ID: 1125710092

View in Genome Browser
Species Human (GRCh38)
Location 15:41777847-41777869
Sequence AGGTACATGCCCCTTTTGGG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 83
Summary {0: 1, 1: 0, 2: 0, 3: 6, 4: 76}

Found 0 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125710092 Original CRISPR AGGTACATGCCCCTTTTGGG GGG Intronic
901602852 1:10435590-10435612 AGGCAGATGCCCCTTATGTGTGG + Intronic
902900858 1:19514975-19514997 AAGAACATGCCACTTTTGGCCGG + Intergenic
904855036 1:33491446-33491468 AGGTACCTGCCCCTTCTATGAGG + Exonic
908148211 1:61270173-61270195 AGGTAAATGTACATTTTGGGGGG + Intronic
908964195 1:69738154-69738176 CGGTACATGGCCATTTTTGGTGG - Intronic
911147746 1:94568824-94568846 AGGTATATGCCCCAGGTGGGAGG + Intergenic
922758397 1:228109371-228109393 AGATATACGCCCCTGTTGGGCGG + Intergenic
1063405527 10:5791033-5791055 TGGGATATGCCTCTTTTGGGAGG + Intronic
1063744192 10:8861121-8861143 AGTCATTTGCCCCTTTTGGGAGG + Intergenic
1064191547 10:13210536-13210558 AGGGACATAACACTTTTGGGAGG + Intronic
1073681709 10:105711976-105711998 AGGTAAATGGCTCTTTTGGCAGG + Intergenic
1074047213 10:109850003-109850025 TGGAACATGCCCCTTTTTGCTGG - Intergenic
1075654276 10:124151117-124151139 TGGCACATGGCCCCTTTGGGCGG - Intergenic
1078586096 11:12590590-12590612 AACTACAGGCCCCTTTTAGGAGG - Intergenic
1093886923 12:24472335-24472357 AGGTACAATCCCCTTGTGAGGGG - Intergenic
1094055828 12:26268849-26268871 AGCTACATGCCCTCTCTGGGTGG + Intronic
1094765389 12:33588614-33588636 AGGAAAAGGCCCATTTTGGGGGG + Intergenic
1097731851 12:63137632-63137654 AATTACATACCCCTTTTGGTAGG - Intergenic
1098488151 12:71045646-71045668 AGTTACATGCTCCTATTGGATGG + Intergenic
1108380660 13:49850885-49850907 AGGTATATGCTCCTTTTCTGGGG - Intergenic
1112562711 13:100528360-100528382 AGGTAAATGATCCTTTTGTGAGG + Intronic
1117444144 14:55787722-55787744 AGGTACATATCCATTTTGGGGGG + Intergenic
1119195988 14:72716932-72716954 AGGTAGATCCCCCGTTAGGGTGG - Intronic
1123918475 15:25054416-25054438 AGGAACATTCCCTTTTTGTGAGG + Intergenic
1125710092 15:41777847-41777869 AGGTACATGCCCCTTTTGGGGGG + Intronic
1136297335 16:29311181-29311203 AGGTCCCGGCCCCTTGTGGGAGG + Intergenic
1139434164 16:66926529-66926551 GTGTTTATGCCCCTTTTGGGTGG - Intergenic
1141957907 16:87384479-87384501 AGGAACAGGCGCCCTTTGGGCGG - Intronic
1143921515 17:10334047-10334069 AGGGGCAAGCCCCTTTGGGGAGG + Intronic
1146401928 17:32506367-32506389 AGGTCCATGTCTCATTTGGGAGG + Intronic
1151128409 17:71870543-71870565 AGAAACATACCCTTTTTGGGGGG + Intergenic
1152368727 17:79871838-79871860 AGCCACATACCCATTTTGGGGGG - Intergenic
1157160031 18:45305457-45305479 AGGTTCTTGCTCCTTTTGGATGG + Intronic
1157283787 18:46363420-46363442 AGGCACATGCCCCTGATGGCCGG - Intronic
1161748619 19:6077423-6077445 AGGCACACGCCCCTCTTGGGTGG - Intronic
1164499450 19:28803554-28803576 AAGTACATGTGCCTTTTTGGTGG - Intergenic
1164857281 19:31534922-31534944 AGCTACAAGCCCCTTTGGGCTGG + Intergenic
1165267840 19:34676862-34676884 AGGTCCATTGCCCTTTTGGGTGG + Intergenic
931355917 2:61537791-61537813 AGATTAATTCCCCTTTTGGGGGG - Exonic
933596041 2:84284312-84284334 AGGTACATTCGCACTTTGGGAGG - Intergenic
935607515 2:104985535-104985557 AGGTACATGACCCATTTTGCAGG + Intergenic
937872967 2:126798932-126798954 AGGAACATGCCCCTCCCGGGTGG - Intergenic
947018278 2:225645729-225645751 AGGTATGTGCCCCTTGTTGGTGG + Intronic
1174865219 20:54129302-54129324 AGGTAAATTCACCTTATGGGGGG + Intergenic
1175309752 20:58003539-58003561 AGGTACCTGGCCCCTTCGGGAGG + Intergenic
1179410065 21:41155724-41155746 AGGAACTTGCCCCTCCTGGGTGG - Intergenic
1183411197 22:37655758-37655780 AGGCCCATGCCCCTTTGTGGGGG - Exonic
949500622 3:4676983-4677005 AGGGACATGGCCATGTTGGGAGG - Intronic
950202464 3:11054968-11054990 AAGGACATGGCCCTCTTGGGAGG - Intergenic
955434261 3:58884457-58884479 AGGTACAGTGCCCTTTTTGGAGG + Intronic
970401451 4:15721285-15721307 AGGTTCTTGCCCATTTTGGAGGG + Intronic
978389810 4:108213631-108213653 AGATACAGGCCCCTCTTAGGAGG + Intergenic
979033981 4:115688302-115688324 TGGTACAAGTCCATTTTGGGGGG + Intergenic
984046043 4:174799432-174799454 AGATGCATGTCCCTTTGGGGTGG + Intronic
985071880 4:186173726-186173748 AGGTCCATGCCTCTTTTCCGTGG + Intergenic
985817147 5:2135516-2135538 AGGTCCATGCTGCTTCTGGGTGG + Intergenic
988093063 5:26568091-26568113 AGGTACATGTATTTTTTGGGAGG + Intergenic
994176766 5:96719608-96719630 AGGTACATGGGTCATTTGGGAGG + Intronic
996947939 5:129093249-129093271 AGGTACCTACCTATTTTGGGTGG - Intergenic
997341865 5:133151505-133151527 AGGTACATGGCTCTTTGTGGTGG + Intergenic
1007967626 6:46016356-46016378 TGGCAAATGCCCCTTTTGGTGGG - Intronic
1009743981 6:67788038-67788060 AAGTAAATGCACCTTATGGGTGG - Intergenic
1012677021 6:102127883-102127905 AGGTAGATGCCCCTGTTGTTTGG + Intergenic
1019744477 7:2692005-2692027 TGGTGCTTGCCCCTTGTGGGCGG + Intronic
1020609843 7:10381736-10381758 AAGTATATTCCCATTTTGGGGGG - Intergenic
1022422832 7:30240222-30240244 AGGAACATCCTCATTTTGGGAGG - Intergenic
1042482359 8:69318469-69318491 AGGTACATGACCTTTTTCTGTGG + Intergenic
1044949219 8:97419060-97419082 ATGTACATACCCCTTTTGCCTGG + Intergenic
1046561111 8:115838453-115838475 ATGTCCATGCCCCTGTTGGGTGG + Intergenic
1056101769 9:83306517-83306539 AGGTAGAAGACCCTTTTAGGTGG - Intronic
1056188243 9:84158457-84158479 AGGAAAATGCCCATTTTTGGTGG + Intergenic
1057512524 9:95692644-95692666 AGGTGCATGCCCGTCTTGTGAGG + Intergenic
1057869353 9:98707223-98707245 AGGTGCAGAACCCTTTTGGGAGG - Intronic
1058423370 9:104854600-104854622 AGGTACATGCTGCTTTAGGAAGG + Intronic
1060548241 9:124473179-124473201 AGGTACATCCCACTTTTAGGAGG + Intronic
1062119184 9:134824882-134824904 AGGTCCATGCCCGCTTTGGGGGG - Intronic
1186735187 X:12455734-12455756 AGGTAAATGTCTCATTTGGGAGG + Intronic
1187268457 X:17758916-17758938 AGGTAGAGGCCCCTTTGGAGAGG - Intergenic
1188937661 X:36196466-36196488 AGGTAAATGCACTTTTTTGGGGG + Intergenic
1197232187 X:124016960-124016982 AAGTATGTGACCCTTTTGGGAGG + Intronic
1197924567 X:131633166-131633188 AAGTATATGTCCCTTTTGGTTGG + Intergenic
1200265702 X:154645330-154645352 AGGAACATGGCCCGTGTGGGAGG + Intergenic
1202096400 Y:21252806-21252828 AGGTACGTGACTCTTTTGGAAGG + Intergenic