ID: 1125700723

View in Genome Browser
Species Human (GRCh38)
Location 15:41680946-41680968
Sequence GTGCCATCCTGGATCTATTT AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 114}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125700718_1125700723 17 Left 1125700718 15:41680906-41680928 CCCAGTTCTTTAATCACAGTGTT 0: 1
1: 0
2: 4
3: 22
4: 268
Right 1125700723 15:41680946-41680968 GTGCCATCCTGGATCTATTTAGG 0: 1
1: 0
2: 0
3: 11
4: 114
1125700719_1125700723 16 Left 1125700719 15:41680907-41680929 CCAGTTCTTTAATCACAGTGTTG 0: 1
1: 0
2: 1
3: 16
4: 228
Right 1125700723 15:41680946-41680968 GTGCCATCCTGGATCTATTTAGG 0: 1
1: 0
2: 0
3: 11
4: 114

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125700723 Original CRISPR GTGCCATCCTGGATCTATTT AGG Intronic
900491555 1:2951792-2951814 GAGCCTTCCAAGATCTATTTTGG + Intergenic
906606779 1:47178223-47178245 GTACCAGCCTGGATCTCTTGAGG - Intergenic
910847958 1:91621749-91621771 TTGCCATCCTAGATATATTGGGG - Intergenic
915096514 1:153466435-153466457 GCCCCATCCTGAAGCTATTTAGG - Intergenic
916299701 1:163259978-163260000 GTGCCCTCAGGGTTCTATTTTGG - Intronic
916614434 1:166424927-166424949 TTGCTATCCAGGATCTTTTTTGG + Intergenic
917043046 1:170827661-170827683 ATGATATCCAGGATCTATTTAGG - Intergenic
917389981 1:174525115-174525137 TGGCCATCCTGGCTCTTTTTTGG + Intronic
922022696 1:221720218-221720240 CTCCCTTCCTGGAGCTATTTAGG - Intronic
922492868 1:226032491-226032513 GTGCCATCATCCATCTATGTAGG - Intergenic
1066118654 10:32262598-32262620 TCCCCATCCTGGAGCTATTTAGG + Intergenic
1067349833 10:45465599-45465621 GTGCCATCCTGGCTCTCTCCAGG - Intronic
1068361848 10:55985148-55985170 TTGCCTTCTTGGATCTATTATGG - Intergenic
1068567059 10:58588023-58588045 CAGCCATCCTGCATATATTTAGG + Intronic
1071454105 10:85829784-85829806 GTGTCATCTTGGATTTCTTTGGG - Intronic
1078876559 11:15404300-15404322 TTGCTATCCTGTATTTATTTTGG + Intergenic
1081481907 11:43497305-43497327 GTGCCATCCTGGAACTCTATGGG + Intergenic
1083438918 11:62663188-62663210 GGGGAATCCTGGATTTATTTGGG - Intronic
1085994474 11:81893859-81893881 GTGCCATGCTGCAGCTCTTTAGG + Intergenic
1087148608 11:94837386-94837408 CTGCCTTCTTGCATCTATTTTGG + Intronic
1087227763 11:95622274-95622296 CTGCCATCCTTGCTCTCTTTTGG - Intergenic
1087757943 11:102074183-102074205 GTGCCATCCTGCAGCTGCTTAGG + Intronic
1089574405 11:119431315-119431337 GTGCCTTCCTGGATGTCTTTGGG + Intergenic
1090047286 11:123347010-123347032 GTCCGATTCAGGATCTATTTTGG - Intergenic
1090809094 11:130221152-130221174 GTGACAGCCTGTATCTATGTAGG + Intergenic
1091004996 11:131944965-131944987 AACCCAGCCTGGATCTATTTGGG + Intronic
1094026991 12:25969620-25969642 GTCACATCCTGGGTATATTTTGG + Intronic
1096600992 12:52729340-52729362 CTGCCTTCCTGGAGCTACTTTGG + Intergenic
1098678984 12:73326275-73326297 TGGCCATTCTGGATCTATTTTGG - Intergenic
1099503244 12:83439894-83439916 TAGCCATCCTGGATCTCTTTTGG + Intergenic
1099947121 12:89257361-89257383 GTGCCATACTACATATATTTGGG - Intergenic
1100222145 12:92516650-92516672 GTGGCATCCTGGAGCCATTCTGG + Intergenic
1100451058 12:94706747-94706769 GCTCCATCCTGGAGCTATCTAGG + Intergenic
1101578306 12:106018501-106018523 CTCCCATCCTGAATCTATCTAGG - Intergenic
1104731946 12:131111682-131111704 CTGCCACTTTGGATCTATTTTGG + Intronic
1107181695 13:37468959-37468981 TTGCTACCCTGGATGTATTTGGG - Intergenic
1107229839 13:38095837-38095859 GTGCCATTCTGTCTCTATCTTGG - Intergenic
1110348382 13:74476121-74476143 CTGCCATCCTGAAGCTATCTAGG + Intergenic
1112370944 13:98792884-98792906 GTTCCATCATGGAACTATATGGG + Intergenic
1114969084 14:28002895-28002917 ATGCCTTCCTGGTTCAATTTTGG + Intergenic
1116247981 14:42442145-42442167 GTGCCATCCTAGTTTTATTACGG + Intergenic
1117423354 14:55570541-55570563 GTGTCATCAAGGATCTACTTTGG + Intronic
1119833880 14:77729392-77729414 GTCCCATATTGGATGTATTTTGG - Intronic
1125700723 15:41680946-41680968 GTGCCATCCTGGATCTATTTAGG + Intronic
1126195744 15:45928559-45928581 GTGCCATCTTGGATGATTTTAGG + Intergenic
1131734815 15:95320622-95320644 GTCCCATCCTGAAGCTATTAGGG + Intergenic
1132096117 15:98986243-98986265 ATCCCATCCTGAAGCTATTTAGG - Intronic
1136569682 16:31089155-31089177 GTGCCATCCTGGAACCATGGAGG + Intronic
1137385842 16:48041843-48041865 GTGCCATCCTCCATCTTTTAGGG - Intergenic
1149568813 17:57657778-57657800 GAGGGATCCTGGAGCTATTTGGG + Intronic
1156442989 18:37210345-37210367 GTCCCATCCTGGAGGTAATTTGG - Intronic
1156669459 18:39451089-39451111 CTGCCATCCTGAAGCTATCTAGG - Intergenic
1156844384 18:41647230-41647252 GAGCCAGCCTGGCTGTATTTTGG - Intergenic
1157528793 18:48405254-48405276 GGGCCATCGGGGACCTATTTGGG + Intronic
1164090047 19:21941854-21941876 CTGCCTGCCTGGATATATTTTGG + Intronic
1164508292 19:28877256-28877278 ATGGCATCCTGGTTTTATTTTGG + Intergenic
1166048920 19:40246708-40246730 GTGCCATCCTTCATGTATTTGGG - Intronic
1168289034 19:55348000-55348022 GTGCTATCCTGGTGCTATTGGGG + Exonic
925754964 2:7124441-7124463 GTGCCAACCTGGATGGATGTTGG - Intergenic
929786004 2:44991983-44992005 GTATCATCATGGATCTCTTTGGG + Intergenic
930308589 2:49708924-49708946 GTGCCATCCTTCATCTACATAGG + Intergenic
931188151 2:59973696-59973718 GTGCCATCCTGGACCCAGCTCGG + Intergenic
935871801 2:107458915-107458937 GTGCTATGCTAGGTCTATTTAGG + Intergenic
938739086 2:134214021-134214043 GTCCCATCCCGAAGCTATTTAGG + Intronic
944637559 2:201689561-201689583 GTGAGATCCTGGATATATTTTGG + Intronic
945120068 2:206448543-206448565 CTCCCATCCTGAAGCTATTTAGG - Intronic
946978754 2:225183362-225183384 GTGATAACCTGGATATATTTAGG + Intergenic
1172681904 20:36722795-36722817 GAGCCATCCCTGATTTATTTGGG - Intronic
1174160718 20:48548586-48548608 GTCCCATTTTGGACCTATTTTGG - Intergenic
1184457579 22:44620455-44620477 GTGCCATCCGGGGTCACTTTGGG - Intergenic
1184904908 22:47475585-47475607 ATGCCATTTTGTATCTATTTAGG - Intronic
949437905 3:4049399-4049421 GTGCCATCCAGCAAATATTTTGG - Intronic
949529815 3:4944773-4944795 GTGCCAGCCTGAAGGTATTTTGG + Intergenic
950136457 3:10584450-10584472 GTGCCACCCTGGATCTCTGTAGG + Intronic
950175782 3:10873291-10873313 GTGCCTGCCTGGAACCATTTGGG - Intronic
954563731 3:51580543-51580565 GTCCCATCCTGGGGCTATCTAGG + Intronic
954994353 3:54867867-54867889 GTGACATCCTGGAGCGATGTGGG + Intronic
955037559 3:55283645-55283667 TTTCCATCCTGGAGCTATCTTGG + Intergenic
955885055 3:63589192-63589214 GTTGCATCCAGGATCTTTTTAGG - Intronic
962781686 3:138724598-138724620 GCTCCATCCTGGAGCTATCTAGG + Intronic
963359068 3:144247152-144247174 GTGTCATTCAGGATCTATGTGGG + Intergenic
964859494 3:161185609-161185631 GTTCCATCCTGAAGCTATCTAGG + Intronic
965929643 3:174027665-174027687 GAGCCATCCTGAATATATTTGGG - Intronic
965983272 3:174719850-174719872 GTGCCAGCCTGGAGCGATCTTGG + Intronic
966052937 3:175643555-175643577 GTGCTATCCTGGATTTATATAGG + Intronic
967020440 3:185517711-185517733 GTCCCACCCTGGATCAATTAAGG - Intronic
970803080 4:19999467-19999489 GAGCAATCCTTGATCTTTTTTGG + Intergenic
973677191 4:53276951-53276973 TTGCCATCCTATATCTGTTTTGG + Intronic
980807271 4:137830092-137830114 GTCCCATCCTGGATCTACTGAGG + Intergenic
982182348 4:152760556-152760578 ATGCAATTCTGGATCTTTTTGGG + Intronic
997598766 5:135125393-135125415 GTGCCATCATGGATTAATGTTGG + Intronic
998116720 5:139543449-139543471 GTGCAATCCAGGATCTACGTGGG - Intronic
998609735 5:143674823-143674845 ATGCCTTGCTGGAACTATTTAGG - Intergenic
1004932208 6:20473714-20473736 GTGCGAGCCTGGAGCTACTTGGG - Intronic
1005635086 6:27745479-27745501 ATGCCAGCCTGCATCTATCTGGG + Intergenic
1006893124 6:37446886-37446908 GTGCCATCCAGGTTCTAAATAGG + Intronic
1008459578 6:51752519-51752541 GTCCCATACTGAATATATTTGGG + Intronic
1008466578 6:51837773-51837795 GTCTCATCATGGATCTCTTTGGG - Intronic
1008999731 6:57699694-57699716 GTGAGATTCTGGATGTATTTTGG + Intergenic
1009059311 6:58378449-58378471 GTGCATTCCTGCATCTCTTTGGG - Intergenic
1009188213 6:60599116-60599138 GTGAGATTCTGGATGTATTTTGG + Intergenic
1010385564 6:75275899-75275921 CTTCCATCCTGAAGCTATTTAGG - Intronic
1011581419 6:88870655-88870677 GTGCCATTTTGGACCTTTTTTGG - Intronic
1012996178 6:105977278-105977300 GTGCCATCCTGGAGTAATTACGG + Intergenic
1014644271 6:123954221-123954243 GTGCCTTGCTGTAGCTATTTAGG + Intronic
1019695020 7:2440796-2440818 GTGTCATTCTGGATTTATCTTGG + Intergenic
1021576645 7:22111496-22111518 GAGTCATTCTGGATATATTTAGG - Intergenic
1022789596 7:33673637-33673659 GTACTATGCTTGATCTATTTTGG + Intergenic
1026583556 7:71637605-71637627 GTTCCATCCTGGCCCCATTTGGG - Intronic
1027518754 7:79176537-79176559 GTGGCCTCTTGGATATATTTTGG + Intronic
1028365154 7:90020654-90020676 GAGTCATCCTTCATCTATTTGGG - Intergenic
1028941464 7:96526626-96526648 GTGCCTTCCTTGATCTCTTGGGG + Intronic
1034445495 7:151111925-151111947 GTCCCAGCCTGGAGCTTTTTAGG + Intronic
1039864068 8:41485763-41485785 GACCCATCCTGGATCATTTTCGG - Intergenic
1041963172 8:63643539-63643561 TTGCCACCCTGGATCTGATTTGG + Intergenic
1043033098 8:75163879-75163901 GTTCCTTCCTTTATCTATTTGGG + Intergenic
1044547820 8:93479192-93479214 GTGCCATTCAGGAGCTATTCAGG - Intergenic
1051201671 9:14633514-14633536 GTGCCTTCCTGGAGCTGCTTAGG - Intronic
1057876650 9:98760448-98760470 TTGCCATCCTGGAGCTACTTAGG + Intronic
1188729572 X:33630540-33630562 GTGCCATTCTGTAGCTACTTGGG - Intergenic
1190093024 X:47456162-47456184 GTGTCATCCTGGATTTGTCTGGG - Intronic
1199489956 X:148387310-148387332 GTGCCATGCTGGAGCTTCTTGGG - Intergenic
1200409877 Y:2850668-2850690 GTGACATCCTGAACCTACTTGGG - Intronic
1201611758 Y:15851087-15851109 CTCCCATGCTGGATGTATTTTGG - Intergenic
1202300991 Y:23413896-23413918 GTGCTATTCTGGGTCAATTTTGG - Intergenic
1202569820 Y:26256702-26256724 GTGCTATTCTGGGTCAATTTTGG + Intergenic