ID: 1125709664

View in Genome Browser
Species Human (GRCh38)
Location 15:41774629-41774651
Sequence GGGGGCGCTGACGAGTAGCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 73
Summary {0: 1, 1: 0, 2: 0, 3: 8, 4: 64}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125709652_1125709664 14 Left 1125709652 15:41774592-41774614 CCTTAGCTCGCCGAGGCTGGTGA 0: 1
1: 0
2: 0
3: 3
4: 56
Right 1125709664 15:41774629-41774651 GGGGGCGCTGACGAGTAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 64
1125709656_1125709664 4 Left 1125709656 15:41774602-41774624 CCGAGGCTGGTGAGGCTGGGCCC 0: 1
1: 0
2: 4
3: 46
4: 409
Right 1125709664 15:41774629-41774651 GGGGGCGCTGACGAGTAGCAGGG 0: 1
1: 0
2: 0
3: 8
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125709664 Original CRISPR GGGGGCGCTGACGAGTAGCA GGG Intronic
904004443 1:27356504-27356526 TGGGGCGCAGAAGAGTAGAATGG + Intronic
905390831 1:37634522-37634544 GGGGGCGCTGGGGAGAAGGATGG + Intronic
920226934 1:204446051-204446073 GGGGGCGCTGGCGAGCACCAGGG + Exonic
924797107 1:247300449-247300471 GGGGGCGCTGATCAGTACCAAGG + Exonic
1065130619 10:22616202-22616224 GGGGGAGCTGACATGTGGCAGGG + Intronic
1069698272 10:70404018-70404040 GGGGGCGGGGACGAGGGGCAGGG - Intergenic
1070630720 10:78082554-78082576 GGCGGCCCTGCCCAGTAGCAAGG - Intergenic
1076902870 10:133348273-133348295 GGGGGTCCTGAGGAGAAGCAGGG + Intronic
1083744412 11:64727227-64727249 GGGGGAGCTGGGGAGTATCAGGG - Intronic
1091240149 11:134046697-134046719 CAGAGCGCTGAGGAGTAGCATGG - Intergenic
1096677091 12:53231883-53231905 GGGGGCGCGGAGGAGCTGCACGG - Intronic
1107456491 13:40560262-40560284 GGTGGCGCAAACGAGTAGCACGG + Exonic
1113962226 13:114132486-114132508 GCGGGCGCGGACGCGCAGCATGG - Exonic
1121115501 14:91339931-91339953 GGAGGCCCTGTCGAGGAGCATGG - Exonic
1122476954 14:102016956-102016978 GAGGGCGCTGAAGAGTGTCATGG - Exonic
1123132583 14:106000181-106000203 GGGGGCGCTCAGAAGAAGCAGGG - Intergenic
1123203684 14:106692038-106692060 GGGGGCGCTCAGGACCAGCAGGG - Intergenic
1123203754 14:106692312-106692334 GGGGGCGCTCATGACCAGCAGGG - Intergenic
1123208783 14:106738819-106738841 GGGGGCGCTCATGACCAGCAGGG - Intergenic
1125709664 15:41774629-41774651 GGGGGCGCTGACGAGTAGCAGGG + Intronic
1126390949 15:48151539-48151561 TGGTGCGATGACTAGTAGCATGG - Exonic
1126740276 15:51770150-51770172 GTGGGGGCTGAGGATTAGCAAGG - Intronic
1129082481 15:73052695-73052717 GGGGGTGCTGAGGAGTCGCCGGG - Exonic
1141592323 16:85077224-85077246 GGGGGCACTCACGGGGAGCAGGG + Intronic
1152577775 17:81150433-81150455 GGGGGTACTGAGGAGTAGGATGG - Intronic
1153828337 18:8897743-8897765 GGGTGAGCTGACTAGGAGCAAGG + Intergenic
1155338118 18:24785657-24785679 GGGGGCACTGAAGAGTGGCAGGG + Intergenic
1159625780 18:70692289-70692311 GGAGGCGCTGGAGAGGAGCAAGG - Intergenic
1160717459 19:582766-582788 GGCGGCGCAGACGTGGAGCAGGG - Exonic
1161621081 19:5297490-5297512 GGGGGCACAGACTAGTTGCAGGG + Intronic
1166974653 19:46598545-46598567 GAGGGAGCTGAGGAGGAGCAAGG - Intronic
1168246936 19:55117211-55117233 GGGGGCGCTGACCTGGTGCAGGG + Exonic
1168327293 19:55544898-55544920 GGTGGAGCTGACGACCAGCAGGG - Exonic
926153729 2:10439030-10439052 GGGGCCACTCACGTGTAGCACGG + Intergenic
931670941 2:64646519-64646541 GGGGGCGCAGCCGAGCAGCAAGG + Intronic
932759215 2:74428604-74428626 GGGGGCCCTGAGGAGTGGAAGGG - Intronic
938337313 2:130511370-130511392 GGGGGTGCTGAGGAGCAGCAGGG - Intergenic
938352525 2:130609365-130609387 GGGGGTGCTGAGGAGCAGCAGGG + Intergenic
946138335 2:217666644-217666666 GGGGGAACTGAGGACTAGCAAGG - Intronic
946410528 2:219513202-219513224 CGGGGCGCTAATGAGCAGCAGGG - Intergenic
947938311 2:234026182-234026204 GGGGGAGCTGGGGAGTAGGAGGG - Intergenic
948540196 2:238685882-238685904 GGGGGCGCTGCTGATTGGCAAGG - Intergenic
1181000830 22:19987108-19987130 GGGGGCGCTGGCCAGCAGCGGGG + Intronic
1182311560 22:29412387-29412409 GGCAGCGCTCCCGAGTAGCAGGG + Intronic
1182688779 22:32141448-32141470 GGCAGCGCTCCCGAGTAGCAGGG - Intergenic
950560648 3:13719682-13719704 GAGGGGGCTGAGGAGGAGCAGGG - Intergenic
952341253 3:32449479-32449501 GGAGGCGATGAGGAGGAGCAGGG - Exonic
953200420 3:40773301-40773323 GTGGGCTCTCACTAGTAGCAGGG - Intergenic
987393627 5:17400192-17400214 GTGGGCCATGACGTGTAGCATGG - Intergenic
992221525 5:74578413-74578435 GGGCGCTCTGAAGAGAAGCATGG + Intergenic
995805836 5:116051586-116051608 GGGGGCACTCCCCAGTAGCATGG - Intronic
1005135941 6:22570001-22570023 GGGGCCGCTGAAGAGGAGCGCGG + Exonic
1007225654 6:40312016-40312038 AGGGGAGCTGACGAAGAGCAAGG - Intergenic
1007679549 6:43624898-43624920 GTTGGCACTGACGAGGAGCAGGG + Exonic
1017649063 6:156564568-156564590 GAGGGCGCAGAAGAGCAGCAAGG + Intergenic
1018013729 6:159693743-159693765 GGCGGCGCTGACCAGCAGCTAGG - Intronic
1023092308 7:36628593-36628615 GGGGGCACTGAAGAGGAGCCAGG + Intronic
1026546119 7:71323990-71324012 CGGGGCTCTGTTGAGTAGCAGGG + Intronic
1029457194 7:100677348-100677370 GGAGGCGCTGACCAGCAGCCTGG - Exonic
1031357569 7:120806089-120806111 GGGGGAGCTGGAGAGTAGCATGG + Intronic
1032151633 7:129434454-129434476 GGAGCCGCTGACCAGCAGCATGG + Exonic
1032278982 7:130486172-130486194 GGTGGCGCTGACGCCTGGCAGGG + Intronic
1039447449 8:37643964-37643986 GGGGGCGTAGAGGAGGAGCAAGG + Intergenic
1049279201 8:141735726-141735748 GGGGGCGGTCAGGAGGAGCATGG - Intergenic
1049289816 8:141795839-141795861 GGGGGCGTTGACGAGAGGGATGG + Intergenic
1049414209 8:142487980-142488002 GGGGGCGCTGAGGAGGTGCCTGG + Intronic
1053557217 9:39149840-39149862 GGGGGCGCTGGGGAGTTTCAGGG - Exonic
1053821325 9:41970108-41970130 GGGGGCGCTGGGGAGTTTCAGGG - Exonic
1054090202 9:60838260-60838282 GGGGGCGCTGGGGAGTTTCAGGG - Intergenic
1054111613 9:61113817-61113839 GGGGGCGCTGGGGAGTTTCAGGG - Intergenic
1054609244 9:67217308-67217330 GGGGGCGCTGGGGAGTTTCAGGG + Intergenic
1057393269 9:94657028-94657050 GGGAGCGCTGAGGATTAGCTTGG - Intergenic
1059244672 9:112839621-112839643 GGGGGCACTGATTAGTAGAAAGG + Intronic