ID: 1125682061

View in Genome Browser
Species Human (GRCh38)
Location 15:41537160-41537182
Sequence CTCCAGCAGTGTCTCCGTGT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 261
Summary {0: 1, 1: 0, 2: 0, 3: 16, 4: 244}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125682059_1125682061 -10 Left 1125682059 15:41537147-41537169 CCAGTACGACTCTCTCCAGCAGT 0: 1
1: 0
2: 1
3: 2
4: 81
Right 1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 244
1125682058_1125682061 -9 Left 1125682058 15:41537146-41537168 CCCAGTACGACTCTCTCCAGCAG 0: 1
1: 0
2: 1
3: 4
4: 64
Right 1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 244
1125682057_1125682061 -8 Left 1125682057 15:41537145-41537167 CCCCAGTACGACTCTCTCCAGCA 0: 1
1: 0
2: 0
3: 5
4: 71
Right 1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 244
1125682055_1125682061 2 Left 1125682055 15:41537135-41537157 CCAGCTGCCTCCCCAGTACGACT 0: 1
1: 0
2: 0
3: 5
4: 126
Right 1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 244
1125682056_1125682061 -5 Left 1125682056 15:41537142-41537164 CCTCCCCAGTACGACTCTCTCCA 0: 1
1: 0
2: 0
3: 5
4: 102
Right 1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG 0: 1
1: 0
2: 0
3: 16
4: 244

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125682061 Original CRISPR CTCCAGCAGTGTCTCCGTGT GGG Exonic
907410851 1:54282347-54282369 CTCCAGCAGTGTTTCCCAGTTGG - Intronic
908118665 1:60965364-60965386 CTCCAGTAGGGACTCTGTGTAGG + Intronic
908963492 1:69729788-69729810 CCCCAGCAGAGACTCTGTGTGGG + Intronic
909913522 1:81290020-81290042 CTCCCACAGTGTCTCCAGGTTGG + Intergenic
911490796 1:98563389-98563411 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
911855690 1:102872303-102872325 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
912052044 1:105541765-105541787 CTCCAGTGGCGACTCCGTGTGGG + Intergenic
912511809 1:110194883-110194905 CTCCAGCTGTGTCCCAGTGTGGG - Intronic
915625624 1:157112345-157112367 CTCCATGTGTGCCTCCGTGTGGG + Intergenic
915665416 1:157439971-157439993 CTCCAGTGGTGACTCTGTGTGGG + Intergenic
917894576 1:179475213-179475235 CTCCAGTAGGGACTCTGTGTGGG - Intronic
918990738 1:191694782-191694804 CCCCAGTAGAGTCTCTGTGTAGG + Intergenic
919256236 1:195128528-195128550 CTCCAGGAGGGACTCTGTGTGGG + Intergenic
921559196 1:216636587-216636609 CTACAGCACTGTCTCCTTTTGGG + Intronic
921792741 1:219308845-219308867 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
922179082 1:223219510-223219532 CTCTAGCAGAGTCTCCCTGCAGG - Intergenic
922486363 1:225976107-225976129 CCCCAGCAGTCTCTCCCTGACGG + Intergenic
924060000 1:240164130-240164152 CTCCAGCAGTCTTTCCGCCTTGG + Intronic
1062885115 10:1010666-1010688 CTCCACCAGAGTCTCAGGGTGGG - Intronic
1062885185 10:1010917-1010939 CTCCACCAGAGTCTCGGGGTGGG - Intronic
1062885236 10:1011107-1011129 CTCCACCAGAGTCTCGGGGTGGG - Intronic
1064097092 10:12431905-12431927 CTCCAGCTGTGTTTCCCTTTTGG + Intronic
1064614133 10:17135159-17135181 CTACAGCAGTGTCTATATGTGGG + Intergenic
1065382372 10:25103054-25103076 CTCCAGGACTGTCTCAGTGAAGG + Intergenic
1065534249 10:26701739-26701761 CCCCAGCAGGGACTCCGTGTGGG - Intronic
1066118795 10:32263644-32263666 CCCAAGCAGTGTCTCCCTGAGGG - Intergenic
1066451890 10:35537353-35537375 CCCCAGCAGGGACTCTGTGTGGG - Intronic
1068807406 10:61213651-61213673 TTCCAGTAGTTTCTCCTTGTAGG - Intergenic
1068903771 10:62299607-62299629 CTCCAGCAGTTTCCCATTGTAGG - Intergenic
1070589145 10:77789214-77789236 CCCCAGCACAGTCTCCATGTGGG + Intergenic
1071395428 10:85218847-85218869 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1071478403 10:86044088-86044110 CTTGAGCAGTGTTTCTGTGTGGG - Intronic
1074223655 10:111462399-111462421 CTCCAGTAGGGACTCCGTGTGGG - Intergenic
1078978625 11:16506034-16506056 CCCCAGCAGGGACTCTGTGTGGG - Intronic
1079346674 11:19658647-19658669 CCCCAGCAGTATCCCCGTGCAGG + Intronic
1079500231 11:21094467-21094489 CCCCAGTAGGGTCTCTGTGTGGG + Intronic
1079686242 11:23363016-23363038 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
1081008125 11:37773881-37773903 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
1081022008 11:37958709-37958731 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
1081370689 11:42298508-42298530 CTCCAGCAGCTTCTGCGGGTAGG + Intergenic
1081400394 11:42636172-42636194 CTCCAGTAGGGACACCGTGTGGG - Intergenic
1081598742 11:44477222-44477244 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1082561645 11:54626719-54626741 CTCTAGTAGGGACTCCGTGTGGG + Intergenic
1082934824 11:58645707-58645729 CTCCAGTAGAGACTCTGTGTGGG + Intronic
1083185302 11:61014098-61014120 CTCCAGCTGTGTGTACGTCTTGG - Intronic
1083430390 11:62611263-62611285 CTCCACCTCTGTCTCCGTCTGGG + Exonic
1083609070 11:63996606-63996628 ATCCAGCAGTGCCTCCAAGTGGG - Exonic
1083944369 11:65915890-65915912 CTCCAGCAGTCTCACCGAATCGG - Intergenic
1084608718 11:70187301-70187323 CACCAGAAATGTCTCCGTGGAGG + Intronic
1084737676 11:71116367-71116389 TTCCTGCAGTGTATACGTGTTGG - Intronic
1087116844 11:94534690-94534712 CTTCAGCAATGCATCCGTGTTGG + Intergenic
1089496646 11:118911423-118911445 CTCCAGCCGTGTCTCTGGGGAGG + Intronic
1092489177 12:8929751-8929773 CTCAAGCAGTCTGTCCGTCTTGG + Intronic
1093973970 12:25400943-25400965 CCCCAGTAGTGACTCTGTGTGGG - Intergenic
1094421139 12:30272619-30272641 CTCCAGTGGTGACTCTGTGTGGG + Intergenic
1094655933 12:32419503-32419525 CCCCAGCAGTGGCTGCGTGGTGG - Intronic
1095928787 12:47605738-47605760 CCCCAGCAGGGACTCCATGTGGG + Intergenic
1096100589 12:48968618-48968640 CTCCAGGGGTCTCTCCCTGTGGG - Intronic
1097668809 12:62512712-62512734 CTCCAGTAGGGACTCTGTGTGGG + Intronic
1098304434 12:69088259-69088281 CTTCAGCATTGTCTGCGTGATGG - Intergenic
1099694253 12:85997915-85997937 CTCCAGTAGGGACTCAGTGTGGG + Intronic
1101663537 12:106788417-106788439 CCCCAGTAGGGACTCCGTGTGGG + Intronic
1104485409 12:129147947-129147969 GTCCAGTACTTTCTCCGTGTTGG + Intronic
1104893408 12:132150840-132150862 CTCCAGCTTTGTGTCCGTGGGGG + Intronic
1106262280 13:28078186-28078208 CTTCAGCAGGGACTCTGTGTGGG + Intronic
1107678203 13:42818645-42818667 CGCCAGCAGGGACTCTGTGTGGG + Intergenic
1109091544 13:58052396-58052418 CTCCAGTAAGGACTCCGTGTGGG - Intergenic
1109512995 13:63404127-63404149 CCCCAGCAGGGACTCAGTGTGGG + Intergenic
1109810750 13:67509577-67509599 CTCCAGGAGGGACTCTGTGTAGG - Intergenic
1109862983 13:68224822-68224844 CCCCAGTAGTGTCTCTGTGTGGG + Intergenic
1110377886 13:74814681-74814703 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1111105707 13:83642767-83642789 CTCCAGTAGAGACTCTGTGTGGG + Intergenic
1112670529 13:101631492-101631514 CTTCTGCAGTTTCTCTGTGTGGG - Intronic
1113982283 13:114286576-114286598 CCCCAGCAGAGTCTCAGGGTTGG - Exonic
1115541743 14:34427464-34427486 CCCCAGTAGGGACTCCGTGTGGG - Intronic
1116195136 14:41715825-41715847 CTCCAGTAGGGACTCTGTGTGGG + Intronic
1117180234 14:53183815-53183837 CTCCAGTAGTGTCTCCAGCTGGG - Intergenic
1117186314 14:53244049-53244071 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1119963131 14:78882252-78882274 CCCCAGTAGGGACTCCGTGTGGG - Intronic
1120454686 14:84716672-84716694 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1121273558 14:92652956-92652978 CTCCTGCAGCATCTCCGTGCTGG - Exonic
1121881913 14:97508347-97508369 CTCCAGTAGGGACTCTGTGTAGG - Intergenic
1123574706 15:21655663-21655685 CTCCAGTAATCTCTCTGTGTTGG - Intergenic
1123611320 15:22098159-22098181 CTCCAGTAATCTCTCTGTGTTGG - Intergenic
1123724520 15:23088698-23088720 ATCCAGCCGGGTCTCCATGTTGG - Intergenic
1124374387 15:29121172-29121194 CCCCAGCAGTGCCTCCCTGTAGG - Exonic
1125682061 15:41537160-41537182 CTCCAGCAGTGTCTCCGTGTGGG + Exonic
1125881414 15:43199110-43199132 CCCCAGCAGGGACTCTGTGTGGG - Intronic
1127407908 15:58672214-58672236 CCCCAGCACTGTCTCCATGGAGG - Intronic
1128688805 15:69707601-69707623 CCCCAGTAGGGACTCCGTGTCGG + Intergenic
1133255311 16:4512919-4512941 CTGCAGCACTGTCACCGTGGTGG + Exonic
1134636294 16:15794504-15794526 CTCCAGCACTGGCTGTGTGTGGG + Intronic
1138024729 16:53513434-53513456 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
1142096539 16:88242981-88243003 CCGCATCAGTGTCTCCCTGTGGG - Intergenic
1143402866 17:6657298-6657320 CTGCAGCTGGATCTCCGTGTAGG + Intergenic
1144613468 17:16746467-16746489 CCCCAGCAGAGTCTCAGGGTTGG + Intronic
1145133137 17:20376542-20376564 CCCCAGCAGAGTCTCAGGGTTGG + Intergenic
1148243189 17:46013233-46013255 CTCCAGCAGTGGCCTTGTGTGGG - Intronic
1149204522 17:54228212-54228234 CTCCAGTAGGGACTCCATGTGGG - Intergenic
1151977565 17:77491098-77491120 CTCCAGCAGAGTCTCTGAGGGGG + Intronic
1152111389 17:78359442-78359464 CTCCAGGAGTGTGGCCGGGTGGG + Intronic
1152391643 17:80007252-80007274 CCCCAGCACGGTCTCCGGGTGGG + Intronic
1156498539 18:37542019-37542041 CTCCAGCAGTGGCACAGAGTGGG + Intronic
1156651139 18:39228263-39228285 CTCCAGTAGTGACTCTGTGTGGG - Intergenic
1156904424 18:42336779-42336801 CCTCAGCAGGGTCTCCGTGTGGG + Intergenic
1159896014 18:73996696-73996718 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1160231919 18:77055204-77055226 CTCCAGCACAGCCTCTGTGTGGG + Intronic
1161014505 19:1977095-1977117 ATCCAGCTGGGTCACCGTGTTGG - Intronic
1161316287 19:3619089-3619111 CTCCAGCAGGTCCTCCATGTCGG + Exonic
1163420571 19:17211724-17211746 CTCCAGCAGGCTCTCGGTGCTGG - Exonic
1165316583 19:35059960-35059982 CTCCAGCAGCCTCTGGGTGTGGG - Exonic
1165974754 19:39665950-39665972 CTCCAGTAGGGACTCTGTGTAGG + Intergenic
1166164924 19:40980684-40980706 CCCCAGCAGAGGCTCTGTGTGGG + Intergenic
924993673 2:338132-338154 CCCCAGTAGGGTCTCTGTGTGGG - Intergenic
926358984 2:12067477-12067499 CTCCATCAGTGTCTCCTCCTGGG + Intergenic
926401541 2:12502174-12502196 CCCTATCAGTGTCTCCGTGGAGG + Intergenic
927140787 2:20129537-20129559 CTCCAACAGTGACTCCCTTTTGG - Intergenic
927519786 2:23691799-23691821 CTCCAGCAGTGTCTTGGCGTTGG - Exonic
927921054 2:26971869-26971891 CTCCAGCTGTGTGTCTTTGTGGG + Intronic
929358147 2:41050955-41050977 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
934616604 2:95775124-95775146 CTCCAGAAGTGCCTCCCTCTAGG - Intergenic
934837702 2:97605525-97605547 CTCCAGAAGTGCCTCCCTCTAGG + Intergenic
935625945 2:105172419-105172441 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
935853544 2:107249175-107249197 CTCCAGCTGTGTCTCCCTCTGGG + Intergenic
940381321 2:153018045-153018067 CCCCAGTAGGGACTCCGTGTGGG + Intergenic
941137724 2:161738380-161738402 CTCCAGCACTGTCTCATGGTTGG + Intronic
941974503 2:171387981-171388003 CAGCAGCAGTGTCTGCGTGCTGG + Intronic
942419991 2:175797545-175797567 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
942519960 2:176793209-176793231 CTCCAGGAGTCTCTACGTCTTGG + Intergenic
943998095 2:194797262-194797284 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
945002034 2:205361947-205361969 CTCCTTCAGTGTCTCAGAGTTGG + Intronic
945377603 2:209097274-209097296 CTGCAGTAGTGTCTAGGTGTGGG - Intergenic
945713497 2:213330156-213330178 CTCCAGTAGGGACTCTGTGTGGG - Intronic
945977792 2:216284053-216284075 CTGCAGAAGTGTCTCCGTAAAGG + Intronic
948429696 2:237911713-237911735 CACCAGCAGGGTCACCGTGATGG - Exonic
1170310097 20:14982826-14982848 CTCCAGTAGGGACTCTGTGTGGG - Intronic
1172509614 20:35491243-35491265 CTGCAGCAGTGTCTCCAGGAGGG - Exonic
1173878087 20:46389158-46389180 ATCCAGCCGGGTCTCCATGTTGG + Exonic
1175291168 20:57876408-57876430 CTCCAGGTCTGTCTCTGTGTGGG + Intergenic
1175644486 20:60659187-60659209 GTCCAGCAGGGTCTCCGGTTTGG - Intergenic
1175675544 20:60943605-60943627 CCCCAGGAGTTTCTCTGTGTGGG - Intergenic
1177118128 21:17109927-17109949 CCCCAGTAGTGACTCTGTGTAGG + Intergenic
1177339746 21:19783778-19783800 CCCCAGTAGGGACTCCGTGTGGG + Intergenic
1177485061 21:21746182-21746204 CCCCAGTAGGGACTCCGTGTGGG - Intergenic
1177741160 21:25155048-25155070 CTCCAGTAGGGACTCCGTGTGGG - Intergenic
1178580297 21:33832305-33832327 CTCCAGCACTGGCCCCGTGCCGG + Intronic
1178940737 21:36902941-36902963 CTCCAGCAGTGTCTCATTTGTGG - Intronic
1179393432 21:41014995-41015017 CTCAAGTAGTCTCTCTGTGTTGG - Intergenic
1182271402 22:29156195-29156217 CTCCAGGAGTGGCTCAGGGTGGG - Intronic
1182942038 22:34286163-34286185 CCCTAACAGTGTCTCCTTGTTGG - Intergenic
1182957706 22:34442774-34442796 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1184424412 22:44400888-44400910 CTCCCTAAATGTCTCCGTGTGGG - Intergenic
1184507261 22:44911765-44911787 CCCCAGTAGAGACTCCGTGTAGG - Intronic
1185044712 22:48523178-48523200 CTCCAGCAGAGGCTCCGTGCAGG - Intronic
1185310603 22:50152223-50152245 CCCCAGCAGTGTCTCCCCGAGGG + Intronic
950448822 3:13054354-13054376 CTCCAGAAGTTTCTCTGTTTGGG + Intronic
950932259 3:16802131-16802153 CTCCAGCCCTGTCTTCGTGGTGG - Intergenic
951452181 3:22852210-22852232 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
951463575 3:22977361-22977383 CCCCAGCAGTGTATCTGAGTGGG - Intergenic
951865163 3:27299507-27299529 CCCCAGCAGGGACTCTGTGTGGG - Intronic
952105511 3:30065425-30065447 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
953503790 3:43463105-43463127 CTCCAGTAGAGACTCTGTGTGGG - Intronic
954093435 3:48302805-48302827 CTCCGTCAGTGATTCCGTGTAGG - Intergenic
956327501 3:68070083-68070105 CCCCAGCAGAGACTCTGTGTGGG + Intronic
957759238 3:84533362-84533384 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
957929779 3:86863173-86863195 CCCCAGTAGGGTCTCTGTGTGGG - Intergenic
958518662 3:95156264-95156286 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
958831795 3:99098911-99098933 CTCCAGTAGGGACTCTGTGTAGG - Intergenic
959624365 3:108432933-108432955 CCCCAGCAGGGACTCTGTGTGGG - Intronic
959815666 3:110670908-110670930 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
961383343 3:126509941-126509963 CTCCAGAAGCCTCTCCGTCTGGG + Intronic
961549140 3:127657452-127657474 CTCCCGCAGCTTCTCCCTGTTGG + Intronic
961556421 3:127699212-127699234 TTCCAGCACTGTCTCTCTGTGGG + Intronic
962448567 3:135492102-135492124 CTCCTGCAGTTTCTCCTTCTTGG - Intergenic
962661742 3:137608629-137608651 CTTCAGCAGTGTCTACATCTAGG + Intergenic
963363199 3:144303107-144303129 CCCCAGCAGAGACTCCGTATGGG + Intergenic
965013398 3:163125960-163125982 CCCCAGTAGTGACTCTGTGTGGG + Intergenic
965275455 3:166676942-166676964 CTCCAGCGGGGACTCTGTGTGGG + Intergenic
966891285 3:184409385-184409407 CACTTGCAGTGTCTGCGTGTAGG - Intronic
968274263 3:197427952-197427974 GTCCATCATTGTCTCCGAGTGGG - Intergenic
968568208 4:1326082-1326104 CCACAGCAGTGGCTCCGCGTGGG - Intronic
970306078 4:14733952-14733974 CTCCAGTAGGGACTCAGTGTGGG + Intergenic
970554194 4:17215027-17215049 CTGCAGCAGGGACTCTGTGTGGG + Intergenic
970937136 4:21586429-21586451 CTCCCCCAGTGTCTCCCTTTGGG + Intronic
970987611 4:22176615-22176637 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
973010774 4:45069920-45069942 CCCCAGCAGAGACTCTGTGTAGG - Intergenic
973585944 4:52391159-52391181 CTTCAGCAATGTCTCAGTATCGG - Intergenic
973712090 4:53640296-53640318 CTCTATCATTGTCTCCTTGTGGG - Intronic
974341112 4:60615995-60616017 CTCCAGTAGGGCCTCTGTGTGGG - Intergenic
974555807 4:63446035-63446057 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
974624863 4:64412109-64412131 TTCCAGTAGTGTCCCTGTGTAGG - Intergenic
975279221 4:72540950-72540972 CTCCAGTAGGGACTCTGTGTGGG - Intronic
976051145 4:81012578-81012600 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
977704043 4:100051929-100051951 CCCCAGTAGGGTCTCTGTGTGGG + Intergenic
978497808 4:109378625-109378647 CTCAAGCAATGTCTCTGTGGGGG + Intergenic
979500462 4:121434308-121434330 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
982843302 4:160219823-160219845 CTTCATCAGGGACTCCGTGTAGG + Intergenic
983068880 4:163245649-163245671 CTCTATCAGTGTGTCAGTGTAGG - Intergenic
984234751 4:177142414-177142436 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
986258684 5:6123785-6123807 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
989532590 5:42525057-42525079 CCCCAGCAGGGACTCTGTGTGGG - Intronic
990281645 5:54257772-54257794 CTCCAGCACTTTCTTTGTGTGGG - Intronic
991559732 5:67937168-67937190 CTCCACCAGTCTCTCCATGCTGG - Intergenic
994325659 5:98442297-98442319 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
995392384 5:111653310-111653332 CCCCAGTAGGGACTCCGTGTGGG + Intergenic
997243364 5:132324943-132324965 CACCAGCAGTGCCTCTATGTAGG - Intronic
997282311 5:132656651-132656673 CTCCCACAGGGTCTCCGTGATGG - Intronic
1002930700 6:1632906-1632928 CTCCAGCAATGCCGCCATGTTGG - Intronic
1003227976 6:4223585-4223607 CTCCAGGAGGGACTCCATGTGGG - Intergenic
1004497709 6:16180681-16180703 CTCCACCTGTGGCCCCGTGTAGG - Intergenic
1005175044 6:23035035-23035057 CTTCAGCAGTGTGTCCTTGACGG - Intergenic
1006207204 6:32357928-32357950 CCCCAGCAGTGTCTCTGGGGTGG + Intronic
1007287490 6:40758158-40758180 CTCCAGCAGAGGCTCCCTATGGG + Intergenic
1011378619 6:86718759-86718781 CCCCAGCAGGGACTCTGTGTGGG + Intergenic
1013884456 6:114945603-114945625 CCCCAGTAGGGACTCCGTGTGGG + Intergenic
1013910725 6:115272807-115272829 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1014103069 6:117533085-117533107 CTCCAGGAGTGTCTCCCACTTGG - Intronic
1015212356 6:130712648-130712670 CCCCAGCTGTGTCTCCTTGCAGG + Intergenic
1015232635 6:130933894-130933916 CACCATCACTGTCTCCGTGTAGG + Intronic
1016419983 6:143873452-143873474 CTCCACCAGGGACTCTGTGTGGG + Intronic
1018351048 6:162959476-162959498 CCCCAGCAGTGACTCCATGCTGG - Intronic
1019544180 7:1565242-1565264 CCCCACCAGTGTCTGCGTTTGGG - Intergenic
1022950954 7:35337442-35337464 CTCCAGCAGTTCCTCAGTTTGGG - Intergenic
1026461408 7:70618382-70618404 CTCCAGCAGTCTCTCCCTGGAGG + Intronic
1028790193 7:94844713-94844735 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1029707838 7:102285088-102285110 CTCCATCAGTTCCTCCTTGTGGG + Intronic
1030111729 7:106032499-106032521 CCCCAGCAGTGACTCTGCGTGGG - Exonic
1030220318 7:107091758-107091780 CTCCAGCAGTGGCTTCCTATGGG + Intronic
1030330026 7:108261014-108261036 CTCCATCAGTGTCCCCCTTTAGG - Intronic
1031301639 7:120068251-120068273 CCCCAGCAGGGACTCTGTGTGGG - Intergenic
1032396171 7:131591699-131591721 CTCCAGCAGTCTTTCCCAGTGGG - Intergenic
1035135403 7:156698367-156698389 CCCCAGTAGGGACTCCGTGTGGG + Intronic
1035853200 8:2942539-2942561 CACCAGCAGTGGCTCTGTGGCGG - Exonic
1037975661 8:23209326-23209348 CCCCAGTAGGGACTCCGTGTGGG - Intronic
1038347367 8:26744769-26744791 CTCCAGCACTCTCTCCTTTTTGG + Intergenic
1039365262 8:36922250-36922272 CTCCAGCAATGTCCCCTTGATGG + Intronic
1042057961 8:64786719-64786741 CCCCAGGAGTGACTCTGTGTGGG + Intronic
1043932142 8:86103541-86103563 CTCCAGCAGTGTCTTCAGGTAGG + Intronic
1048768293 8:137867902-137867924 CCCCAGCAATGACTCTGTGTGGG - Intergenic
1049217981 8:141416514-141416536 TTCCAGCAGCGTCTCCCTGAAGG - Intronic
1052701358 9:31941579-31941601 CCCCAGCAGGGACTCTGTGTCGG - Intergenic
1053246058 9:36535585-36535607 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1056256409 9:84803627-84803649 CTTCAGCAGTTTCACCTTGTGGG + Intronic
1056813143 9:89779982-89780004 CCCCACCAGAGTCTCCCTGTGGG - Intergenic
1057997565 9:99832782-99832804 TTTCAGAAGTGTCTCAGTGTTGG + Exonic
1058383153 9:104401800-104401822 CTCCAGCTGAATCTCAGTGTTGG + Intergenic
1059170582 9:112120921-112120943 CTCCAGCAGTTGTTCTGTGTCGG + Intronic
1059986317 9:119823814-119823836 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1061541663 9:131280771-131280793 CTGCTGCAGTGTCTCCTTGCAGG + Intergenic
1062044398 9:134418374-134418396 CTTCATCTGTGTCTCCGTGTGGG + Intronic
1062131004 9:134893084-134893106 CCCCAGCAGTGTTTCCATCTTGG - Intergenic
1188449604 X:30295187-30295209 CTCCAGTAGGGACTCTGTGTGGG - Intergenic
1190056947 X:47186544-47186566 CTTGTGCAGTGTCTCCTTGTAGG - Exonic
1191894763 X:65980352-65980374 TTCCATCTGAGTCTCCGTGTAGG - Intergenic
1192528004 X:71864169-71864191 CTTCAGCAGATTCTCCATGTTGG - Intergenic
1193707855 X:84844759-84844781 CTCCAGTAGGGACTCTGTGTGGG + Intergenic
1194662140 X:96639318-96639340 CCCCAGTAGGGTCTCTGTGTGGG - Intergenic
1195074637 X:101314725-101314747 TTCCAGCAATGACTCCCTGTTGG + Intergenic
1196261050 X:113581908-113581930 CTCAAGCAGTGTCCCCATCTTGG - Intergenic
1196285229 X:113871757-113871779 CTCCAGTGGGGACTCCGTGTGGG - Intergenic
1199243499 X:145575417-145575439 CCCCAGTGGTGACTCCGTGTGGG - Intergenic