGAGCTGGG - Intronic
1083618541 11:64037788-64037810 GGATGCACAGACCCAGGTCTAGG - Intronic
1084041878 11:66547200-66547222 TGATGGGCAGAGCCTGGGCTGGG - Intronic
1084095441 11:66908157-66908179 GGAGGGCCAGGGCCAGGGCTGGG + Intronic
1084550124 11:69836126-69836148 GGGTAGACAGAGACAGAGATTGG - Intergenic
1084793015 11:71486703-71486725 GGATGGACAAAGGGAGAGATGGG - Intronic
1084794438 11:71495815-71495837 GTATGGCCAGAGCCACCGCTGGG - Intronic
1085319355 11:75564616-75564638 GCAGGGAAGGAGCCAGAGCTGGG + Intronic
1085325250 11:75601739-75601761 GGCTGGAGAGTGACAGAGCTCGG - Intronic
1085326010 11:75607015-75607037 GGATGGACAGAGCTGATGCTGGG + Intronic
1085339037 11:75719415-75719437 GGAGGGACAGGGCCAGCTCTGGG + Intronic
1085448609 11:76617311-76617333 GGAAGGACAGAGCCTGGACTTGG + Intergenic
1085454454 11:76657767-76657789 CAATGGGCAGAGCCAGGGCTAGG - Exonic
1085629061 11:78097861-78097883 GGAGGCATAGAGCCAGAACTGGG - Intergenic
1086420686 11:86634253-86634275 GGTTGTATGGAGCCAGAGCTTGG + Intronic
1089345974 11:117792134-117792156 GGATGGACAGAGGTAGAGAGGGG - Intronic
1089394202 11:118124957-118124979 GAATGGAAGGGGCCAGAGCTGGG - Intergenic
1089643105 11:119860522-119860544 GGAAAGACAGAGACAGAGATGGG - Intergenic
1089681604 11:120121857-120121879 GGAGGGACAGGGCCAGGGCGAGG + Intronic
1090182915 11:124716635-124716657 GGCTTGACAGAGGCAGAGGTGGG + Intergenic
1091220437 11:133927251-133927273 GGATTGGCACAGCCAAAGCTGGG - Intronic
1091387688 12:105145-105167 GGAGGCAGAGACCCAGAGCTTGG - Intronic
1091750467 12:3018821-3018843 GTATAGGCAGGGCCAGAGCTGGG + Intronic
1091864312 12:3818025-3818047 GGTTGGATTGATCCAGAGCTGGG - Intronic
1092427029 12:8382997-8383019 CGAGGGACAAAGCCAGAGCAGGG + Intergenic
1095507484 12:42912664-42912686 GAATGGATAGGGCCAGAGCTGGG + Intergenic
1095825228 12:46524185-46524207 GCATAGACAGAGGCAGAGATGGG - Intergenic
1096465171 12:51844536-51844558 GGATGAAAGGAGTCAGAGCTGGG - Intergenic
1096500889 12:52063281-52063303 GGCTGGACAGTGCCAGCGCCTGG - Intergenic
1096515615 12:52153583-52153605 GTATGGCCACAGCCAGACCTGGG - Intergenic
1096559535 12:52425627-52425649 GGATGGCCACCGCCAGAGCTAGG + Intronic
1096793746 12:54061137-54061159 CGATGGGCAGGGACAGAGCTGGG + Intergenic
1098219235 12:68251241-68251263 GGATGGTCAGTGGCAGAGATAGG - Intronic
1098232044 12:68381326-68381348 GGATGAAGAGAGCCAGAAATGGG + Intergenic
1099338422 12:81395517-81395539 GGAAGGTCAGAGACAGATCTTGG - Intronic
1102545400 12:113651140-113651162 TGATTGGCAGAGCCAGAGGTAGG - Intergenic
1102645030 12:114398205-114398227 GGAACGACAGACCCAGATCTGGG + Intronic
1102780011 12:115556178-115556200 GTAAAGACAGAGGCAGAGCTTGG - Intergenic
1103926609 12:124426888-124426910 GGATGGTCTGCGCCAGAGCAGGG + Intronic
1104976777 12:132555704-132555726 GGACGGACAGGGGCAGAGATAGG - Intronic
1105431210 13:20339437-20339459 GGAGGGGCAGTGCCAGAGCAGGG + Intergenic
1105929778 13:25041601-25041623 GGGTAGACACAACCAGAGCTAGG + Intergenic
1106240533 13:27908788-27908810 GGATGGAGAGAGCAAGAGAAAGG + Intergenic
1106333874 13:28765095-28765117 GGATGGTCAGATCCAGACTTAGG + Intergenic
1108283962 13:48887283-48887305 GAAGGGACATAGCCAGAGCAGGG + Intergenic
1108642530 13:52395951-52395973 GGCTGGATACAGGCAGAGCTGGG + Intronic
1111083233 13:83339997-83340019 GTAAGGACAGAGGCAGAGTTTGG + Intergenic
1111201664 13:84945775-84945797 AGCTGGACAGAGGCAGAGCTGGG + Intergenic
1112501905 13:99949532-99949554 GGAAGGGCAGAGCTAGGGCTGGG + Intergenic
1112781038 13:102901842-102901864 AGATGGGCAGAGGCAGAACTGGG + Intergenic
1112870783 13:103968358-103968380 GGATGGTGAAAGCCAAAGCTCGG + Intergenic
1113014705 13:105815673-105815695 GAGTGGAGAGGGCCAGAGCTGGG + Intergenic
1113627376 13:111856929-111856951 GGATGCACAGGGCCACAGCCAGG + Intergenic
1113888315 13:113723117-113723139 GGACGGACAGAGCAAGACCAAGG + Exonic
1115395671 14:32905984-32906006 GGAAGGTCAGAGCAAGAGCAGGG - Intergenic
1116740957 14:48753790-48753812 ATATGGACTGAGACAGAGCTTGG + Intergenic
1117900813 14:60530879-60530901 GGCTGGGCAGAGACTGAGCTTGG + Intergenic
1118001420 14:61526971-61526993 GACTGGACAGAGCAACAGCTTGG - Intronic
1118712997 14:68538086-68538108 GACTGGAAAGAGCCAGAGTTAGG - Intronic
1121480726 14:94269710-94269732 GAAAGGTCAGAGTCAGAGCTTGG + Intronic
1122088457 14:99322716-99322738 GGCTGGACAGAGCCAGGGGCTGG - Intergenic
1122859902 14:104577837-104577859 GGCTGAACAGTGACAGAGCTGGG + Intronic
1124208156 15:27740805-27740827 GTAGGGACAGAGACAGAGCAGGG - Intergenic
1125602426 15:40923015-40923037 GGAAGGCCAGAGCCAGAGGAGGG + Intergenic
1125681100 15:41530694-41530716 GGATGGACAGAGCCAGAGCTGGG + Intronic
1128331846 15:66761204-66761226 GGAGGGACAGGGACAGTGCTAGG - Intronic
1128811299 15:70574770-70574792 GGTTGGAAAGTGGCAGAGCTGGG + Intergenic
1129185039 15:73900828-73900850 GAATGCTCAGAGTCAGAGCTGGG - Intergenic
1129188937 15:73926655-73926677 GCATGGACAAAGCTAGAGCTGGG + Exonic
1129446969 15:75625532-75625554 GGAGGGATAGAGCCAGGCCTGGG - Exonic
1129775502 15:78233790-78233812 GGATGGACAGGGCCTGGGCCAGG + Intronic
1130545616 15:84856123-84856145 AGGTGGAAAGGGCCAGAGCTGGG + Intronic
1131398807 15:92108323-92108345 GGAGGAGCAGAGCCAGAGCCAGG - Intronic
1132378547 15:101349070-101349092 GGAAGGACAGAACCAAAGCTGGG + Intronic
1132396767 15:101480324-101480346 GGCTGGGCAGAGCCACAGGTCGG + Intronic
1132944161 16:2523350-2523372 GTGTGGGCAGAGCCAGAGCTGGG + Intronic
1133229118 16:4358172-4358194 GGAGGGACAGGGCAAGACCTGGG + Intronic
1133371227 16:5247368-5247390 GGAGGGACAAAGCCAGGGCAGGG - Intergenic
1133738724 16:8635228-8635250 GGATGTACAGCGCTGGAGCTCGG + Exonic
1134135153 16:11672711-11672733 GCATGGGCAGAGCCAGATGTGGG - Intronic
1135964905 16:27027778-27027800 GGATGGATATAGCCAGAACTTGG - Intergenic
1136451593 16:30357024-30357046 GGAGGGACAGAGCCAGGACCTGG - Intergenic
1137935708 16:52633472-52633494 GGATGGTCAGAGCAAGGCCTGGG - Intergenic
1138239122 16:55412242-55412264 GGAAAGACAGAGGCAGAGGTTGG + Intronic
1138552803 16:57756616-57756638 GGGTGGGCTTAGCCAGAGCTGGG + Intronic
1138659168 16:58507772-58507794 GGAGGGGCAGAGGCAGAGGTGGG - Intronic
1139264143 16:65623578-65623600 GGAGGGAGAGGGCTAGAGCTCGG - Intergenic
1139380862 16:66529806-66529828 GGATGGACAGAGGGACAGCAGGG - Intronic
1139391080 16:66606353-66606375 GGAAGGGGAGGGCCAGAGCTGGG + Intronic
1139437191 16:66943108-66943130 GGATGGAGTCAGCCAGAGCCTGG + Intronic
1139952570 16:70679388-70679410 GGATGGACAGAGCCACTCCTGGG + Intronic
1140776267 16:78251153-78251175 AGATGGGAAGAGCCAGAACTAGG - Intronic
1141838686 16:86560038-86560060 GGATGCACACAGGCAGAGGTGGG + Intergenic
1142196624 16:88742117-88742139 GGCTGGGCAGAGCCTGACCTGGG - Intronic
1142782970 17:2195807-2195829 GGCTAGAAAGTGCCAGAGCTGGG + Intronic
1143150374 17:4804101-4804123 GGGTGGCCAGAGCCAAGGCTGGG + Intergenic
1143180613 17:4981933-4981955 GGATGGAGAGAGTCAGAAATTGG - Intronic
1143213001 17:5203385-5203407 GGATGGCCTGAGTCACAGCTGGG - Intergenic
1144121441 17:12157771-12157793 GCATGGCCAGAGCAAGAGCAAGG - Intergenic
1144306082 17:13970725-13970747 CGATGGACAGCGCCAAAGCACGG + Intergenic
1144763499 17:17720748-17720770 GGATGGTCAGATCCTGACCTTGG + Intronic
1145255469 17:21319859-21319881 GGCTGGGCAGAGCCTCAGCTGGG - Intergenic
1145321143 17:21768093-21768115 GGCTGGGCAGAGCCTCAGCTGGG + Intergenic
1145398351 17:22512869-22512891 GGAGTTACAGATCCAGAGCTTGG + Intergenic
1146322857 17:31859807-31859829 GGATAGGCAGGGCCTGAGCTGGG + Intergenic
1147559763 17:41501616-41501638 GGAGGGAGGGAGCCAGTGCTGGG - Intronic
1147685923 17:42286948-42286970 GGAGGGTCAGACACAGAGCTAGG - Intergenic
1147980022 17:44268461-44268483 GGATGGACAGAGGCAGGACAGGG - Intergenic
1148051455 17:44771964-44771986 GGAGGGAGGGAACCAGAGCTGGG - Intronic
1148629013 17:49092372-49092394 GGAAGGACAAAGCCAGTGATTGG - Intergenic
1148787655 17:50153138-50153160 GGGTGGAGCTAGCCAGAGCTTGG + Intergenic
1149010164 17:51848006-51848028 GGCTTTACAGAGCCAGGGCTAGG + Intronic
1149660151 17:58330615-58330637 GGCAGGATAGGGCCAGAGCTAGG + Intergenic
1150658361 17:67055403-67055425 GGTTGGAGGGAGACAGAGCTTGG + Intronic
1151116480 17:71740984-71741006 CTATGGGCAGAGGCAGAGCTGGG - Intergenic
1151363092 17:73600315-73600337 GGATCAAGAGAGCCAGAGCTTGG - Intronic
1151383260 17:73739970-73739992 GGAAGGACAGAGCCAGGGTCAGG - Intergenic
1151387232 17:73762484-73762506 GCAAGGACAGAGCCAGAGACTGG + Intergenic
1151471089 17:74318230-74318252 GGATGGCAAGCGCCTGAGCTGGG - Intergenic
1151708916 17:75788706-75788728 GGTTGGACAGAGCAAGAGACAGG + Intronic
1151897046 17:76987460-76987482 AGATGGAGGGAGCCAGGGCTGGG + Intergenic
1152225242 17:79089888-79089910 GGACGGGCACAGCCAGAGCAGGG - Intronic
1152452035 17:80387633-80387655 GGATGAAGAGAGCCAGATGTGGG - Intronic
1152661727 17:81545521-81545543 GGATGGACAGGGCCAGTCCTCGG + Intronic
1152676104 17:81642148-81642170 GGACCCACAGAGCCAGGGCTGGG + Intronic
1152726937 17:81952210-81952232 GGATGCACAGACTCAGAGCAGGG - Intergenic
1153341456 18:3978845-3978867 TGATGGACAGAGGCAGAGGAGGG + Intronic
1153748608 18:8206912-8206934 GGGAGGACAGAGGCAGAGATTGG + Intronic
1153749031 18:8210386-8210408 GGGAGGACAGAGGCAGAGATTGG + Intronic
1154415682 18:14174158-14174180 GCAGGGCCAGAGCCAAAGCTGGG + Intergenic
1155622390 18:27794674-27794696 TGTGGGACAGAGCCAGAACTTGG - Intergenic
1157686086 18:49643967-49643989 GAATGGTCATTGCCAGAGCTGGG - Intergenic
1158393110 18:57059543-57059565 GGAGGGACAGAGACAGAGCTGGG + Intergenic
1159655616 18:71028182-71028204 TAATGGACAAAGCCAGGGCTTGG + Intergenic
1160083240 18:75751135-75751157 GGAGTGACAGAGGCAGAGATGGG - Intergenic
1162048723 19:8018978-8019000 GGATGGTCAGAATCAGAGATTGG + Intronic
1162097677 19:8320812-8320834 GAAAGGACAGAGCCAGAGGCTGG + Intronic
1162550942 19:11357775-11357797 GGTTGGACAGAGACAGAGATAGG - Intronic
1162730490 19:12715594-12715616 GGATGGCCAGAGCGAGTACTGGG - Intronic
1163039934 19:14594593-14594615 GGTTGGTCAGGGCCAGAGCAGGG - Intronic
1163762159 19:19143387-19143409 GGAGGAAGAGAGGCAGAGCTGGG + Intergenic
1164463030 19:28464581-28464603 GGATGGGGAGGGCCAGGGCTGGG + Intergenic
1164618379 19:29679956-29679978 GGATAGACAAAGCCAGAGAAAGG + Intergenic
1164882606 19:31746659-31746681 GAATGCATAGAACCAGAGCTGGG + Intergenic
1165064515 19:33221211-33221233 GGATGGAGAGAGCCAGGGTCGGG - Intronic
1165313984 19:35043795-35043817 GGAAGGACAGCCCCAGGGCTTGG + Intronic
1165326766 19:35118629-35118651 GGCTAGGCAGAGCCAGGGCTGGG + Intronic
1165487597 19:36104887-36104909 GGCTGGGCAGAGCCTGGGCTGGG - Exonic
1166001183 19:39878283-39878305 GGAGGCAGAGGGCCAGAGCTGGG - Intronic
1166003965 19:39894542-39894564 GGAGGCAGAGGGCCAGAGCTGGG - Intronic
1166317556 19:41997598-41997620 GGATGGCGAGAGACAGAGATGGG - Intergenic
1166662675 19:44657497-44657519 GGATGCACAGCGCCAGAGCAGGG + Intronic
1166704678 19:44902162-44902184 GGATGGACAAAGCTCCAGCTTGG - Intronic
1166705954 19:44908173-44908195 GGAAGGACAGAGACAGAGCCAGG - Intronic
1166776379 19:45315408-45315430 GGAGGAACAGAGCCAGGGCTGGG + Intronic
1167022795 19:46891075-46891097 AGATGGAAAGTGGCAGAGCTGGG - Intergenic
1167075122 19:47243876-47243898 GGAGCGACAGAGACAGAGATGGG - Intergenic
1167220858 19:48197128-48197150 GGAAGGAAAGGGGCAGAGCTGGG + Intronic
1167445551 19:49535075-49535097 GGAGGGGCAGAGTCAGTGCTGGG - Intronic
1168271590 19:55252926-55252948 GCAGGGACAGAGCCAGGGCCAGG + Intronic
925148472 2:1598995-1599017 GGAGGGACACAGCCAGCCCTGGG - Intergenic
925331851 2:3064515-3064537 GGATGGAAAGAGACTGAGTTTGG + Intergenic
925521667 2:4753365-4753387 GGGTGGACAGAGCCTCACCTGGG + Intergenic
926738639 2:16093386-16093408 GGAGAGACAGAGCAAGACCTCGG + Intergenic
926751768 2:16203940-16203962 GGATGGCCAGAGGCAGGGCTGGG - Intergenic
927213286 2:20651489-20651511 GCCTGGACAGAGCCCCAGCTTGG - Intergenic
927319579 2:21727224-21727246 GGATGATCAGCGTCAGAGCTTGG + Intergenic
927864237 2:26578550-26578572 GGATGGTTGGAGGCAGAGCTTGG + Intronic
927887125 2:26725437-26725459 GCATGGACATAGCCCCAGCTTGG - Intronic
928951543 2:36817626-36817648 GGAGGGACAGAACCAGAATTTGG + Intergenic
931997973 2:67857258-67857280 GGATGGTCGAAGCCAGGGCTGGG - Intergenic
932103689 2:68923986-68924008 GGATGGTCAGTGGCAGACCTAGG + Intergenic
932409108 2:71534808-71534830 GGAAGGTCAGACCCAGAGCTGGG - Intronic
932493532 2:72135611-72135633 GGCTGGGCAGGGCCAGAGCAGGG + Intronic
932846570 2:75141604-75141626 GGGTGGACAAAGGCATAGCTTGG - Intronic
934238978 2:90251770-90251792 GCAGGGACAGGGCCACAGCTGGG - Intergenic
935294963 2:101640811-101640833 GTATGGTCTGAGCCAGAGCAGGG + Intergenic
935302821 2:101708081-101708103 GGATGGTCAGAGGCCGAGGTAGG - Intronic
936286362 2:111184445-111184467 GAATGGAGATAGCCAGAGGTGGG - Intergenic
936399294 2:112153680-112153702 GGGTGGACACAGCCAAAGATGGG - Intronic
937074430 2:119090724-119090746 GGATGTACAGAGAGAAAGCTGGG - Intergenic
937101261 2:119272127-119272149 GGATTGACAAAGCCAAAGGTTGG + Intergenic
937281878 2:120722959-120722981 AGAGGGACAGAGGCAGTGCTGGG - Intergenic
937350124 2:121155375-121155397 ACAGAGACAGAGCCAGAGCTTGG + Intergenic
937359190 2:121217406-121217428 GGATGGCCACAGCCGGACCTCGG + Exonic
937373162 2:121316703-121316725 GGATTGACATAGCCAGAACTCGG + Intergenic
939056752 2:137374161-137374183 GGAGGGAGAGAGAGAGAGCTGGG + Intronic
940483240 2:154263206-154263228 AGATGGTAAGTGCCAGAGCTGGG - Intronic
941000976 2:160203654-160203676 GGATTGGCATATCCAGAGCTGGG - Intronic
942263102 2:174191476-174191498 TGAGCGACAGAGCCAGAGCCAGG - Intronic
943767195 2:191676045-191676067 GGAAGGGCTGAGCCACAGCTTGG + Intergenic
944414494 2:199468789-199468811 AGATTGCCAGGGCCAGAGCTTGG - Intronic
944932323 2:204532414-204532436 TGATGGACGGAGCCAAATCTAGG + Intergenic
945420693 2:209632597-209632619 GGATGGGCATGGCCAGAGCATGG - Intronic
945591051 2:211732125-211732147 GGAAAGGCAGAGTCAGAGCTGGG + Intronic
945924234 2:215787624-215787646 GGATGGACAGGTCAAGATCTTGG - Intergenic
946548661 2:220776132-220776154 GGCTGGACAAAGCCAGAGAGGGG - Intergenic
948551472 2:238775627-238775649 GGATGGAGTGAGCGGGAGCTGGG + Intergenic
948595570 2:239077214-239077236 GCATCCACAGAGCCAGACCTTGG - Intronic
948769159 2:240239325-240239347 GGATGGACAGATAGAGAGATGGG + Intergenic
948861004 2:240752555-240752577 GGGTGGGGAGAGCCAGAACTTGG + Intronic
1169724336 20:8713136-8713158 AGATGGACAGAACAAGAGGTAGG - Intronic
1169910568 20:10644631-10644653 TGCTGGTCAGACCCAGAGCTGGG + Intronic
1170155406 20:13264626-13264648 GGATGGCCATAGCCACATCTAGG - Intronic
1170556445 20:17518799-17518821 GGATGAACTGATTCAGAGCTGGG - Intronic
1171043741 20:21790994-21791016 GGATGGACAGACAGATAGCTTGG - Intergenic
1172201131 20:33126700-33126722 GGATGGTCACAGTCACAGCTCGG + Intergenic
1172701155 20:36854493-36854515 GGATGGGAAGAGCAAGAGCACGG + Intronic
1173762785 20:45578814-45578836 GGAGGGGCAGAGCCTGAGCAAGG - Intronic
1174284529 20:49463190-49463212 GGGAGGAAAGAGACAGAGCTTGG - Intronic
1174674496 20:52340445-52340467 GATTGGAGAGAGGCAGAGCTTGG - Intergenic
1174911624 20:54614326-54614348 GGATGGAGAGAGACAGAGGGAGG + Intronic
1175183826 20:57166608-57166630 GGGTAGACAGAGGCAGAGATTGG + Intergenic
1175342624 20:58243576-58243598 TGATTGTCAGAGGCAGAGCTGGG + Intergenic
1175569651 20:60009190-60009212 CGAGGGACAGAGCCAGAAATGGG + Intronic
1176857653 21:13985146-13985168 GCAGGGCCAGAGCCAAAGCTGGG - Intergenic
1176866953 21:14059081-14059103 GCAGGGCCAGAGCCAAAGCTGGG + Intergenic
1178785373 21:35648576-35648598 GCATGGCCTGAGGCAGAGCTGGG + Intronic
1178882967 21:36463174-36463196 GGATGGGCGCAGCCAGGGCTGGG - Intronic
1179407847 21:41140132-41140154 GGAGGGACAGGGGCAGAGCGAGG + Intergenic
1179678701 21:43002521-43002543 CGATGGCCAGAGGCTGAGCTGGG - Intronic
1179783342 21:43716518-43716540 GGTTGGAGAGACCCAGAGCTGGG - Intergenic
1181067268 22:20312792-20312814 GGCAGGACAGGGTCAGAGCTGGG + Intergenic
1181646165 22:24232732-24232754 AGAGGGACTGAGGCAGAGCTGGG + Intronic
1182077205 22:27503040-27503062 TGATGGCCAGAGCCAGCTCTTGG - Intergenic
1182301379 22:29339142-29339164 GGAGGGAAAGAGTCAGAGGTGGG + Intronic
1183430855 22:37764908-37764930 GGCTGCCCAGAGACAGAGCTAGG + Intronic
1183718924 22:39550908-39550930 GCATGGAGAGAGCCAGAGAAAGG + Intergenic
1183748509 22:39705864-39705886 GGATGGACTGGGTCAGAGCAAGG - Intergenic
1184253318 22:43273205-43273227 AGATGGAGACAGACAGAGCTGGG + Intronic
1184419544 22:44371683-44371705 CCACGGCCAGAGCCAGAGCTGGG - Intergenic
1184599252 22:45532879-45532901 GGGTGTCCAGAGCCAGAGCCTGG + Intronic
1184898124 22:47424202-47424224 GGAGGGACAGAGGGGGAGCTGGG + Intergenic
1185040332 22:48500787-48500809 GGATGCACACAGACAGGGCTGGG + Intronic
1185061966 22:48611819-48611841 GGATGGGCAGAGGCAGTGCCTGG + Intronic
1185104232 22:48858178-48858200 GGATGGACAGAGAGAGAGCATGG - Intergenic
949889960 3:8726396-8726418 GGATGGACAGCCCTAGAGATGGG + Intronic
952467560 3:33605985-33606007 AGAGGGACAGGGCCAGTGCTAGG + Intronic
952968581 3:38636686-38636708 GGAAGGGCAGGGCCAGAGCCAGG - Intronic
953457615 3:43055398-43055420 GGGTGGACAGAGACAGAGGTGGG - Intronic
953551514 3:43907151-43907173 AGATGCCCAGATCCAGAGCTGGG + Intergenic
953700254 3:45190231-45190253 GGATGGGAAAAGTCAGAGCTTGG - Intergenic
954301444 3:49702784-49702806 GGCTGGACAGAGCCAGGCGTAGG + Intronic
954416601 3:50396276-50396298 GGCAGGACAGAGCCTGAGCTGGG - Intronic
954689678 3:52388948-52388970 GGCTGGTCAGAGACAGAGGTGGG - Intronic
954763624 3:52895741-52895763 CTATGGAAACAGCCAGAGCTAGG + Intronic
957071733 3:75572692-75572714 CGAGGGACAAAGCCAGAGCAGGG + Intergenic
959562909 3:107802830-107802852 GGATGTACAAGGCAAGAGCTTGG - Intronic
959996361 3:112684745-112684767 TGATGGGCAGAGCTAGAGCCTGG + Intergenic
960594134 3:119392580-119392602 GGCTGGGCAGAGCCACAGCAGGG + Intronic
960988477 3:123295590-123295612 GGCTTGACCTAGCCAGAGCTGGG - Intronic
961259547 3:125590123-125590145 GGAAGGAAAGACCCAGAACTGGG + Intronic
961282410 3:125774393-125774415 TGAGGGACAAAGCCAGAGCAGGG - Intergenic
961594291 3:128004923-128004945 GGATGGACAGAGATAGGCCTAGG + Intergenic
961635395 3:128329793-128329815 GGAGGGACATGGCCAGTGCTGGG + Intronic
962361035 3:134742982-134743004 GGAGGGACAGAGACAGAGCCTGG - Intronic
962844048 3:139260100-139260122 GGGAGGCCAGAGCCAGAGCCTGG + Intronic
962989597 3:140566174-140566196 GGATGGGCAGAGGCAGACATGGG + Exonic
963756882 3:149243659-149243681 GGATGAACACAGACAGAGGTGGG - Intergenic
964026185 3:152077831-152077853 GCATGGAGAGAGCCAGAACTTGG - Intergenic
966828821 3:183988512-183988534 GGGTGGGCAGGGCCTGAGCTAGG - Intronic
967835532 3:193959437-193959459 GTAAGGACAGAGACAGAGATCGG + Intergenic
967945581 3:194801438-194801460 TGATGGACAGACTCAGATCTGGG + Intergenic
967967544 3:194973955-194973977 GGATGGAGACAGGGAGAGCTGGG - Intergenic
968056215 3:195694005-195694027 GGAGGTACAGAGGCAGACCTTGG + Intergenic
968673363 4:1864132-1864154 GCTGGGACAGAGCCAGAACTTGG + Intergenic
968956616 4:3722721-3722743 GGGTGGGCAGAGCCAGGGGTGGG + Intergenic
969015324 4:4100003-4100025 CGAGGGACAAAGCCAGAGCAGGG + Intergenic
969509900 4:7611895-7611917 GGATCCACAGAGCCTGAGCCAGG - Intronic
969738635 4:9008350-9008372 CGAGGGACAAAGCCAGAGCAGGG - Intergenic
970485279 4:16518966-16518988 GGATGGTCGGAGACAGAGGTGGG - Intronic
975230558 4:71927885-71927907 GGAATTACAGAGCCAGAGTTAGG - Intergenic
975491971 4:74999101-74999123 GGATGTACTGAGGCAGAGTTTGG - Intronic
978367284 4:107995688-107995710 CAATGGTCAGAGGCAGAGCTGGG + Intronic
978711427 4:111787248-111787270 GGATACACAGACACAGAGCTGGG - Intergenic
979453659 4:120902285-120902307 GGAAGCACAGAGCCAGTGCCTGG + Intronic
981341602 4:143628018-143628040 GGTTCCAAAGAGCCAGAGCTTGG + Intronic
983310143 4:166049257-166049279 AAATGCACAGAGCCAGGGCTTGG - Intronic
983459173 4:168006012-168006034 GGCTAGACAGGGACAGAGCTGGG - Intergenic
983568188 4:169176283-169176305 GGATGGACAGTCCCAGAGCTTGG - Intronic
985472735 5:55585-55607 GGAGGGACAGGGTCAGAGCGTGG + Intergenic
985580853 5:694412-694434 GCAGGGACAGAGCCGGGGCTGGG - Intergenic
985676513 5:1234316-1234338 GGATGCCCTGGGCCAGAGCTGGG + Intronic
986196193 5:5538079-5538101 GTGTGGACAGAGACAGAGATTGG - Intergenic
987224015 5:15820882-15820904 ACAAGGACAGAGCCAGAGCAAGG - Intronic
988548141 5:32176438-32176460 GGGTGAACAGGGGCAGAGCTGGG - Intergenic
988638650 5:33016543-33016565 GTAGGGACAGATCCAGATCTAGG - Intergenic
988977457 5:36529103-36529125 GGCTGGCCTGAGGCAGAGCTGGG - Intergenic
989480574 5:41925599-41925621 GCATGGACGGAGCCAGACCCAGG - Intronic
989659516 5:43785130-43785152 GGAGTAGCAGAGCCAGAGCTAGG + Intergenic
990082202 5:51930750-51930772 GGTTGGTCAGTGCCAGGGCTGGG + Intergenic
990350115 5:54907870-54907892 GGAAGCACTCAGCCAGAGCTGGG + Intergenic
991502664 5:67292501-67292523 GGATGGTCACAGACAGAGCATGG + Intergenic
992477473 5:77117700-77117722 GGGTGGACAGAGCCAGAGGCAGG + Intergenic
992863659 5:80937117-80937139 GGCTGGACCCAGGCAGAGCTGGG - Intergenic
995803916 5:116029761-116029783 GGAAGGACAGAGGCAGATATAGG + Intronic
996597783 5:125225627-125225649 GGATGGCCAGAGCCAGGTCCTGG - Intergenic
996798360 5:127375639-127375661 GGAAGAACAGAGCTAGAGCAGGG - Intronic
997818435 5:137040092-137040114 TGCTGGACACAGCCAGAGCAGGG - Intronic
999109849 5:149109575-149109597 GGATGGTCAGTGCCAGTCCTGGG - Intergenic
999637224 5:153635463-153635485 GGCTGCACAAAGGCAGAGCTAGG + Intronic
1000633512 5:163617457-163617479 GGATGTAGAGATCAAGAGCTTGG - Intergenic
1001476609 5:172055075-172055097 GTGTGGACAGAGGTAGAGCTTGG - Intronic
1001945310 5:175773271-175773293 GGCAGGGCAGAGGCAGAGCTGGG + Intergenic
1002079187 5:176727562-176727584 GCATGGAGAGGGCCACAGCTGGG - Intergenic
1002565159 5:180108819-180108841 GGATGTACTGAGCCCCAGCTGGG - Intronic
1003123806 6:3339371-3339393 GGAGGGACAGGACCAGGGCTTGG - Intronic
1004471064 6:15929497-15929519 ACATGGAAAGAGCCTGAGCTTGG - Intergenic
1004775134 6:18835734-18835756 GGAGTGACAGAGCCAGTGCCAGG + Intergenic
1007106177 6:39284719-39284741 GGATGGGCAGAGCATGAGCTGGG - Intergenic
1007454251 6:41963952-41963974 TGATGGACAGTGCTAGAGGTGGG - Intronic
1007556105 6:42767857-42767879 GGAAGAACACAGGCAGAGCTGGG + Intronic
1011022030 6:82825203-82825225 GGGGTGTCAGAGCCAGAGCTGGG + Intergenic
1013046680 6:106492565-106492587 GGAAGGACCGACCCAGAGCTAGG + Intergenic
1013836886 6:114343518-114343540 GGATGCCTAGACCCAGAGCTTGG + Intergenic
1014597291 6:123360617-123360639 GGAAGGCCAGAGGCAGTGCTAGG + Intronic
1017565072 6:155675034-155675056 GGATGCACAGAGCATGGGCTAGG + Intergenic
1018429646 6:163713215-163713237 GGAAGCCCTGAGCCAGAGCTGGG - Intergenic
1018457300 6:163963574-163963596 GAAGAGACAGAGCCCGAGCTGGG - Intergenic
1019154191 6:170027965-170027987 AGATGGACAGAGACACAGATGGG + Intergenic
1019154214 6:170028376-170028398 GGATGGAGAGAGATAGAGATGGG + Intergenic
1019510891 7:1416782-1416804 GGAGGGACAGATCCGGAGGTGGG - Intergenic
1019574335 7:1729163-1729185 GGATTCTTAGAGCCAGAGCTTGG + Intronic
1020096138 7:5370669-5370691 GGAGGGACAGTGCCCGAGCCTGG - Exonic
1020279967 7:6645138-6645160 GAAGGAGCAGAGCCAGAGCTGGG - Intronic
1023734789 7:43225127-43225149 AGATGGACTGAGCCAGATCGAGG + Intronic
1023864723 7:44233290-44233312 GGATGGACAGGGTCCGAGATGGG + Intronic
1023953075 7:44863216-44863238 GGATGGATAGAGACAGAGTTAGG + Intergenic
1024536245 7:50436957-50436979 GGATGGACTGAGACATACCTTGG - Intergenic
1024542106 7:50484229-50484251 GGATCGACAAAGCCAGATGTTGG - Intronic
1025969818 7:66311909-66311931 GGAATGACAGTGCCAAAGCTGGG - Intronic
1025998682 7:66544530-66544552 GGATGGACAGACCAACAACTGGG + Intergenic
1026019399 7:66696007-66696029 GGCTGGGGAGAGACAGAGCTGGG + Intronic
1026512289 7:71037545-71037567 GGCTGGCCAAGGCCAGAGCTTGG + Intergenic
1026827514 7:73593747-73593769 GGAAGGGCAGAGCCAGGGCCTGG + Exonic
1026929405 7:74215516-74215538 TGATGGGCAGAGCCAGGGTTAGG + Intronic
1028853141 7:95559088-95559110 GGCTAGGCAGAGCTAGAGCTGGG - Intergenic
1028941228 7:96524095-96524117 AGATTGACAGAGACAGAGCATGG - Intronic
1029073991 7:97921663-97921685 CGAGGGACAAAGCCAGAGCAGGG + Intergenic
1029104029 7:98159742-98159764 GCACAGCCAGAGCCAGAGCTTGG + Intronic
1029199765 7:98831013-98831035 TAATTGACAGAACCAGAGCTAGG - Intergenic
1030304513 7:108004380-108004402 CAATGGACAGAGTCAAAGCTTGG + Intergenic
1032021350 7:128408694-128408716 GGCTTGACAGAGGCAGTGCTTGG - Intronic
1033284950 7:140033459-140033481 GGCTTGCCAGAGCCAGTGCTGGG - Intronic
1033442868 7:141396038-141396060 GCATGGCCAGATGCAGAGCTGGG - Intronic
1033654091 7:143361943-143361965 GGAGGGACAGGGCCAGGGCCGGG - Intronic
1034554207 7:151839712-151839734 CTATGGACAGAGCTAGAGCCTGG - Intronic
1034560406 7:151876347-151876369 AGAGGGACAGGGCCCGAGCTGGG - Intronic
1035366823 7:158353907-158353929 GGATGGCCAGAGACAAAGGTGGG + Intronic
1036095023 8:5714222-5714244 GGATAGACAGAGCCAGAAGCTGG + Intergenic
1036243714 8:7099632-7099654 CGAGGGACAAAGCCAGAGCAGGG - Intergenic
1036703557 8:11030135-11030157 GGGTGGACTGAGCCAAAGCAGGG - Intronic
1036890571 8:12593872-12593894 CGAGGGACAAAGCCAGAGCAGGG + Intergenic
1037494542 8:19425959-19425981 AGAGGGACAGAGGCAGGGCTGGG - Intronic
1038246465 8:25860970-25860992 GAGTGGACAGAGTCAGAGGTTGG - Intronic
1038478137 8:27883324-27883346 ACATGGTCAGTGCCAGAGCTGGG + Intronic
1038735857 8:30168812-30168834 GGCTGTTCAGAGACAGAGCTTGG + Intronic
1039082104 8:33743708-33743730 GGATGGAAAGAGCCCGGGATTGG - Intergenic
1039272098 8:35893599-35893621 GGAGGGAGAGAACCAGAGCTTGG - Intergenic
1042515924 8:69659029-69659051 GGCATGACAGAGCTAGAGCTCGG + Exonic
1042961610 8:74309470-74309492 GTGTGGACAGAAGCAGAGCTTGG - Intronic
1043400543 8:79880058-79880080 GGATGGACAGGACCAGATCATGG + Intergenic
1044742686 8:95343767-95343789 TGAATGACAGAGCCAGATCTGGG - Intergenic
1045404526 8:101852433-101852455 GGTTTTCCAGAGCCAGAGCTGGG - Intronic
1047062127 8:121239224-121239246 GGCATGACAGAGCCAGCGCTTGG + Intergenic
1048013101 8:130474352-130474374 GGATGCACAGAGCCAAATCCAGG - Intergenic
1048451368 8:134536608-134536630 GGAAGGACACAGGCAGAGGTAGG + Intronic
1049298079 8:141854530-141854552 GGGTGTACAGAGGCAGAGGTGGG + Intergenic
1049779748 8:144423489-144423511 GCAGGGACAGAGCCAGGGCCGGG + Intergenic
1049838414 8:144754968-144754990 GAACGGCCAGAGCCAGAGCCCGG + Intronic
1049849042 8:144821002-144821024 GGATAGGCAGAGCCAGAGAGTGG - Intergenic
1049974104 9:845583-845605 GGAAGAAGAGAGCCAGAACTGGG - Intronic
1050032492 9:1401157-1401179 GGATGGTTAGAGACAGAGCCAGG + Intergenic
1050947087 9:11538173-11538195 AGTTGGACAGAGACAGAGATTGG - Intergenic
1051539297 9:18196524-18196546 GGATGCAGAGAGCCTGAGCTTGG + Intergenic
1053008074 9:34617270-34617292 TCATGGGCACAGCCAGAGCTAGG - Intronic
1053141929 9:35688035-35688057 GGGGGGACAGGGACAGAGCTGGG - Intronic
1056570990 9:87814542-87814564 GGATGGGCAGAGGCAGAACCTGG + Intergenic
1056752839 9:89364370-89364392 GCATGGAGAGGCCCAGAGCTCGG + Intronic
1057229691 9:93312867-93312889 GAGTGGACAGAGCCAGAGGGTGG - Intronic
1057749905 9:97783979-97784001 GGATGGTCAGAGGCATAGCGGGG + Intergenic
1057866639 9:98686888-98686910 GGCTGGGGAGAGGCAGAGCTTGG - Intronic
1057937825 9:99255810-99255832 AGATGGTAAGAGGCAGAGCTGGG + Intergenic
1058846551 9:108966190-108966212 TGATGGAAAGAGCCTGAACTTGG - Intronic
1060236993 9:121871564-121871586 GGATGGGCAAAGCCAGAGGCAGG - Intronic
1060763578 9:126276190-126276212 GGATCCTCAGAGCCAGAGCCAGG - Intergenic
1060946794 9:127574453-127574475 AGACGGTCAGAGCCAGAGCTTGG + Intronic
1061291622 9:129653674-129653696 GGCTGGTGAGAGGCAGAGCTGGG + Intergenic
1061371782 9:130201523-130201545 GGATGAGCAGTGCCAGGGCTGGG + Intronic
1061834173 9:133318059-133318081 GGATGCAGAGGGGCAGAGCTGGG + Intergenic
1061894503 9:133640136-133640158 GGATGGCCAGAGGCAGTGGTGGG + Intronic
1062396054 9:136353335-136353357 GGAAGGAGGGAGCCAGGGCTTGG + Intronic
1062507951 9:136887402-136887424 GAACGGTCAGGGCCAGAGCTGGG + Intronic
1062672920 9:137722522-137722544 GGGTGGACTGAGCCAGGGCAGGG + Intronic
1187058007 X:15759213-15759235 AGAAGGACAGTGCCAAAGCTGGG + Intronic
1187422847 X:19151228-19151250 GGATGGCAAGAGCCTGAGCTGGG + Intergenic
1189853610 X:45200871-45200893 GGCTGTACAGAGGCAGGGCTTGG + Exonic
1190175564 X:48146326-48146348 TGAAGGACAGAGCCCGAGGTTGG - Intergenic
1190182852 X:48208218-48208240 TGAAGGACAGAGCCCGAGGTTGG - Intronic
1190192343 X:48287825-48287847 TGAAGGACAGAGCCCGAGGTTGG + Intergenic
1190668592 X:52718232-52718254 TGAAGGACAGAGCCCGAGGTTGG + Intergenic
1190670825 X:52740172-52740194 TGAAGGACAGAGCCCGAGGTTGG - Intergenic
1197599247 X:128508192-128508214 CGATGGATTGAGCCACAGCTGGG - Intergenic
1198051362 X:132956148-132956170 GGAAGACCAGAGCCAGAGCGGGG + Intronic
1198075095 X:133186326-133186348 GGATGGACAGGGCCAGGGAAAGG + Intergenic
1199694847 X:150336611-150336633 GAATGGACAGAGTCAGCACTTGG + Intergenic