ID: 1125688884

View in Genome Browser
Species Human (GRCh38)
Location 15:41580590-41580612
Sequence GAAAATGCAAATATTCAGCT GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 2855
Summary {0: 1, 1: 1, 2: 3, 3: 136, 4: 2714}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125688879_1125688884 10 Left 1125688879 15:41580557-41580579 CCACCACCTAGAGATAATCACCA 0: 1
1: 1
2: 9
3: 45
4: 234
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714
1125688880_1125688884 7 Left 1125688880 15:41580560-41580582 CCACCTAGAGATAATCACCATTG 0: 1
1: 0
2: 4
3: 29
4: 173
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714
1125688876_1125688884 26 Left 1125688876 15:41580541-41580563 CCAGTTACCTATACTCCCACCAC 0: 1
1: 0
2: 0
3: 10
4: 189
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714
1125688881_1125688884 4 Left 1125688881 15:41580563-41580585 CCTAGAGATAATCACCATTGATC 0: 1
1: 0
2: 1
3: 23
4: 182
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714
1125688878_1125688884 11 Left 1125688878 15:41580556-41580578 CCCACCACCTAGAGATAATCACC 0: 1
1: 2
2: 17
3: 70
4: 254
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714
1125688882_1125688884 -10 Left 1125688882 15:41580577-41580599 CCATTGATCTTTTGAAAATGCAA 0: 1
1: 1
2: 5
3: 65
4: 517
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714
1125688877_1125688884 19 Left 1125688877 15:41580548-41580570 CCTATACTCCCACCACCTAGAGA 0: 1
1: 0
2: 11
3: 134
4: 3723
Right 1125688884 15:41580590-41580612 GAAAATGCAAATATTCAGCTGGG 0: 1
1: 1
2: 3
3: 136
4: 2714

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125688884 Original CRISPR GAAAATGCAAATATTCAGCT GGG Exonic
Too many off-targets to display for this crispr