ID: 1125682017

View in Genome Browser
Species Human (GRCh38)
Location 15:41536907-41536929
Sequence TGTGAGGCTGAGAAGTAGAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 470
Summary {0: 1, 1: 1, 2: 1, 3: 22, 4: 445}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125682017_1125682026 29 Left 1125682017 15:41536907-41536929 CCTCTCTACTTCTCAGCCTCACA 0: 1
1: 1
2: 1
3: 22
4: 445
Right 1125682026 15:41536959-41536981 ACATCCCGATGGTCCTGGAGCGG 0: 1
1: 0
2: 1
3: 7
4: 77
1125682017_1125682023 18 Left 1125682017 15:41536907-41536929 CCTCTCTACTTCTCAGCCTCACA 0: 1
1: 1
2: 1
3: 22
4: 445
Right 1125682023 15:41536948-41536970 CCAACATCACCACATCCCGATGG 0: 1
1: 0
2: 1
3: 8
4: 101
1125682017_1125682024 24 Left 1125682017 15:41536907-41536929 CCTCTCTACTTCTCAGCCTCACA 0: 1
1: 1
2: 1
3: 22
4: 445
Right 1125682024 15:41536954-41536976 TCACCACATCCCGATGGTCCTGG 0: 1
1: 0
2: 0
3: 8
4: 93

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125682017 Original CRISPR TGTGAGGCTGAGAAGTAGAG AGG (reversed) Intronic
900971348 1:5993762-5993784 AGTGAGGCTGAGCAGGAAAGTGG - Intronic
901190892 1:7409144-7409166 TGAGAGGCTGAGAAGAAAACTGG + Intronic
902555183 1:17242699-17242721 ACTGAGGCTTAGAAGGAGAGTGG + Intronic
903031608 1:20467723-20467745 TGAGAGGAAGAGAAGCAGAGAGG - Intergenic
903288478 1:22291963-22291985 GGTGAGGCTCAGAAGGAGACAGG + Intergenic
904172617 1:28602084-28602106 TGTGAGACTGTGAAGTGGGGGGG + Intronic
904754711 1:32761791-32761813 TGTGAGACTGATAAGAAGAGTGG + Intronic
907246026 1:53109734-53109756 TGAGAGGCTGTGAAGGAGATGGG - Intronic
907757449 1:57324712-57324734 TGAGAGGCTGAGAAAGAAAGCGG - Intronic
907862887 1:58371073-58371095 TGGAAGGCTCAGAAGAAGAGAGG + Intronic
908872031 1:68624442-68624464 TGTGAGTCAGAGAAGGAGACAGG - Intergenic
909717697 1:78728960-78728982 TGTGAGGCAGTGAATTAGAAAGG - Intergenic
909894975 1:81057440-81057462 TGTGATGCTGAGGATTACAGGGG + Intergenic
910113274 1:83704240-83704262 GGTGAGGCTGAAAAGTAATGCGG + Intergenic
910273344 1:85420724-85420746 TGGAAGGCTGAGAAGAAGACAGG - Intronic
910453356 1:87370293-87370315 TGAGAGGCTGTGTAGCAGAGTGG + Intergenic
911099635 1:94084854-94084876 GGTGGGGCTGAGAAGAAGAGTGG + Intronic
912853557 1:113147570-113147592 TGTGTGGCTGGGAGGTAGAATGG - Intergenic
912908147 1:113729256-113729278 TCTGAGGCTGAGAAGGGTAGTGG + Intronic
913666982 1:121057705-121057727 TTTGAGGCTGGGTAGGAGAGAGG + Intergenic
914018728 1:143845129-143845151 TTTGAGGCTGGGTAGGAGAGAGG + Intergenic
915283036 1:154835794-154835816 TTTGATGCTGGGAGGTAGAGAGG + Intronic
915317165 1:155035265-155035287 TGGGAGGCTGAGCAGGAGAATGG - Intronic
916043170 1:160978691-160978713 TGGGAGGCTGAGGAGGAGGGAGG + Intergenic
916226278 1:162492959-162492981 TGGGAAGTTGAGAAGTAGGGAGG - Intergenic
917467463 1:175293892-175293914 TGGGAGGCTGAGCAGGAGAATGG + Intergenic
917961518 1:180149304-180149326 TGGGAGGCTGAGATGGAGATGGG + Intergenic
919833066 1:201555661-201555683 AGTGAGGCTCAGAAGGAGGGAGG + Intergenic
919931934 1:202226688-202226710 GGTGAGGCTGAAGAGTAGTGTGG + Intronic
920369279 1:205467631-205467653 TGGGAGGCTGAGCAGGTGAGTGG - Intergenic
921736924 1:218639245-218639267 TCTGAGGCAGAGAAGTTTAGTGG + Intergenic
922514460 1:226196717-226196739 TGGGAGGCTGAGACGGAGAATGG - Intergenic
922549770 1:226485415-226485437 TGTGAGGCAGCCAAGTAGAAAGG + Intergenic
922831553 1:228556966-228556988 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922832031 1:228608948-228608970 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922832592 1:228611189-228611211 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922833152 1:228613430-228613452 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922833713 1:228615671-228615693 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922834272 1:228617912-228617934 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922834832 1:228620143-228620165 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922835381 1:228622346-228622368 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922835940 1:228624588-228624610 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922836499 1:228626828-228626850 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922837057 1:228629069-228629091 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922837616 1:228631311-228631333 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922838175 1:228633552-228633574 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922838734 1:228635777-228635799 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922839292 1:228638017-228638039 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922839853 1:228640248-228640270 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922840414 1:228642489-228642511 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
922840976 1:228644720-228644742 AGAGAGGCTGAGAAAGAGAGAGG + Intergenic
923128722 1:231056560-231056582 GGGAAGGGTGAGAAGTAGAGGGG - Intergenic
923619968 1:235570638-235570660 TGGGAGGCTGAGAGGGGGAGTGG - Intronic
923641101 1:235761794-235761816 TGGGAGGCTGTCAATTAGAGAGG + Intronic
924211265 1:241769752-241769774 TGTGAGGCTGACATGGTGAGGGG - Intronic
924538931 1:244962747-244962769 CTTGGGGCTGAGCAGTAGAGAGG + Intergenic
1063107122 10:3002168-3002190 TGAGAGACAGAGAAGGAGAGTGG + Intergenic
1063970812 10:11380120-11380142 TGTGTGGCTGAGCAGGAAAGAGG - Intergenic
1064974017 10:21094785-21094807 TGTGAGACTTAGAAGCAAAGAGG - Intronic
1066319629 10:34288876-34288898 TGTCAGGCTGAAAGGTAAAGTGG + Intronic
1066437757 10:35409554-35409576 TGAGAGGCTGAGGAACAGAGAGG + Intronic
1067145179 10:43689218-43689240 TGGGCGGCTGAGGAGTGGAGCGG + Intergenic
1067753129 10:48984952-48984974 GATGAGGCTGAGAGGTAGAGGGG + Intergenic
1068522515 10:58093497-58093519 TGTTAGGCAGAGAAGAAAAGGGG - Intergenic
1068603528 10:58980257-58980279 TGTGAGGGTGAAGAATAGAGAGG + Intergenic
1068904634 10:62309326-62309348 AGTAAGGCTGAAAAATAGAGAGG - Intergenic
1069262174 10:66412563-66412585 TGGGAGGCTGAGAAGGAGAATGG - Intronic
1070310920 10:75273252-75273274 TATGAAGTTGAGAAGTAGATGGG - Intergenic
1070705483 10:78634723-78634745 TGTGGAACTGAGAAATAGAGGGG - Intergenic
1070767191 10:79063526-79063548 TGTGAGGCTCAGAGGGTGAGAGG + Intergenic
1071355578 10:84790249-84790271 ATTGAGGCAGAGAAGTAGTGAGG + Intergenic
1071752705 10:88499198-88499220 TGTTGGGCAGAGCAGTAGAGTGG - Intronic
1074957886 10:118410398-118410420 TGTGAGGGTGAGAACTATACCGG + Intergenic
1075528196 10:123203389-123203411 TGTGAGGCTGACATGTGCAGGGG + Intergenic
1076162924 10:128259866-128259888 TGTGGGGCTGGGAGGTGGAGAGG - Intergenic
1077376019 11:2205442-2205464 TGGAAGGCTGGGAAGTAGGGAGG - Intergenic
1077376113 11:2205720-2205742 GGGGAGGCTGAGAGGTAGGGAGG - Intergenic
1077376128 11:2205760-2205782 GGGGAGGCTGAGAGGTAGGGAGG - Intergenic
1077376143 11:2205800-2205822 AGGGAGGCTGGGAAGTAGGGAGG - Intergenic
1077376171 11:2205888-2205910 GGGGAGGCTGAGAGGTAGGGAGG - Intergenic
1077376255 11:2206135-2206157 GGGGAGGCTGAGAGGTAGGGAGG - Intergenic
1077970525 11:7184361-7184383 CCAGAGGCTGAGAAGTATAGTGG + Intergenic
1078233804 11:9465931-9465953 TGGGAGGCTGAGGAGAAGGGAGG - Intronic
1079354585 11:19719653-19719675 TGGGAGGCAGAGAGGTAGGGTGG - Intronic
1079372745 11:19865485-19865507 AGTGAGGCTGGGAAGCAGAATGG - Intronic
1079546650 11:21641477-21641499 AGAGGGTCTGAGAAGTAGAGAGG + Intergenic
1080054065 11:27887071-27887093 TGTGAGGCAGAGAACAAGTGAGG + Intergenic
1080853153 11:36088917-36088939 TGTGAGACTGGGGAGGAGAGGGG - Intronic
1080907286 11:36559468-36559490 TGGGAGTTTGAGAAGAAGAGAGG - Intronic
1084021777 11:66422059-66422081 TGGGAGGCAGAGAAGAAGTGAGG - Intronic
1084451607 11:69242385-69242407 GGTGAGGCTGGGAACTGGAGTGG - Intergenic
1085162258 11:74359375-74359397 GGAGAAGCTCAGAAGTAGAGAGG - Intronic
1085272555 11:75278794-75278816 TGTGAGGCTCGCAAGGAGAGGGG - Intronic
1085681037 11:78575033-78575055 GGTGAGGCTGAGAAACTGAGAGG + Intergenic
1088402720 11:109438908-109438930 TAGGAGACTGAGGAGTAGAGAGG - Intergenic
1088612003 11:111586478-111586500 AATGAGGCTGACCAGTAGAGGGG + Intergenic
1088700438 11:112406843-112406865 TGTGAAGGTGAGCAGTAAAGGGG - Intergenic
1090809404 11:130223571-130223593 TGTGTGGCTGAGAAGTGGTTTGG + Intergenic
1091021225 11:132101954-132101976 AATGGGGCTGAGAAGTAGGGAGG - Intronic
1091585113 12:1811519-1811541 TGAGGGGCTGAGAAGTGTAGGGG + Intronic
1092029436 12:5271919-5271941 AGTGTGACTGAGAAGTTGAGTGG + Intergenic
1093757123 12:22865176-22865198 TGGGAGCCTGAGAAGAAGAAAGG + Intergenic
1094487237 12:30934862-30934884 TGAGATGCTGGCAAGTAGAGAGG + Intronic
1095328958 12:40933821-40933843 TGTGAGGCTGAGAACATTAGAGG + Exonic
1095477208 12:42597503-42597525 TGTGAGTTTGAGAAAGAGAGAGG + Intergenic
1096224351 12:49855894-49855916 TGAGAGGCTGGGAAGTGTAGTGG - Intergenic
1097502900 12:60428170-60428192 GGTGAGGCTGAGAAGTGAAAAGG + Intergenic
1099005316 12:77228232-77228254 TGGGAGACAGGGAAGTAGAGTGG - Intergenic
1101499094 12:105284686-105284708 TGGGAGGCTGGGGAGTTGAGAGG + Intronic
1102376319 12:112424284-112424306 TGTGAGGCTGGGAAGGTGGGAGG + Intronic
1102422193 12:112812692-112812714 TGTGAGGGAGAGAGGGAGAGAGG - Intronic
1102497634 12:113330368-113330390 TGTGAGGCGGTGGACTAGAGGGG + Intronic
1103063538 12:117878035-117878057 TGAGGGGCTGAGATGTGGAGAGG + Intronic
1103177604 12:118878133-118878155 ATTGAGGCAGAGAAGCAGAGAGG + Intergenic
1103198680 12:119068798-119068820 GGTGAGGCTTAGAAACAGAGAGG + Intronic
1103538615 12:121650978-121651000 TGTTAGGCTGAGAAGTGGTCAGG + Intergenic
1103869491 12:124081133-124081155 TGAGTGGGTGAGAAGCAGAGAGG + Intronic
1104163145 12:126200257-126200279 GGGGAGGCTGAGAAGGAGAATGG - Intergenic
1105654348 13:22419811-22419833 TGTGAGGAGGGGAAGGAGAGTGG + Intergenic
1106254431 13:28009902-28009924 TATGGGGCTGAGTAGGAGAGGGG + Intronic
1107021530 13:35757286-35757308 AGTGAGGCTGAAGCGTAGAGTGG + Intergenic
1107559253 13:41545531-41545553 TGTGAAGATGAGATGCAGAGAGG - Intergenic
1107897030 13:44975457-44975479 TGTGAGGTTGAAGAGGAGAGAGG - Intronic
1108503962 13:51092759-51092781 TGTGAAGCTGAGAAGTACATAGG + Intergenic
1109609552 13:64745656-64745678 TGTCAGGCTGAGATGTAAAAAGG - Intergenic
1109809030 13:67484878-67484900 TATGAGGAAGAGAAGTAGAAAGG - Intergenic
1110152750 13:72274732-72274754 AGTGAGGCAGAGAAGGAGAGAGG + Intergenic
1111234040 13:85385051-85385073 TGTGTGGCTGGTAAGTGGAGTGG - Intergenic
1111479844 13:88810378-88810400 TGTGGGGCTCAGAAGAAGACAGG + Intergenic
1112064615 13:95780146-95780168 TTTGGTGCAGAGAAGTAGAGAGG - Intronic
1112222515 13:97505370-97505392 TGGGAGGCAAAGAAGTAGGGAGG - Intergenic
1112334080 13:98499591-98499613 TGTGGATCTGAGAAGGAGAGGGG + Intronic
1112762681 13:102709098-102709120 GCAGAGGCTGAGAACTAGAGAGG - Intergenic
1113492704 13:110705174-110705196 TGTGAAGCTAAGAAGTGGTGGGG + Intronic
1113549402 13:111180599-111180621 GGAGAAGCTGAGATGTAGAGAGG + Intronic
1114215272 14:20653530-20653552 TGAGAGGGTGAGAGGCAGAGGGG + Intergenic
1114235037 14:20815963-20815985 TGTGAGGCTGGGAGGTATTGAGG + Intergenic
1114347799 14:21815170-21815192 TCTGAGGCTGCAAAGTAGTGGGG + Intergenic
1114640696 14:24218073-24218095 TGTGAAGATGAGAAGAGGAGAGG - Intronic
1114982617 14:28184794-28184816 TTAGAGGCTGAGAAGAAAAGAGG + Intergenic
1116007297 14:39307927-39307949 TATGAGGGTGGGAAGTATAGAGG + Intronic
1116250080 14:42470468-42470490 TGAGAGGCTGAGCAGGAGAATGG + Intergenic
1118057700 14:62098933-62098955 TATGAGGCTGAGTATTAGTGGGG + Intronic
1118509821 14:66459764-66459786 TGTAAGGGGGAGAATTAGAGAGG - Intergenic
1118754546 14:68830385-68830407 TCAGAGGCTGGGAAGGAGAGGGG - Intergenic
1118795575 14:69140787-69140809 ATAGAGGCTGAGAAGCAGAGTGG - Intronic
1119156918 14:72419947-72419969 TGTGAGACAGAGAAGTGGATGGG + Intronic
1119647854 14:76361300-76361322 TGGGAGGCTGGGATGTAAAGGGG + Intronic
1119851513 14:77869839-77869861 TGTGAAGCTGAGAAGAGGTGAGG - Intronic
1121075630 14:91065945-91065967 TGAGAGATGGAGAAGTAGAGAGG + Intronic
1121434044 14:93907088-93907110 ACTGAGGCTGAGAGGTGGAGTGG - Intergenic
1121867498 14:97376702-97376724 AGTGAGGCTGGGAACGAGAGTGG - Intergenic
1121888378 14:97565723-97565745 TGTGAGGGAGAAAAGTAGAATGG - Intergenic
1121977018 14:98414401-98414423 TGCGAGGCTGAGAAGTAAGGAGG + Intergenic
1122325934 14:100880661-100880683 TGTTGGGGTGAGAAATAGAGGGG + Exonic
1122551230 14:102551090-102551112 AGTGAGGCTGAGACCTAGATGGG + Intergenic
1122939581 14:104975254-104975276 GGTGAGGCTCAGAAGTGGACAGG - Intronic
1202841958 14_GL000009v2_random:129927-129949 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1202911349 14_GL000194v1_random:120160-120182 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1125682017 15:41536907-41536929 TGTGAGGCTGAGAAGTAGAGAGG - Intronic
1127507149 15:59608596-59608618 AGTGAGACAGAGAGGTAGAGAGG + Intronic
1127706199 15:61549430-61549452 TGAGACCCTGAGAAGTAGAATGG - Intergenic
1128837353 15:70820969-70820991 GATGAGGTGGAGAAGTAGAGAGG + Intergenic
1129964278 15:79719993-79720015 TGTGAAGAAGAGAAGTAGAAAGG - Intergenic
1130047956 15:80460812-80460834 TGTGAGGAGGAGAAGTAATGGGG + Intronic
1131074949 15:89489653-89489675 TGTGGGACTGAGAAGCAGAAGGG - Intronic
1131156483 15:90079099-90079121 TGTGAGGCAGAGCAGCACAGTGG + Intronic
1132234168 15:100206642-100206664 GGTGAGGCTGAGAAGAAGTGTGG + Intronic
1133361942 16:5181005-5181027 CCTGAGGATGAGTAGTAGAGAGG + Intergenic
1133928211 16:10211064-10211086 TCTCAGGCTGAGAAGCAGGGAGG - Intergenic
1134314423 16:13105486-13105508 AGAGAGGCTTAGAAGGAGAGAGG + Intronic
1134450349 16:14359573-14359595 GGGTAGGCAGAGAAGTAGAGAGG - Intergenic
1134747998 16:16602717-16602739 AGTGAGGCTGAGAAGTGGGCAGG - Intergenic
1134997469 16:18750942-18750964 AGTGAGGCTGAGAAGTGGGCAGG + Intergenic
1135930235 16:26730124-26730146 TGAGAGAGTGAGAAGGAGAGAGG - Intergenic
1136188600 16:28602175-28602197 TGTGCAGATGAGAAGCAGAGTGG - Intergenic
1136191070 16:28615169-28615191 TGTGCAGATGAGAAGCAGAGTGG - Intronic
1136416103 16:30104778-30104800 GCTGAGGGTGAGGAGTAGAGGGG - Intergenic
1136640528 16:31560834-31560856 TGTGAGGTTGTGAAGAAAAGGGG + Intergenic
1137792793 16:51188980-51189002 TGTGGGGCTGAGGTGTAGATGGG - Intergenic
1137911627 16:52383778-52383800 TGTGAGGTAGAGAAAGAGAGAGG - Intergenic
1139970406 16:70770659-70770681 GGTGAGGCAGAGAAGTAGCCAGG - Intronic
1140521285 16:75584324-75584346 TCTGGGGCAGAGAAGTGGAGGGG - Intergenic
1141004408 16:80338647-80338669 TGTGATGGGGAGAAGAAGAGTGG - Intergenic
1141735532 16:85849886-85849908 TGTGGGACTGAGGAGCAGAGAGG - Intergenic
1141882424 16:86868797-86868819 GGTAAGGCAGAGAGGTAGAGGGG + Intergenic
1141958805 16:87391508-87391530 TGGGAGGCTGAGGGGTAGACAGG + Intronic
1144008022 17:11118862-11118884 AGTCAGGCAGAGAAGGAGAGAGG + Intergenic
1144818960 17:18057936-18057958 TGGGAGGCTGAGGAGGAGAATGG - Intronic
1146214082 17:30964787-30964809 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1146936056 17:36813320-36813342 AGGGAGGCTGAGAGGGAGAGGGG + Intergenic
1147415600 17:40287395-40287417 TGCGAGGTTGAGCATTAGAGAGG + Intergenic
1147909208 17:43844718-43844740 TGTGGGGCTGGGAAATGGAGGGG + Intergenic
1149146050 17:53494133-53494155 TTGGAGGCTGAGAAGTGTAGGGG + Intergenic
1149681128 17:58508131-58508153 AGTGGGGCTGGGAAGTAGGGAGG - Intronic
1151290840 17:73148709-73148731 TGTAAGGGGGAGAAGAAGAGAGG - Intergenic
1152313688 17:79567073-79567095 TCTGAGGCTGGGAAGGAGAACGG - Intergenic
1152521363 17:80858638-80858660 AGTGGGGCTGAGAAGTCGTGTGG + Intronic
1152635422 17:81428800-81428822 TGAGGGGCTGAGAAGTGGTGGGG - Intronic
1155172141 18:23274760-23274782 TGTGAGACTGAGAGGGAGATGGG - Intronic
1155848543 18:30740280-30740302 TCAGAGGCTGAGAAGGAGAATGG + Intergenic
1156471877 18:37382316-37382338 AGAGAGGCAGAGAAGGAGAGTGG - Intronic
1156473536 18:37391984-37392006 TGCAAGGCTGAGAACCAGAGGGG + Intronic
1156489542 18:37488023-37488045 TGGGGGGCTAAGAAGTAGTGAGG - Intronic
1156628343 18:38937333-38937355 TGGGAGGCTGACATCTAGAGAGG - Intergenic
1157331187 18:46704956-46704978 TTTGTGGCTGGGAAGGAGAGGGG + Intronic
1157555841 18:48612440-48612462 TGTGGGGATGGGAAGGAGAGAGG + Intronic
1157601594 18:48896587-48896609 GGTGAGGCTGAAGAGTGGAGTGG - Intergenic
1158175576 18:54652204-54652226 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
1158748555 18:60230209-60230231 TGAGAGGCTGAAAACAAGAGAGG - Intergenic
1159379810 18:67642322-67642344 TCAGAGGCTGGGAAGTATAGTGG + Intergenic
1159943430 18:74426177-74426199 TCTGAGGGTGGGAAGTGGAGAGG - Intergenic
1160657109 19:278954-278976 TGGGAGGCTGAGCAGGAGAATGG + Intergenic
1161454225 19:4362148-4362170 TGTGAGGCTGAGACCCAGAGGGG + Intronic
1162268954 19:9598568-9598590 TGAGAGGCAGAGAAGGAGGGAGG - Intergenic
1163430614 19:17264909-17264931 TTGGAGGCTGAGAAGAGGAGGGG - Intronic
1163847523 19:19646012-19646034 TGTGAGCCGGAGCAGGAGAGGGG - Intronic
1164579532 19:29425957-29425979 TGTGGGGCTGCAAAGTGGAGTGG - Intergenic
1165463046 19:35955355-35955377 TGGGAGGCTGAGGAGGAGGGTGG + Intergenic
1165495268 19:36149028-36149050 TGTTAGGCTTAGAACTGGAGAGG + Intronic
1165821491 19:38679209-38679231 TGTGGGGCTGAGAAGTATTCGGG - Intronic
1166711732 19:44942091-44942113 TGGGAGGGTGAGAAGGAGGGAGG + Intergenic
1166971471 19:46571305-46571327 TGGGAGGCTGAGGAGGAGAATGG + Intronic
1167112025 19:47468215-47468237 GGTGAGGCTGAGGAGCAGAGGGG - Intronic
1167982312 19:53285000-53285022 TGAAAGGCTGAGAAGGGGAGAGG + Intergenic
1167983833 19:53298973-53298995 TGAAAGGCTGAGAAGGGGAGAGG - Intergenic
925539727 2:4953499-4953521 TGGGAGGCTCAGAAGAAGACAGG - Intergenic
925588073 2:5483263-5483285 TGTGAGGCTGAGAGCAAGGGAGG + Intergenic
925920732 2:8636169-8636191 TGTGAGGCTGAGAAGGGGCCTGG + Intergenic
927248041 2:20973785-20973807 CCTGAGGCTGAGAACTACAGTGG + Intergenic
928346859 2:30506922-30506944 TGTGAAGCTTACAAGAAGAGTGG + Intronic
929226234 2:39514314-39514336 TGTGAGATTCTGAAGTAGAGTGG + Intergenic
929451726 2:42042490-42042512 GGTGGGGCTGAGGACTAGAGAGG - Intergenic
929451750 2:42042619-42042641 GGTGAGGCTGAGTAGGAGGGAGG + Intergenic
929589546 2:43136046-43136068 TGGGAGGAAGAGAAGGAGAGGGG + Intergenic
929939549 2:46322656-46322678 TGAGGAGCTGAGATGTAGAGAGG + Intronic
930303718 2:49651008-49651030 TGTGCCTCTGAGAAGTAAAGAGG - Intergenic
931778032 2:65556710-65556732 AGAAAGGCTGAGAAGCAGAGGGG + Intergenic
932060942 2:68496920-68496942 TGGAAGGCTGAGAAGAAGACAGG - Intronic
932075430 2:68658104-68658126 TTTTAGGCTGAAAAGCAGAGTGG - Intergenic
933437505 2:82266982-82267004 TGTGAATCTGAAATGTAGAGAGG + Intergenic
934097517 2:88620266-88620288 TGTGGAGCTGGGAAGGAGAGGGG - Intronic
934128196 2:88919873-88919895 AGTGAGGCAGAGAGGCAGAGAGG - Intergenic
934573549 2:95386212-95386234 TGTGAGCCTGAGAATTTGAGCGG - Intergenic
934649835 2:96084585-96084607 TGTGAGCCTGAGAAGTGGTAGGG + Intergenic
936536002 2:113311715-113311737 TCTGAGATTGAGGAGTAGAGTGG + Intergenic
937302151 2:120849375-120849397 TGGGAGGTTGAGAGGAAGAGAGG - Intronic
937909247 2:127067555-127067577 TGGGATGCTGAGACGTGGAGGGG - Intronic
937927313 2:127177112-127177134 TGTGAGGCAGATACGCAGAGAGG + Intergenic
938302499 2:130227244-130227266 GGTGAGAGTGAGAAGCAGAGAGG - Intergenic
938924968 2:136030629-136030651 TTTGAGTCTGAAAAGCAGAGTGG - Intergenic
939516540 2:143175623-143175645 TCTGTGGCTGAGAATGAGAGTGG - Intronic
940041195 2:149362702-149362724 TGAGAGGGTGAGAAGTGAAGGGG + Intronic
942403755 2:175630850-175630872 TGGGAGGCTGTGTAGCAGAGTGG + Intergenic
942807654 2:179951879-179951901 AGTGAGGCAGAGAAGTGAAGAGG + Intronic
943181233 2:184544287-184544309 TGTGAGTCTGTGAATAAGAGGGG + Intergenic
944724222 2:202453648-202453670 TCAGAGGCTGAGAAGAATAGTGG + Intronic
945191819 2:207196692-207196714 TTTGAGGCTGAGAAAGTGAGAGG + Intergenic
945509735 2:210686490-210686512 TGTGAAGCTGAGGTTTAGAGAGG + Intergenic
946362195 2:219225705-219225727 TGTGGGGCTGAGGAGCAGAGAGG - Intronic
946532450 2:220586202-220586224 AGAGAGGCTGAGAGGAAGAGAGG + Intergenic
946707571 2:222473515-222473537 TTTGAGGCTGGGAAGGAGAGGGG + Intronic
946757015 2:222957580-222957602 TGAGAGGCTGGGAAGGGGAGTGG + Intergenic
947962437 2:234250718-234250740 TTTGAGGCAAAGAGGTAGAGTGG - Intergenic
1168838921 20:896415-896437 TGAGAGGCTGAGAAGAAGCAAGG + Intronic
1169953645 20:11076836-11076858 TCTGAGGATGGGAAGTAAAGGGG - Intergenic
1170399243 20:15961857-15961879 TGTGAGGCTTAGTAAGAGAGAGG + Intronic
1172244438 20:33436086-33436108 TGGGAGGCTGAGCAGGAGAATGG + Intronic
1173874763 20:46363611-46363633 GGAGAGGAAGAGAAGTAGAGGGG - Intronic
1174391406 20:50220469-50220491 AGAGAGGCTGAGAAATAAAGAGG + Intergenic
1175712499 20:61232381-61232403 TGTGAGACTAAGAACCAGAGCGG - Intergenic
1176529292 21:7945705-7945727 TGGGATGCCGTGAAGTAGAGTGG - Intergenic
1176630704 21:9134829-9134851 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1176642582 21:9320000-9320022 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
1176975872 21:15321191-15321213 TTAGAGGCTGAAAAGAAGAGGGG - Intergenic
1179190744 21:39119761-39119783 GGTGAGGCAGAGAACAAGAGGGG + Intergenic
1180351588 22:11809352-11809374 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
1180375890 22:12092797-12092819 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
1180386612 22:12182722-12182744 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1181772944 22:25139942-25139964 AGTGAAGCTGAGAAGTGGTGTGG + Intronic
1182364065 22:29766234-29766256 TTTGAGGGAAAGAAGTAGAGTGG - Intronic
1183598130 22:38824470-38824492 TGCGAGGCCCAGAGGTAGAGGGG + Intronic
1184164174 22:42717722-42717744 TGTGAGACAGAGAGATAGAGAGG - Intronic
1185343785 22:50302697-50302719 TCTGAGGCTGAGAGGGAGTGGGG + Intronic
949165286 3:933414-933436 TGGGAGGCTTAGAAATAGAAAGG - Intergenic
950716576 3:14851729-14851751 AGTGAGGCTCAGAAGTCTAGTGG - Intronic
950921913 3:16703504-16703526 CTTGAGGCTGAGAAAGAGAGAGG - Intergenic
951063171 3:18234220-18234242 TGTGTGGCTGAGGTGAAGAGAGG + Intronic
951360059 3:21714360-21714382 AGTGAGGCTCAGAAGTGGATGGG - Intronic
951595356 3:24312706-24312728 AGTGAGGGGGAGAAGAAGAGGGG + Intronic
952049699 3:29369538-29369560 AGTGAGGGTGAGGAGGAGAGAGG + Intronic
952672024 3:35980925-35980947 TGGGAGGCTGAGAGGTAGGAGGG - Intergenic
952774737 3:37034185-37034207 TATGAGGCTGGGAAGCAGGGTGG - Intronic
952812221 3:37414356-37414378 TCAGAGGCTGGGAAGGAGAGAGG - Intronic
953187411 3:40651753-40651775 TTTGATGCTGAGGAGGAGAGGGG - Intergenic
954927836 3:54252821-54252843 GTTGAGGCCGGGAAGTAGAGAGG + Intronic
956666141 3:71643611-71643633 AGAGTTGCTGAGAAGTAGAGAGG + Intergenic
957097523 3:75790649-75790671 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
958431677 3:94046279-94046301 GATGAGGTGGAGAAGTAGAGAGG - Intronic
958753075 3:98215996-98216018 TGTGATGCAGTGAAGTACAGGGG - Intergenic
958877740 3:99635053-99635075 AATGAGGCTGAGAAATGGAGAGG - Intergenic
959012926 3:101099118-101099140 AATGAGCCTGAGAAGTAGACAGG - Intergenic
959266034 3:104140010-104140032 TTTGAGTCTGAGAGGTAGAGAGG + Intergenic
959722353 3:109506561-109506583 TTGGAGGCTGGGAAGTAAAGGGG + Intergenic
960416638 3:117393019-117393041 TGTGTGGAGAAGAAGTAGAGTGG - Intergenic
961000103 3:123368270-123368292 TGGAGGGCTGAGAAGTAGATGGG + Intronic
961518579 3:127454126-127454148 TGGAAGGCTGAGAAGTTGGGTGG - Intergenic
961716858 3:128863758-128863780 GGTGAGGCTGGGAAGAAGGGAGG + Intergenic
962079267 3:132119791-132119813 TGTCAGGCAGAGAAGTAAACAGG + Intronic
962282014 3:134059259-134059281 TGAGAAGCAGAGAAGGAGAGTGG - Intergenic
963028868 3:140946786-140946808 GGTAAGTTTGAGAAGTAGAGAGG + Intronic
963152619 3:142061687-142061709 TGAAGGGCTGAGAACTAGAGGGG - Intronic
963621587 3:147614197-147614219 TGTGTGGCAGAAAAGAAGAGGGG - Intergenic
966381453 3:179348387-179348409 TGTGAGGCTGACATTTAGAAAGG - Intronic
967554394 3:190837340-190837362 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
968008119 3:195256559-195256581 TGTGCGGGTGAGAAGTTGCGGGG - Intronic
968094760 3:195921069-195921091 TGGGAGGCTGAGGAGGAGGGTGG - Intergenic
1202744303 3_GL000221v1_random:85018-85040 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
969013419 4:4086025-4086047 CGGGAGGCTGAGAAGGAGAATGG + Intergenic
970146989 4:13046388-13046410 TGGGAGTGGGAGAAGTAGAGAGG + Intergenic
970250074 4:14105163-14105185 TGTGATTCTGAGAAGTTAAGTGG + Intergenic
971233284 4:24818222-24818244 TTTGAGCCTGAGAAGCTGAGAGG + Intronic
971684623 4:29748058-29748080 TGGGAGGCTCAGAAGAAGACAGG - Intergenic
972452479 4:39216435-39216457 TGTGAGCTTCAGAATTAGAGAGG + Intronic
974025173 4:56727272-56727294 GATGAGGCTGAGAAGTAGCCGGG + Intergenic
974422250 4:61692325-61692347 TATGGGGTTGAGAAATAGAGGGG - Intronic
974710666 4:65589807-65589829 TGTGAGGCATAAAAGTAGTGTGG + Intronic
974713821 4:65639690-65639712 TGGGAGTCTCAGAAGAAGAGAGG - Intronic
975362807 4:73491071-73491093 AGTGAGGCTGAAACGGAGAGGGG + Intronic
975907306 4:79228906-79228928 TGTGAGACTGAAAAATAGAATGG - Intronic
976008597 4:80460074-80460096 TGTGAGAGAGAGAAGAAGAGAGG + Intronic
978702252 4:111661991-111662013 CAAGAGGCTGGGAAGTAGAGAGG + Intergenic
978969592 4:114787116-114787138 GGTGAGGCTGAGGAGAAAAGGGG + Intergenic
979611756 4:122696907-122696929 CCAGAGGCTGAGAAGTATAGTGG + Intergenic
980962695 4:139492127-139492149 GGTGAGGCTGGGGAGGAGAGGGG - Intergenic
981795282 4:148588815-148588837 TGGAAGGCTCAGAAGAAGAGAGG + Intergenic
981942821 4:150303674-150303696 TGGGAGGCTGAGCAGGAGAATGG - Intronic
982178151 4:152725942-152725964 TGTGAGGTGGAGAAGTATTGGGG + Intronic
1202757488 4_GL000008v2_random:78237-78259 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
985800639 5:2003546-2003568 GGTGAGGCTGGGAGGTACAGGGG + Intergenic
986416828 5:7537439-7537461 TGAAAGGCTGGGAAGTACAGAGG - Intronic
986514810 5:8550136-8550158 TGTGTGGCAGAGAACTGGAGTGG - Intergenic
987005248 5:13703833-13703855 TGTGAGGCTGAGAAGTATAGGGG - Intronic
987033145 5:13994151-13994173 TGGGTGGCTGAGAGGCAGAGAGG - Intergenic
987087603 5:14484792-14484814 TGTGGGGATAGGAAGTAGAGTGG - Intronic
988013684 5:25525811-25525833 TAAGAGGCTGAGAAGTGTAGTGG - Intergenic
989700695 5:44261149-44261171 TGTCAAGCTGATAAGTAAAGAGG + Intergenic
992988177 5:82255104-82255126 TGTGGGGTTGAGAAGCAGAGGGG - Exonic
993214517 5:85002341-85002363 TTAGAGGCTGAGAACTATAGTGG - Intergenic
993267193 5:85740963-85740985 TGGGGGGCTCAGAAGAAGAGAGG - Intergenic
994533335 5:100994097-100994119 AGAGTGGCAGAGAAGTAGAGTGG + Intergenic
994735217 5:103545529-103545551 TGTTTGGCTGAGGAGTAGAGTGG + Intergenic
995893227 5:116981087-116981109 TGTTAGGCTGAGAAAGAGAAGGG + Intergenic
996259059 5:121443219-121443241 TCAGAGGCTGGGAAGTATAGCGG + Intergenic
997772140 5:136565120-136565142 AGTGAGGCTGTGGAGAAGAGGGG - Intergenic
997853811 5:137355773-137355795 TCTGAGCCAGAGAAGGAGAGGGG - Intronic
997928808 5:138055365-138055387 TCAGAGGCTGGGAAGTGGAGAGG - Intergenic
998565438 5:143212330-143212352 TGAGAGGCTGGGAAGCAGACAGG - Intronic
998933065 5:147202659-147202681 TCAGAGGCTGAGAAGGATAGTGG - Intergenic
999733289 5:154492459-154492481 GGGGAGGCTGTGAAGGAGAGAGG - Intergenic
999745802 5:154590839-154590861 TGTGAAGCAGACAGGTAGAGAGG - Intergenic
1000152493 5:158517385-158517407 GGTGAGGATGAGAAGCACAGCGG + Intergenic
1000563946 5:162824940-162824962 TGGGAGGCTGAGACGGAGAATGG - Intergenic
1001163442 5:169341837-169341859 TCTGATCCTGAGAAGGAGAGAGG + Intergenic
1001192599 5:169644451-169644473 TGTGGGTATGAGAAGGAGAGAGG + Intronic
1001238858 5:170052583-170052605 TGTGGGGCAGAGATGTAAAGTGG + Intronic
1001516359 5:172358063-172358085 TGAGAGGCTGAGGCTTAGAGAGG + Intronic
1001575358 5:172759736-172759758 TCAAAGGCTGAGAAGTTGAGTGG + Intergenic
1004165987 6:13256863-13256885 TGTAGGGCTCAGAAGAAGAGAGG - Intronic
1004603220 6:17170688-17170710 TGTGAGGCTTAGAGGCAGACAGG - Intergenic
1006075006 6:31526719-31526741 TGGGAGGCTGAGCAGGAGAATGG - Intergenic
1006097852 6:31666919-31666941 TGTGAAGCTGGCAAGTAGGGAGG - Intronic
1006187408 6:32189264-32189286 TGTCTGGCTGAGCAGTGGAGAGG + Intronic
1006605336 6:35252133-35252155 AGGGAGGCAGAGAAGTAAAGAGG - Exonic
1006645131 6:35510616-35510638 TGTGAGGCAGAGGAGGACAGAGG - Intronic
1006967631 6:38004860-38004882 TGTCAGACTGAGAAAGAGAGTGG + Intronic
1007034684 6:38662392-38662414 TGTGGGGCTGGGAAGTACACAGG + Intergenic
1007405414 6:41633014-41633036 CTTGAGCCTGGGAAGTAGAGAGG + Intergenic
1008016872 6:46530436-46530458 TCTGAGACTGACAAGCAGAGTGG + Intergenic
1008492327 6:52099481-52099503 TGTGAAGATGAGGAGTATAGCGG + Intergenic
1009167934 6:60363325-60363347 GGAGAGGGTGAGAAGGAGAGGGG - Intergenic
1009167941 6:60363347-60363369 GGAGAGACTGAGAAGGAGAGAGG - Intergenic
1009960636 6:70516638-70516660 TGGGAGGCTGAGATGGAGAATGG - Intronic
1010261302 6:73820218-73820240 TGGGATACTGAGAATTAGAGTGG - Intronic
1011673545 6:89708374-89708396 TGTGAACCTGAGAAGTTGTGGGG - Intronic
1011765191 6:90611961-90611983 TGTGAGGCTGTGACAGAGAGGGG - Intergenic
1012789430 6:103674897-103674919 TGAGAGGCTGATAGGCAGAGAGG - Intergenic
1013630884 6:111984722-111984744 TCTGAGGCTCAGGAGGAGAGGGG + Intergenic
1016172050 6:141030068-141030090 TTGGAGGCTGAGAAGGAGAATGG - Intergenic
1020447328 7:8282954-8282976 AGTGTGGCTGTGAAGTATAGTGG + Intergenic
1020798839 7:12708714-12708736 TGTGAGGGAGAGAAAAAGAGAGG - Intergenic
1021490524 7:21215596-21215618 TGCTATGCTGATAAGTAGAGGGG - Intergenic
1022357026 7:29625712-29625734 TGGGAGGCAGGGAAGGAGAGAGG + Intergenic
1022459272 7:30588780-30588802 TGGGAGGCTGAGAAGCAGGGCGG + Intergenic
1023956599 7:44891649-44891671 TCTGAGGCTGAGGAGAGGAGAGG + Intergenic
1025951015 7:66145534-66145556 TGTGGGTCTGAGATGTAGAATGG + Intronic
1026666880 7:72348437-72348459 TGTGGGGCAGAGAACTGGAGAGG + Intronic
1028022079 7:85789607-85789629 TGGGAAGCTGGGAAGTGGAGTGG + Intergenic
1028404780 7:90463605-90463627 TTGGAGGCTCAGAAGAAGAGAGG + Intronic
1028597246 7:92558511-92558533 TGGGAGGCTGAGATGGAGGGTGG - Intergenic
1028661839 7:93286483-93286505 GGTGAAGCTGAGAACCAGAGTGG + Intronic
1028929770 7:96399557-96399579 TATTAGGCTGAGCAGTAGAAAGG + Intergenic
1029356502 7:100056043-100056065 TGGGAGGCTGAGCAGGAGAATGG - Intronic
1030265979 7:107622353-107622375 GTTGAGGCTGAAAAGTAGATGGG - Exonic
1030756944 7:113297475-113297497 TGGGAGGCAGAGATGAAGAGAGG + Intergenic
1030840964 7:114353808-114353830 TGTGATGGTGAGATGTAGATTGG - Intronic
1032202103 7:129829346-129829368 ACTGAGGCTGAGAGGTTGAGTGG + Intergenic
1034225221 7:149476206-149476228 TGGGAGGCTGAGCAGGAGAATGG + Intronic
1034407287 7:150913533-150913555 TGTGAGGCTTGGAAGTGCAGCGG - Intergenic
1038454794 8:27666201-27666223 TATTAGGCTGAGAAGCTGAGTGG - Intronic
1040716660 8:50262513-50262535 TCTGAGGCTGAGCAGGAGAATGG - Intronic
1040836055 8:51732465-51732487 TGAGGGGCTCAGAAGAAGAGAGG - Intronic
1041570156 8:59328694-59328716 GGTGAGTGTGAGAATTAGAGAGG + Intergenic
1043338688 8:79209538-79209560 TGAGTGGCTGAGAAGTTGAGTGG + Intergenic
1043872159 8:85445463-85445485 TGAGAGTCAGAGAAGTTGAGTGG + Intronic
1045103111 8:98865306-98865328 TGGGAGGCTGAGAGGTATAGGGG - Intronic
1045280615 8:100746626-100746648 GGTGTGGCTGAGAGATAGAGAGG + Intergenic
1046027531 8:108743811-108743833 TGAGAGGCTGTGGAGGAGAGGGG - Intronic
1046480707 8:114813828-114813850 CGGGAGGCTGAGAAGGAGAATGG + Intergenic
1046970343 8:120215953-120215975 TGTGGAGCTTAGAGGTAGAGTGG + Intronic
1047684910 8:127295160-127295182 TGGGAGGCAGAGAGGTGGAGGGG + Intergenic
1047685616 8:127302249-127302271 TGGGAATCTGAGAAGTAGAAGGG - Intergenic
1048526958 8:135211969-135211991 GGTGAGGCTGAGATGTATAAAGG - Intergenic
1049283967 8:141764595-141764617 AGTGAGGCTGAGAGGGAGTGGGG - Intergenic
1049663957 8:143834886-143834908 TGTGAGTCTGAGGAGCAGGGAGG + Exonic
1050009201 9:1169078-1169100 GGTGAGGGAGAGAGGTAGAGAGG + Intergenic
1050730464 9:8703609-8703631 GGTGAGGATGAGAAGTCGAGGGG - Intronic
1050803135 9:9640721-9640743 TATGAGGCTGGGAAGTAGAGGGG + Intronic
1051184006 9:14439787-14439809 TGTGAGGAAAACAAGTAGAGAGG + Intergenic
1051269411 9:15340853-15340875 TGGGAGGCTGAGCAGGAGAATGG - Intergenic
1051912623 9:22171840-22171862 TGTGAAGCTGATAAGAAGAGCGG - Intergenic
1053532686 9:38897807-38897829 TGGGAGGCTGAGCAGGAGAATGG - Intergenic
1054204910 9:62122236-62122258 TGGGAGGCTGAGCAGGAGAATGG - Intergenic
1054633448 9:67466134-67466156 TGGGAGGCTGAGCAGGAGAATGG + Intergenic
1055815691 9:80202365-80202387 CGGGAGGCTGAGAAGGAGAATGG + Intergenic
1057233111 9:93337044-93337066 TGTCAGGCTGAGAACTGGACTGG + Intronic
1057299970 9:93872257-93872279 TGGGTGGATGAGAAGTAGAATGG + Intergenic
1057303475 9:93899617-93899639 TGGGAGACTGAGATGTGGAGAGG - Intergenic
1057905494 9:98980050-98980072 TGGGAGGCTGAGAGGTGGAAGGG + Intronic
1057964124 9:99487021-99487043 TGTGTGGCTGAGAAGGGAAGAGG - Intergenic
1058218991 9:102272344-102272366 GGTGAGGCTGTGAAGAAAAGGGG - Intergenic
1059171493 9:112129218-112129240 TGTGAGGGTGAGAAGGGGGGTGG + Intronic
1059520070 9:114932649-114932671 TGTGGGGCTGAGAAGGGCAGTGG + Intergenic
1060498406 9:124134657-124134679 TGGGATGCTGAGAAAGAGAGGGG + Intergenic
1060941157 9:127543627-127543649 TGTGGGGATGGGAAGGAGAGCGG - Intronic
1062327859 9:136020914-136020936 TGCGAGGCTGAGACGGAGGGTGG - Intronic
1203689087 Un_GL000214v1:25289-25311 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
1203753534 Un_GL000218v1:102527-102549 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1203387655 Un_KI270438v1:69942-69964 TGCGATGCCGTGAAGTAGAGTGG + Intergenic
1203712935 Un_KI270742v1:114967-114989 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1203538278 Un_KI270743v1:63100-63122 TGGGAGGCTGAGGAGGAGAATGG + Intergenic
1203647188 Un_KI270751v1:78764-78786 TGGGAGGCTGAGGAGGAGAATGG - Intergenic
1185511504 X:667957-667979 TGTGAGGGGGTGAAGGAGAGGGG - Intergenic
1187554121 X:20335022-20335044 TGGGAGGCAGAGAGGTAGACTGG - Intergenic
1189191801 X:39115666-39115688 TGAGAAGCTGAGAAAGAGAGTGG - Intergenic
1189549564 X:42078795-42078817 TCTAAGGCTGAGAAGAAGACAGG - Intergenic
1190733103 X:53237375-53237397 TGCCTCGCTGAGAAGTAGAGTGG + Intronic
1191668106 X:63724058-63724080 TGAGAGGCAAAGAAGTAGACAGG + Intronic
1192415415 X:70975411-70975433 TTTGAGGCAGAGAAGTATGGTGG + Intergenic
1192773240 X:74215447-74215469 TGTGAAGCTGAGATGAAGAGAGG + Intergenic
1193175841 X:78391357-78391379 CCAGAGGCTGAGAAGTATAGTGG + Intergenic
1193321225 X:80123720-80123742 CCAGAGGCTGAGAAGTGGAGTGG - Intergenic
1194891845 X:99388654-99388676 TCCGAGGCTGGGAAGTATAGTGG - Intergenic
1195317646 X:103694348-103694370 TGTGAAGCTGACAAGGAAAGGGG - Intergenic
1196698688 X:118642312-118642334 TGTGAGGCTGGGAATGAGAAAGG + Intronic
1196706256 X:118720187-118720209 TCTGTGGCTGAGAAGTAGCAAGG + Intergenic
1198127928 X:133665300-133665322 TGTGAAGTTGAGAGGTAGATAGG + Intronic
1199176789 X:144797922-144797944 ACTGAGGCAGAAAAGTAGAGTGG + Intergenic
1199542650 X:148974134-148974156 TGAGAGGATGAGAATAAGAGAGG + Intronic
1201167178 Y:11220089-11220111 TGGGAGGCTGAGGAGGAGAATGG - Intergenic