ID: 1125686917

View in Genome Browser
Species Human (GRCh38)
Location 15:41568875-41568897
Sequence CAGGATGAGCTGACAGTGGA GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 281
Summary {0: 1, 1: 1, 2: 2, 3: 23, 4: 254}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125686901_1125686917 21 Left 1125686901 15:41568831-41568853 CCTTCTCCCCAGGCTCACTATGG 0: 1
1: 0
2: 1
3: 32
4: 260
Right 1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG 0: 1
1: 1
2: 2
3: 23
4: 254
1125686910_1125686917 13 Left 1125686910 15:41568839-41568861 CCAGGCTCACTATGGGGTGGGGG 0: 1
1: 0
2: 2
3: 26
4: 178
Right 1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG 0: 1
1: 1
2: 2
3: 23
4: 254
1125686908_1125686917 14 Left 1125686908 15:41568838-41568860 CCCAGGCTCACTATGGGGTGGGG 0: 1
1: 0
2: 2
3: 29
4: 231
Right 1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG 0: 1
1: 1
2: 2
3: 23
4: 254
1125686906_1125686917 15 Left 1125686906 15:41568837-41568859 CCCCAGGCTCACTATGGGGTGGG 0: 1
1: 0
2: 1
3: 17
4: 305
Right 1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG 0: 1
1: 1
2: 2
3: 23
4: 254

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125686917 Original CRISPR CAGGATGAGCTGACAGTGGA GGG Exonic
900552692 1:3264584-3264606 CAGGAGGAGCGGAAAGGGGAGGG + Intronic
901061087 1:6472198-6472220 CAGAGTGAGCTGGCAGTGTAGGG - Intronic
901642374 1:10699195-10699217 GAGGATGAGCTGGAAGTGCAGGG - Intronic
902449269 1:16486306-16486328 CTGGCTGAGCTCACAGAGGAAGG + Intergenic
902468668 1:16633021-16633043 CTGGCTGAGCTCACAGAGGAAGG + Intergenic
902505476 1:16936971-16936993 CTGGCTGAGCTCACAGAGGAAGG - Intronic
902655348 1:17864071-17864093 CTGGATGAGGTGACAGTGGATGG + Intergenic
904089653 1:27935854-27935876 CAGGAAGAGAGGACAGTGCACGG + Intronic
904983360 1:34524867-34524889 GAGGATGGCCAGACAGTGGATGG - Intergenic
908814899 1:68021736-68021758 CATGATGAGATGAGATTGGAGGG - Intergenic
909290558 1:73878052-73878074 CAGGCAGAGCTGACTATGGAAGG + Intergenic
910349592 1:86280579-86280601 TATGATCAGCTGACAGAGGAAGG + Intergenic
911258520 1:95660530-95660552 CAGGATGAGCTAAAAGGAGATGG - Intergenic
911957602 1:104258083-104258105 CAAGATGAGCTGAGAGCTGAGGG + Intergenic
912996313 1:114535683-114535705 GAGGTTGAGCTGACAATGCATGG - Intergenic
915074579 1:153297843-153297865 AAGGATGGGCTGGCAGGGGAGGG + Exonic
915930030 1:160054665-160054687 CAGGCAGAGCTGACACAGGAAGG - Intronic
916140293 1:161691498-161691520 CATGGTGAGCTGAGAGTTGAAGG + Intergenic
916450375 1:164915075-164915097 CCAGAGGAGCTGACAGTAGAGGG - Intergenic
917732023 1:177884069-177884091 CTGCATGAGCTGTCAGTGCAAGG - Intergenic
917793455 1:178514521-178514543 CAAGATGAGCTGAAAGAGGGAGG + Intronic
918006824 1:180548991-180549013 CAGGAGGAGTTGAAAGTGGATGG - Intergenic
918122810 1:181554650-181554672 CAGGATGATCAAACAGTGCATGG - Intronic
919117773 1:193302482-193302504 TAGGAAGAGCTGACTATGGAAGG + Intergenic
919919983 1:202161886-202161908 CAGGATCAGCTGGCCATGGAGGG - Intergenic
924775674 1:247113223-247113245 CAGGAGGGTCTGACAGTAGAGGG - Intergenic
1063134816 10:3207502-3207524 CAGGATGAACTGACCGGGGGAGG - Intergenic
1063666039 10:8061323-8061345 CTCGATCAGATGACAGTGGAGGG - Intronic
1064213884 10:13383570-13383592 CAGGAGGACCTGAGAGTGGCCGG + Intergenic
1065749628 10:28873968-28873990 CAGGCTGAGATGACAGTAGCTGG + Intronic
1065792637 10:29275505-29275527 TAGGATGAGCTGATGATGGAAGG - Intergenic
1069667388 10:70172009-70172031 CAGGATGAGCGGAGGGTAGAGGG - Intergenic
1069749402 10:70735868-70735890 CAGGCTGAGCTGTCAGAGAATGG + Intronic
1070544310 10:77440683-77440705 CAGAATGAGCTCACGGTAGAGGG - Intronic
1073894370 10:108137451-108137473 CTGGAAGAGCTGACAGCTGAAGG + Intergenic
1074907611 10:117878885-117878907 AGGGAGGAGCTGACAGAGGAAGG - Intergenic
1075640500 10:124060930-124060952 CAGGATGAGCTGCCATTTTATGG + Intronic
1076442216 10:130487833-130487855 CTGGAGGAGCTGACAGTGCGAGG + Intergenic
1076823808 10:132957259-132957281 CAGGCTGCGCTGGCAGTGGCCGG + Intergenic
1076865260 10:133163457-133163479 CAGGATGAGCTCAGAGCAGAAGG + Intronic
1078846924 11:15126884-15126906 CAGAAAGAGCTGCCTGTGGATGG + Intronic
1080229352 11:30001190-30001212 CAAGAGGAGCTGACAGAGGCAGG - Intergenic
1080534248 11:33206178-33206200 AAGGATGGGCTGGGAGTGGAGGG - Intergenic
1081058358 11:38439496-38439518 CATGACGAACTGAAAGTGGAAGG + Intergenic
1084519956 11:69657051-69657073 CAGGGAGAGCTGACTGCGGAAGG - Intronic
1085279282 11:75319751-75319773 CAGGAGGAGCAGACAGGGAAAGG + Intronic
1086426058 11:86683323-86683345 CAGGATGAGGGGAAAGAGGAAGG + Intergenic
1086453350 11:86938501-86938523 CAGGAGGAGCTGGAAGTGGCTGG + Intronic
1087418043 11:97883735-97883757 CAGCATCAGCTTACAGTGCATGG + Intergenic
1087508439 11:99058610-99058632 CAGGAGGAGCTGAGAATGCAGGG - Intronic
1091074917 11:132606525-132606547 CAGGAAGAGCTGACCCAGGAGGG + Intronic
1091406271 12:211419-211441 TGGGCTGAGCTTACAGTGGAAGG - Intronic
1093524959 12:20094932-20094954 CTAGATGAGCTGACAGATGAAGG - Intergenic
1093797276 12:23327383-23327405 CAGGAAGAGCTCCTAGTGGAGGG - Intergenic
1094855552 12:34401260-34401282 CAGGAAGAGTTGAAAGGGGAGGG + Intergenic
1096193245 12:49633413-49633435 CAGGAGCAGCTGCAAGTGGATGG - Exonic
1098476225 12:70907379-70907401 TATGCTGGGCTGACAGTGGAAGG - Intronic
1099312336 12:81042571-81042593 CACGATGAACTGAAAGTTGAAGG - Intronic
1100980045 12:100156592-100156614 CAGGTTTTGCTGACAGTGGCCGG + Intergenic
1104765781 12:131329365-131329387 CAAGCTGCGCTCACAGTGGACGG + Intergenic
1104813486 12:131632497-131632519 CAAGCTGCGCTCACAGTGGACGG - Intergenic
1106942597 13:34794576-34794598 CAGGATGAGGGGTCAGTGGATGG - Intergenic
1107920997 13:45207420-45207442 CAAGATAAGCTGTCATTGGAAGG + Exonic
1108747301 13:53408889-53408911 CAGGAGGAGAGGACAGTGGCAGG - Intergenic
1108934547 13:55868692-55868714 CAGAAGCAGTTGACAGTGGAAGG - Intergenic
1110375364 13:74787279-74787301 CAGGATGAGGTGACTGTAGCTGG - Intergenic
1112484791 13:99810554-99810576 CAGGATGAGCCTAGAGAGGAAGG + Intronic
1114184649 14:20391249-20391271 CAGGAGGAGCTGACTGTGGAGGG + Intronic
1114248280 14:20934736-20934758 GAGGATAAGGTGGCAGTGGAGGG - Intergenic
1118450907 14:65901407-65901429 CAGGTTGAGCTGGCAGTTGATGG + Intergenic
1121628978 14:95408939-95408961 CAGGATGAGGTCCCAGGGGACGG - Intronic
1122251307 14:100441735-100441757 CAGGATGAAATGACAGTAGGAGG + Intronic
1122886065 14:104710961-104710983 CAGGATCAGCTGGCAGAAGATGG - Exonic
1123008144 14:105334192-105334214 CAGGAGGAGGTGTCAGGGGAAGG - Intronic
1125201552 15:37104596-37104618 CAGAAGGAGCTGACTGTTGACGG - Intergenic
1125342495 15:38688677-38688699 TAGGCTGAGCTGACATTGGGAGG + Intergenic
1125686917 15:41568875-41568897 CAGGATGAGCTGACAGTGGAGGG + Exonic
1126130104 15:45332724-45332746 GAGGATACGCTGACAGTTGAAGG - Intergenic
1126704108 15:51391776-51391798 CAGCCAGTGCTGACAGTGGAGGG + Intronic
1126908127 15:53389397-53389419 CAGGCTGAGGAGAGAGTGGAAGG + Intergenic
1127595177 15:60474340-60474362 TAGGATAAACTGTCAGTGGAGGG - Intronic
1127772437 15:62242725-62242747 CAGGCTTTGCTGACAGTGGCTGG + Intergenic
1128367972 15:67018223-67018245 AAGGAAGAGCTGCCAGGGGAAGG - Intergenic
1129167804 15:73788662-73788684 TAGAATGAGCTGGCAGGGGAGGG + Intergenic
1129530438 15:76260580-76260602 CAGGATGAGCTGACAATGGAGGG - Intronic
1130220531 15:82015589-82015611 CAGGATGAGCTGAGAGATTAAGG + Intergenic
1130948101 15:88564427-88564449 TAGGGTGAGATGACAATGGAAGG - Intergenic
1131202127 15:90408041-90408063 CAGGATAAGCTGACATTGTATGG + Intronic
1131400780 15:92124045-92124067 CAGGAGGGGCTGGCAGTGGGCGG + Intronic
1133732665 16:8590074-8590096 CAGGTAGAGCTGGCATTGGAGGG - Intergenic
1135251138 16:20901418-20901440 CCGGATGAGGTGACAGAAGATGG + Intronic
1135715126 16:24757667-24757689 AAGGAAGAGCAGACATTGGAAGG + Intronic
1137410967 16:48227828-48227850 CATCATGGACTGACAGTGGAGGG + Exonic
1137728161 16:50670732-50670754 CAGGAGGAGCTGGCTGTGGCAGG + Intronic
1139587714 16:67914902-67914924 CAAGATACGCTGACAGAGGAAGG + Intronic
1140768035 16:78178100-78178122 CAGGAAGTGCTGACAGTGAAGGG + Intronic
1141993379 16:87622666-87622688 CAGGAGGAGCTGAGGGTGCATGG + Intronic
1143054433 17:4152291-4152313 CAGAATGAGCTAACAGGGGCAGG - Intronic
1143922248 17:10339296-10339318 CAGGATGAAGTGACAGTTAAAGG + Intronic
1144097596 17:11915726-11915748 CAGGATGAGTAGGCATTGGATGG - Intronic
1145982492 17:29021372-29021394 CAGGATAAGCTGATAAAGGAAGG - Intronic
1146512820 17:33465077-33465099 CAGGAGGAGCTGACAGTTCCTGG + Intronic
1146535447 17:33646884-33646906 CTGGGGGAGCTGACAGTGAATGG + Intronic
1147262182 17:39214995-39215017 CGGGATGAGCTGACCGAGGATGG - Exonic
1147978238 17:44259972-44259994 CAGGCTGAGCTATCAGTGGTGGG + Intronic
1148742697 17:49901882-49901904 CAGGAGGAGCAGACTGTGGTTGG - Intergenic
1148759941 17:49994422-49994444 CGGGATGAGCTGAGAGAGGAAGG - Intronic
1148795568 17:50195117-50195139 GAGGATGAGCTGAGAGTCGGGGG + Intronic
1149317814 17:55455451-55455473 AAGGCTAAGGTGACAGTGGATGG - Intergenic
1150381606 17:64724675-64724697 CAGCATGGGCTGACATTTGAAGG - Intergenic
1150774727 17:68070563-68070585 CAGCATGGGCTGACATTCGAAGG + Intergenic
1151160781 17:72163702-72163724 CAGGATAAGCTGAAGGTGGGTGG - Intergenic
1151668453 17:75558649-75558671 CAGGCTGGGCTGGGAGTGGAAGG - Intronic
1152426337 17:80220539-80220561 CAGGGGGAGCGGACAGTGGCCGG + Intronic
1155544456 18:26901265-26901287 CAGGATGAGGTTCAAGTGGAAGG - Intergenic
1160448773 18:78947577-78947599 ACGCCTGAGCTGACAGTGGAGGG + Intergenic
1160566838 18:79791158-79791180 CAGGAGGAGCTGACACTGTCGGG + Intergenic
1160696216 19:485842-485864 GAGCATGAGCTGACCCTGGACGG - Intergenic
1161063286 19:2225951-2225973 CAGGATGAGATGGCAGGGGACGG - Intronic
1161589741 19:5123976-5123998 CAGGATGGGCTGGCAGGGGTGGG + Intronic
1163591124 19:18194697-18194719 CAAGATGGGCTGACGATGGAGGG - Intronic
1163695797 19:18762661-18762683 CAGGGAGAGCTGCCAGGGGAGGG - Intronic
1165858289 19:38893443-38893465 CTGGACGAGCTGACCTTGGAAGG - Exonic
1165935341 19:39385349-39385371 CAGGGTGAGCTGACTGTGCCTGG + Intronic
1166308199 19:41947169-41947191 CAGTTTGAGCTGACAGTGATTGG - Intergenic
1168244770 19:55106726-55106748 CAAGATGAGGTCACAGGGGAAGG - Intronic
925128132 2:1476316-1476338 GAGGAAGAGCTGACAGGGAAAGG + Intronic
925585725 2:5462097-5462119 CAGGATGAGCTGAAGGTGGGAGG + Intergenic
927291827 2:21412326-21412348 CAGGGTGAGCTTCAAGTGGAAGG - Intergenic
927697502 2:25247971-25247993 CGGGAGGAGCTGGCAGTGGAAGG + Intronic
928128759 2:28633970-28633992 CTGGATGAGCTGACAGGGGTGGG - Intronic
928358700 2:30645447-30645469 CAGGATGAACTGACGCTGGATGG + Intergenic
935268895 2:101416695-101416717 CAGGATGATCCGACAGGGCATGG + Intronic
935312074 2:101794133-101794155 AAGGATGTGCTCAAAGTGGATGG + Intronic
937073847 2:119086712-119086734 CAATTTGAGCTGTCAGTGGAGGG + Intergenic
937126534 2:119478387-119478409 CAGCAGGGCCTGACAGTGGAAGG + Intronic
938550963 2:132382192-132382214 CAGAATGAGAGGTCAGTGGATGG + Intergenic
939017594 2:136920280-136920302 CAGGACGACCTGCCTGTGGAAGG - Intronic
940885293 2:158984688-158984710 GAGGAGGAGTTGACAGTGGCTGG + Intronic
943384516 2:187184888-187184910 CAGGATCAGCTGGCAGAGAAAGG - Intergenic
945845078 2:214934668-214934690 AAGGATGAGCTGTCATTTGAAGG - Intronic
945907683 2:215613511-215613533 CAGGATCAGCTCACAGTCAAGGG - Intergenic
946419336 2:219556241-219556263 CAGGATGTGCGGGCAGAGGAAGG - Exonic
947320474 2:228911988-228912010 AAGGATGTGCTCACAGAGGAGGG + Intronic
948148945 2:235729437-235729459 CAGGCTGAGCTGACCCTGCAAGG - Intronic
948266480 2:236638763-236638785 CAGCATGAGTTGAGAGTGCAGGG - Intergenic
1168769127 20:403079-403101 CAGGATGCGCTCACAGGGGAGGG + Intergenic
1169060196 20:2655446-2655468 CTGGAGGAGCTGACAATGGATGG + Exonic
1169907004 20:10614465-10614487 CAGGATGAGCTGGGATTGGCTGG + Intronic
1170212961 20:13863404-13863426 GGGGATCAACTGACAGTGGAGGG + Intronic
1172274839 20:33673896-33673918 CAGGCTGGGCTGACTGGGGAAGG - Intronic
1172511466 20:35503983-35504005 GAGGAAGAGCTGGCAGTGGAGGG + Exonic
1172813594 20:37669286-37669308 CAGGCTGAGCACTCAGTGGATGG + Intergenic
1172880029 20:38193872-38193894 CAGGCTGAGCTGGCAGAGGGAGG - Intergenic
1174130806 20:48342153-48342175 CTGGAGGAGCAGACAGTGCAGGG - Intergenic
1175297434 20:57918661-57918683 CAGGCTGAGCTGACTCTGCATGG - Intergenic
1175415896 20:58800736-58800758 GCGAATGAGCAGACAGTGGACGG - Intergenic
1175461416 20:59154475-59154497 CAGGATGGGAGGAAAGTGGAAGG - Intergenic
1178660005 21:34499351-34499373 CAGGATGGGCAGACAGGGAAGGG - Intergenic
1179710156 21:43208704-43208726 CAGGAAGTGCGGACAGTGGGAGG + Intergenic
1180984608 22:19897035-19897057 GAGGGTGAGCTGGCAGTGGACGG - Intronic
1181161540 22:20962855-20962877 CAGGAGAACCTGACAGTAGAGGG + Intergenic
1182722431 22:32414320-32414342 CCTGATAAGCAGACAGTGGAGGG - Exonic
1182756935 22:32687911-32687933 CAGGATGACCTGACCTGGGATGG - Intronic
1182871357 22:33650520-33650542 CAGGCTGAGCTGCCTGCGGAGGG + Exonic
1183367145 22:37412828-37412850 CAGGATGAGCTTAGAGTGCCGGG - Intronic
1185044376 22:48521868-48521890 CAGGATGAGCTTCATGTGGAGGG + Intronic
950644910 3:14371361-14371383 AAAGATGAGCCGATAGTGGAAGG - Intergenic
950703652 3:14767032-14767054 CAGGAGGATGTGACAATGGAGGG - Intronic
951072535 3:18349204-18349226 GAAGAAGAGCTGTCAGTGGAAGG - Exonic
952259183 3:31723180-31723202 CAGGCTTAGCTGGCTGTGGATGG + Intronic
953478459 3:43227005-43227027 CATGAGGAGCTCACAGTGTAGGG + Intergenic
955948332 3:64217014-64217036 CTGGATAAGCTGTCAGGGGAAGG + Intronic
957636383 3:82790956-82790978 TAGGATGACCTGCCTGTGGAGGG + Intergenic
958616577 3:96500771-96500793 CATGATGAACTGAAAATGGAAGG + Intergenic
958985481 3:100775778-100775800 CAATAAGAGCTGAGAGTGGAAGG + Intronic
959670359 3:108970487-108970509 GAGGATGAGGTGAGAGTAGAGGG + Intronic
960823969 3:121763095-121763117 AAGGATGAACTGACAGTTGAAGG - Intergenic
961001150 3:123374915-123374937 CATGATGAGCTCACACTGAAGGG + Intronic
966005211 3:175002557-175002579 CACAATGAGCTGAAAATGGAAGG + Intronic
966700206 3:182841027-182841049 CAGGATGAGCTAGAGGTGGAAGG - Intronic
966703222 3:182879518-182879540 CAGCATGGGCTGGTAGTGGATGG + Exonic
967123107 3:186401265-186401287 CAGGACGAGGTCACAGTGGGAGG - Intergenic
967295595 3:187961640-187961662 CATGAAGAGCTGACTGTAGAGGG + Intergenic
967852708 3:194094077-194094099 AGGGATGAGCTGACTGTGGGAGG - Intergenic
968040860 3:195588177-195588199 CAGGAAGAACTGCCAGTGCAGGG + Intergenic
968450966 4:675764-675786 CAGGCTGATCTGAAAGTGGGTGG - Intronic
968530271 4:1087417-1087439 CAGGATGGGGTGACAGTGATAGG + Intronic
968621725 4:1606398-1606420 CGGGAAGAGCTTACCGTGGAGGG - Intergenic
969302258 4:6304035-6304057 CAGGATGAGAGGACAGTGTCGGG - Intergenic
970372725 4:15424295-15424317 CAAGAGGAGCTGAAAGTGAAAGG - Intronic
972285750 4:37646412-37646434 CAGCAGCAGCTGCCAGTGGACGG + Intronic
972314819 4:37916561-37916583 CAGGATGGGCTGAAAGTGCTTGG + Intronic
975293045 4:72699910-72699932 CAGGCTGAGGTGGAAGTGGAAGG - Intergenic
975446038 4:74466695-74466717 CAGGAAGAACCGAGAGTGGAAGG - Intergenic
976042051 4:80898427-80898449 CAGGTTCAGCTGGCAGAGGAAGG - Intronic
977722902 4:100261798-100261820 CAAGATGGGGTCACAGTGGAAGG + Intergenic
982489129 4:156006508-156006530 CAGGTTGATCTGGCAGTTGATGG - Intergenic
983612069 4:169657669-169657691 CAAGTTGAGATTACAGTGGAGGG + Intronic
983626753 4:169809394-169809416 CAGGAAGTACTGCCAGTGGAAGG - Intergenic
985426089 4:189832078-189832100 CTGGATGAGCTCACAGCTGATGG - Intergenic
987577116 5:19744008-19744030 GAGGATGATATGAAAGTGGAGGG - Intronic
987978400 5:25046180-25046202 CAGATTGAGCTGACAGAGGTTGG - Intergenic
988578136 5:32445609-32445631 CAGGAAGAGCAGCAAGTGGAAGG + Intergenic
988907334 5:35802853-35802875 CAGGATGAGAAGTCATTGGAAGG + Intronic
993080092 5:83285856-83285878 GAGGGTGAAGTGACAGTGGAGGG - Intronic
993168465 5:84385036-84385058 CAGAAGGAGCTGAAAGAGGAGGG - Intergenic
994944196 5:106364060-106364082 CATGATGAGCTGAAAATAGAAGG - Intergenic
996099892 5:119435525-119435547 AGGGATGAGCTGTCAATGGAAGG + Intergenic
997781784 5:136667053-136667075 CAGGATGGGCTGAGAGCCGAGGG + Intergenic
999410158 5:151343539-151343561 CAGGATGTGCATACAGTGGCAGG + Exonic
999531789 5:152471210-152471232 CAGGATGAAATTGCAGTGGAGGG + Intergenic
1000385849 5:160674133-160674155 CAGGATTTGCTCAGAGTGGAAGG - Intronic
1002143663 5:177161420-177161442 CAGGAAGGGATGACATTGGAGGG + Intronic
1002386943 5:178875421-178875443 CAGGAGGAGCTGGCAGGGGAAGG + Intronic
1002786361 6:403269-403291 CAGGAGATGCTGACAGGGGAGGG - Intronic
1003271458 6:4611385-4611407 CAGCATGAGCACACAGAGGAGGG - Intergenic
1003365132 6:5466624-5466646 GAGAATGAGCTCTCAGTGGATGG - Intronic
1003852398 6:10238681-10238703 CTGGATTGGCTGAGAGTGGAGGG - Intergenic
1005893928 6:30162454-30162476 CAGGAAGAGCAGAGATTGGATGG + Intergenic
1006923799 6:37643235-37643257 CAGGATGAGATGGAAGTGGAGGG - Intronic
1007116934 6:39349485-39349507 TAGGCAGAGCTGACAGTGGAGGG + Intronic
1008141893 6:47841386-47841408 TAGGAAGAGCTGACAGAGGCAGG + Intergenic
1010383400 6:75249715-75249737 AAGAATGAGGTAACAGTGGAAGG + Intronic
1011480670 6:87790583-87790605 GAGGAAGAGCTGAATGTGGAGGG + Intergenic
1015462323 6:133505591-133505613 CAGGAAGAGCTGGCAGAGGATGG - Intronic
1015854928 6:137613765-137613787 CAAAATGAGCTGACAGAGGCAGG - Intergenic
1016713567 6:147199797-147199819 TAGGAAGAACTGACAGTAGAAGG + Intergenic
1017032498 6:150236575-150236597 GAGGAGGAGCTGAAAGCGGAGGG + Intronic
1019917802 7:4144651-4144673 CAGGAAGAGCTGAGAGAGGGAGG + Intronic
1021523876 7:21564928-21564950 CAGGATGAGGACACAGAGGAAGG - Intronic
1022957782 7:35397325-35397347 CAGGGTGAGGGGACAGAGGATGG - Intergenic
1023842249 7:44104251-44104273 AAGGAGGAGCCGAGAGTGGACGG - Intergenic
1024034255 7:45494446-45494468 ATGGATGAGCTGACAGAAGAAGG - Intergenic
1024610462 7:51059738-51059760 CAGGATGAGGGAACAGTGGCGGG - Intronic
1026405793 7:70064240-70064262 CAGGTTTAGCTGACAGTGCCAGG - Intronic
1027151721 7:75738498-75738520 CAAGATGAGGTGAGAGGGGAAGG - Intronic
1027555514 7:79659928-79659950 CAGGATCAGATGACACAGGAAGG - Intergenic
1028348375 7:89812538-89812560 CAAGATGAGCTGGCAGTCTATGG + Intergenic
1029689398 7:102170957-102170979 CAGGATGAGCTGGGAGGGTAGGG + Intronic
1030247688 7:107402702-107402724 CAGGAAGAGCTGCAGGTGGATGG + Intronic
1033097521 7:138443744-138443766 CTGGTTTAGCTGACAGTTGAGGG + Intergenic
1033309006 7:140246025-140246047 CAGGATGAGGGGTCAGTGGATGG - Intergenic
1034411622 7:150945265-150945287 CAGGAGGCCCTGACCGTGGAAGG - Exonic
1035677329 8:1464663-1464685 CAGGAAGAGCTGTCAGGGGCTGG + Intergenic
1036209327 8:6829262-6829284 CAGCATGAGATGACAGAAGAAGG - Intronic
1040518050 8:48150526-48150548 CAGAATGAGCAGACAGATGAGGG - Intergenic
1042910139 8:73817921-73817943 CAGCAGGAGATGAGAGTGGAAGG - Intronic
1044610096 8:94082973-94082995 CAGGATGAGATGGCATTGCAAGG - Intergenic
1047517844 8:125570374-125570396 CAGGATGACCAGACAATAGAAGG + Intergenic
1048296328 8:133217313-133217335 CAGCGTGAGCTGACAGTCCATGG + Intronic
1048867997 8:138774909-138774931 CAGGATGATGTGGCTGTGGAGGG + Intronic
1049255681 8:141612418-141612440 CAGGAGGAGCTCAGAGGGGAGGG - Intergenic
1049378905 8:142302369-142302391 CAGGAGGATCTGACAGAGGTGGG + Intronic
1049445133 8:142626582-142626604 TATGAAGCGCTGACAGTGGAAGG - Intergenic
1051443296 9:17111661-17111683 CAGGATGGGCTGACTGGTGAAGG - Intergenic
1051474746 9:17493561-17493583 CAGAATGAGGTGACATAGGATGG - Intronic
1052234177 9:26189456-26189478 CTGGATGAGCTGAATGTTGAAGG + Intergenic
1053315874 9:37051506-37051528 CAGTATCAGCTGCAAGTGGAGGG + Intergenic
1054981837 9:71215823-71215845 CAGGATGAACAGACAGTTCAGGG + Intronic
1055566437 9:77573588-77573610 CATGATGGTGTGACAGTGGAAGG + Intronic
1056191689 9:84190541-84190563 CAGTATGAGATGAGGGTGGAAGG - Intergenic
1060239452 9:121890322-121890344 CATGATGAGCTGACAAGTGATGG - Intronic
1062027268 9:134346384-134346406 CTGGATGAGCCGACAGCCGAGGG - Intronic
1062093115 9:134688955-134688977 CATGACCAGCTGACAGTGCAGGG - Intronic
1186531303 X:10298557-10298579 CAGGATTAGTTCACTGTGGATGG + Intergenic
1187236030 X:17468393-17468415 AATGATGAGCTGAGAGTGAATGG - Intronic
1187660498 X:21541413-21541435 CAGTATGGACTGACAGTAGATGG + Intronic
1189130712 X:38495311-38495333 CAAAGGGAGCTGACAGTGGATGG - Intronic
1189318111 X:40069974-40069996 AGGGATGAGCTGGAAGTGGAGGG + Intronic
1189351560 X:40279517-40279539 TATGATGGGCTGAAAGTGGAGGG + Intergenic
1190635051 X:52425106-52425128 CAGGATAAGCTGTTAGTTGATGG - Intergenic
1190999720 X:55647154-55647176 CAGGATGAGCTGTTAGTTGATGG + Intergenic
1194020293 X:88681839-88681861 CAGGGTGAGCTGATAGAGCACGG + Intergenic
1195022594 X:100844901-100844923 AGGGATAAGCTCACAGTGGATGG - Intronic
1195146073 X:102018537-102018559 GAGGATATGCTGACAGTTGAAGG + Intergenic
1195989894 X:110672064-110672086 CAGGAGGAACAGACAGAGGAGGG + Intergenic
1196862447 X:120040835-120040857 CAGGAGGAGGTGACAGGGAAGGG + Intergenic
1196880655 X:120195509-120195531 CAGGAGGAGGTGACAGGGAAGGG - Intergenic
1197748951 X:129952140-129952162 CAGAAAAGGCTGACAGTGGAAGG - Intergenic
1199807585 X:151315765-151315787 CAGAACGATCTGAGAGTGGAAGG - Intergenic