ID: 1125713249

View in Genome Browser
Species Human (GRCh38)
Location 15:41804210-41804232
Sequence CAGACTGAGCTGCCCATAAA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 147
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 138}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125713249_1125713252 1 Left 1125713249 15:41804210-41804232 CCATTTATGGGCAGCTCAGTCTG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1125713252 15:41804234-41804256 GCAAGGGAGACTTCTGCCCCTGG 0: 1
1: 0
2: 2
3: 16
4: 224
1125713249_1125713255 8 Left 1125713249 15:41804210-41804232 CCATTTATGGGCAGCTCAGTCTG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1125713255 15:41804241-41804263 AGACTTCTGCCCCTGGGTTTGGG 0: 1
1: 0
2: 1
3: 20
4: 197
1125713249_1125713256 9 Left 1125713249 15:41804210-41804232 CCATTTATGGGCAGCTCAGTCTG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1125713256 15:41804242-41804264 GACTTCTGCCCCTGGGTTTGGGG 0: 1
1: 0
2: 3
3: 21
4: 238
1125713249_1125713260 29 Left 1125713249 15:41804210-41804232 CCATTTATGGGCAGCTCAGTCTG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1125713260 15:41804262-41804284 GGGTCAGTGTCTCTCCCAAGTGG 0: 1
1: 0
2: 1
3: 24
4: 182
1125713249_1125713253 2 Left 1125713249 15:41804210-41804232 CCATTTATGGGCAGCTCAGTCTG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1125713253 15:41804235-41804257 CAAGGGAGACTTCTGCCCCTGGG 0: 1
1: 0
2: 2
3: 24
4: 188
1125713249_1125713254 7 Left 1125713249 15:41804210-41804232 CCATTTATGGGCAGCTCAGTCTG 0: 1
1: 0
2: 1
3: 7
4: 138
Right 1125713254 15:41804240-41804262 GAGACTTCTGCCCCTGGGTTTGG 0: 1
1: 0
2: 0
3: 22
4: 175

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125713249 Original CRISPR CAGACTGAGCTGCCCATAAA TGG (reversed) Intronic
900791222 1:4682222-4682244 CAGGCTGTGCTGCCCATCGATGG + Intronic
901471038 1:9456646-9456668 CAGACTGAGCTTCTCATCCAAGG + Intergenic
904296070 1:29520609-29520631 CAGCCTGATCTGCCCAAGAATGG - Intergenic
904336850 1:29803455-29803477 CAGCCTGATCTGCCCAAGAATGG - Intergenic
907747522 1:57228091-57228113 CAGACTGAAGTGCCTATAATAGG + Intronic
907988314 1:59554538-59554560 CAGACTGATCTGTCCCTAATGGG + Intronic
908311184 1:62886080-62886102 CAGAGTCAGCTTCCCATAAAAGG + Intergenic
913211691 1:116588069-116588091 CAATCAGAGCTGCCCAAAAATGG + Intronic
921503953 1:215943123-215943145 TGGACAGAGCTGCCCATACAAGG + Intronic
924770824 1:247078365-247078387 GAGGCAGAGCTGCCCAGAAAGGG + Intronic
1063587911 10:7369611-7369633 CTGACTCATCTGCCAATAAATGG + Intronic
1070344818 10:75531418-75531440 CAGACTCTGCTGACCCTAAAAGG - Intronic
1072417899 10:95264113-95264135 CAGCCTGCACTGCCCATCAAGGG - Intronic
1072441129 10:95456404-95456426 CAGAGTGGGCTCCTCATAAAAGG + Intronic
1075383429 10:122037510-122037532 CAGACTGAGCTCCCCATAACCGG + Intronic
1076383448 10:130040305-130040327 CAGACTGCTCTGTCCATATACGG - Intergenic
1077474394 11:2779523-2779545 CAGCCTGTGCTGTCCAGAAAGGG - Intronic
1078612584 11:12834364-12834386 CAGATTGCACTGCCCTTAAAAGG - Intronic
1078801985 11:14655489-14655511 CACACTGAGATGCTCAAAAAAGG - Intronic
1082222985 11:49664453-49664475 CAGACTAAGCTTCCCAACAATGG + Intergenic
1083025375 11:59546301-59546323 GAGACCAAGATGCCCATAAAGGG + Intergenic
1083146890 11:60766765-60766787 CAGTCAGAACTGCCCATAAAAGG + Intronic
1083941969 11:65900625-65900647 CTGACGTAGCTGCCCATACATGG + Intergenic
1084244436 11:67846934-67846956 CAGATTCAGCTCCTCATAAAAGG + Intergenic
1084828247 11:71747627-71747649 CAGATTCAGCTCCTCATAAAAGG - Intergenic
1085379085 11:76096508-76096530 CAGATAGAGCTGCCCAACAATGG + Intronic
1085694936 11:78696161-78696183 CAGAGAGAGCAGCCCATCAAAGG + Intronic
1085748781 11:79140558-79140580 CAGGCAGAGCAGCCCAGAAAAGG - Intronic
1086049115 11:82568109-82568131 TAGGCTGAGCAACCCATAAATGG - Intergenic
1086858093 11:91891024-91891046 GAGATTCAGCTGCCCATAAGAGG + Intergenic
1092415001 12:8284077-8284099 CAGATTCAGCTCCTCATAAAAGG + Intergenic
1092955893 12:13549479-13549501 TAGACAGAGGTGCCCAGAAAAGG + Exonic
1092994001 12:13930686-13930708 CAGAGGGAGCTGCTTATAAAAGG + Intronic
1096385632 12:51193224-51193246 CAGACTGTGCAGCCATTAAAAGG + Intronic
1098612201 12:72472615-72472637 CAGACTGAGATGGCCAAAGATGG - Intronic
1102130757 12:110526942-110526964 CATACTGATCTGGCCATAATTGG - Intronic
1104000745 12:124858331-124858353 CACAGTAAGCTGCCCATGAATGG + Intronic
1104293212 12:127487814-127487836 CAGATTCAGCTCCTCATAAAAGG - Intergenic
1107676992 13:42807834-42807856 AAGTCTGGGCTGGCCATAAAGGG - Intergenic
1112160926 13:96867257-96867279 CAGTGTGAGCTGCCAATAAGTGG - Intergenic
1113572732 13:111370294-111370316 CAGAGTGACCTTCCCATGAAGGG - Intergenic
1115440059 14:33424377-33424399 CAGACCAAGATGCCCATGAAGGG + Intronic
1115795325 14:36929180-36929202 CATACTGAGGTCCCCAGAAAAGG + Intronic
1122002344 14:98669673-98669695 CAGACAGAAATGCCCATCAAGGG - Intergenic
1123788052 15:23691872-23691894 GGGACCGCGCTGCCCATAAAAGG - Intergenic
1124063529 15:26318411-26318433 CAGCCTGTGCTGTCCATAAGAGG - Intergenic
1124476145 15:30036660-30036682 CAGACTTAACTGACCAGAAATGG + Intergenic
1125713249 15:41804210-41804232 CAGACTGAGCTGCCCATAAATGG - Intronic
1125988241 15:44076868-44076890 CAGTCTGAGATGTCCAGAAATGG + Intronic
1126259682 15:46673716-46673738 AAGAATGTGATGCCCATAAAGGG - Intergenic
1126362500 15:47860906-47860928 CTGAATGAGCTGCACTTAAAGGG + Intergenic
1128759019 15:70202703-70202725 CAGCCAGAGCTGCCCAGAACAGG - Intergenic
1130650813 15:85761137-85761159 CAGACTGCGCTGCCGGTGAATGG - Intronic
1131975579 15:97942742-97942764 CAGAATGAGTTTCCCATAACAGG + Intergenic
1132227024 15:100150694-100150716 CAGGCTGAGCTGGCCCTACAGGG - Intronic
1138162855 16:54772413-54772435 AAGCCAGAGCTGCCCAGAAATGG - Intergenic
1138323986 16:56145525-56145547 CAGTCTGAGCAGCCCTTCAAGGG - Intergenic
1138460455 16:57144599-57144621 GAAACTGAGCTTCCCCTAAAGGG + Intronic
1141828352 16:86496202-86496224 CAGGCTGAACTGGCCAGAAAGGG + Intergenic
1143514883 17:7414589-7414611 TGGACTGAGCTGCCCAGAAAGGG + Intronic
1144762286 17:17714117-17714139 CAGGCAGGGCTGCCCAGAAATGG - Intronic
1145864532 17:28232282-28232304 CAGATTCAGCTCCTCATAAAAGG + Intergenic
1147033701 17:37663538-37663560 CAGACAGAGCTGCCCAAATTTGG + Intergenic
1149626938 17:58086136-58086158 CAGGCTGAGATGCCCGTAAGAGG - Intronic
1150284577 17:63947727-63947749 CAGACAGAGCTGCCCAGGGAGGG - Intronic
1150819794 17:68426037-68426059 CAGACTGAGCCGCCCAGTTACGG + Intronic
1151872906 17:76848718-76848740 CAGACTGCGCTGCTCACAGATGG + Intergenic
1152041925 17:77909234-77909256 CAGACAGAGCTGTCCTTGAAAGG + Intergenic
1152543102 17:80986945-80986967 CAGGCTGAGCTGGCCAGAAGAGG - Intergenic
1157110963 18:44820096-44820118 CCTACTGAGCTGGCCAGAAAGGG - Intronic
1159521402 18:69529407-69529429 CAAACTGAGCTCTCCAAAAAGGG + Intronic
1162379612 19:10323643-10323665 CAGACTCAGCTGCCCCATAAGGG + Intronic
926879186 2:17523085-17523107 GAGACACAGCTTCCCATAAATGG + Intergenic
927256416 2:21044094-21044116 CAGCCTGGGCTTCCTATAAATGG - Intergenic
928256695 2:29729046-29729068 CAGACTGAGCATCCGAGAAAAGG - Intronic
929275092 2:40016288-40016310 CAGATTGAGATGCCCTTGAATGG - Intergenic
929861704 2:45683869-45683891 CAAACTTAGCTGCCTATCAATGG - Intronic
935207842 2:100912016-100912038 AAGACAGTGCTGTCCATAAAAGG - Intronic
937127311 2:119482783-119482805 CAGAGTGGGCTGTCCGTAAAGGG - Intronic
942331976 2:174836019-174836041 GAGACAGAGCTGCACACAAAAGG - Intronic
943081186 2:183260867-183260889 CAGAGTAAGCTGCCCATGGAAGG + Intergenic
943161783 2:184263132-184263154 CAGACTGAGTCGCTTATAAAAGG - Intergenic
945926910 2:215815210-215815232 CTGACTGAGCTGGCCAAAGAAGG - Intergenic
946634977 2:221714679-221714701 CAGACTATGATGCCCAGAAAAGG - Intergenic
946963141 2:225006194-225006216 CAAACTAAGATGGCCATAAATGG - Intronic
947595228 2:231407043-231407065 CAGATTCAGCTCCTCATAAAAGG - Intergenic
947642237 2:231713659-231713681 CAGACTCTGCTGCCCATCACAGG - Intergenic
1170831045 20:19840778-19840800 CATAATGAGGTGCCCATGAAAGG - Intergenic
1172775124 20:37402841-37402863 CTGACTGAGCTCACCACAAAGGG + Exonic
1173042055 20:39473699-39473721 CAAACTGAGCTGCCCACAACTGG + Intergenic
1174831160 20:53813399-53813421 CAGAGACAGCTGCCCAGAAAGGG - Intergenic
1177902455 21:26933657-26933679 CAGACTTAGGTTGCCATAAAAGG - Intronic
1178384792 21:32140276-32140298 CAGACAGAGCTCCCCAAAGAGGG - Intergenic
1181085906 22:20439226-20439248 CAGGCTGAGCTGCCCAGAAGTGG - Intronic
953885303 3:46711613-46711635 CAGCCAGGCCTGCCCATAAAAGG - Intergenic
954194941 3:48990775-48990797 CAGACCGCGCTGCCCAAGAAGGG - Intronic
954634086 3:52062266-52062288 CAGGCTGAGGTGCCCTTAAGTGG - Intergenic
955043339 3:55337278-55337300 CACACTGATCTTCCCAGAAATGG + Intergenic
957685258 3:83496699-83496721 CAGACTAAGCTGAATATAAAAGG + Intergenic
959979214 3:112496244-112496266 CAGCATGATCTGCCCATGAAGGG + Intronic
961032460 3:123618476-123618498 CAGCAGGAGCTGCTCATAAAGGG - Intronic
961892552 3:130142688-130142710 CAGATTCAGCTCCTCATAAAAGG + Intergenic
965680529 3:171246871-171246893 CAGACTGGGCTGAACAGAAATGG + Intronic
968035459 3:195544171-195544193 CAGACTGAGCCACCCAGAACTGG + Intergenic
977061236 4:92259143-92259165 CAGCCTGATCTGCCTATAAAAGG + Intergenic
977250235 4:94681284-94681306 CAGACTGAGCTGGTCTAAAAGGG + Intergenic
977555709 4:98485605-98485627 GAGACAGAGCTGCTCAGAAATGG + Intronic
981191560 4:141871027-141871049 CAGACTGAACAACCCATAATAGG + Intergenic
981308007 4:143267179-143267201 CAGACTGAGGTGGTCTTAAATGG + Intergenic
982496313 4:156097141-156097163 GAGACTGATTTCCCCATAAAAGG - Intergenic
985371056 4:189285290-189285312 GAGACTGAGCTGCCCATTGCTGG - Intergenic
988076763 5:26363854-26363876 CAGGCTGAGGTGCTCTTAAATGG + Intergenic
990759612 5:59113875-59113897 CATAGTAAGCTGTCCATAAATGG + Intronic
995975275 5:118027945-118027967 AAAACTGAGCGGCCCTTAAAAGG + Intergenic
1000561791 5:162798483-162798505 CAGACAGTTCTGCCCAGAAAGGG + Intergenic
1003241610 6:4350207-4350229 GAGCCAAAGCTGCCCATAAAGGG - Intergenic
1004603480 6:17173105-17173127 CTTGCTGAGCTACCCATAAAGGG + Intergenic
1005805027 6:29466580-29466602 GGGAATGAGATGCCCATAAAGGG + Intergenic
1009396541 6:63206298-63206320 CAGGCTGAGGTGGCCGTAAATGG + Intergenic
1020291657 7:6727160-6727182 CAGACTGTGATGCCCATCACAGG - Intergenic
1020322767 7:6952191-6952213 CAGATTCAGCTCCTCATAAAAGG + Intergenic
1021194732 7:17662820-17662842 CTGACTCAGCTGCACATCAAAGG + Intergenic
1023649962 7:42359328-42359350 CAAACTGACCAGCACATAAAAGG - Intergenic
1024973339 7:55090669-55090691 CAGCCTGAGATGCCAAAAAATGG + Intronic
1026726862 7:72876722-72876744 CAGACTGTGATGCCCATCACAGG - Intergenic
1027116972 7:75488897-75488919 CAGACTGTGATGCCCATCACAGG + Intergenic
1027274835 7:76546701-76546723 CAGACTGTGATGCCCATCACAGG - Intergenic
1027368747 7:77485829-77485851 CAGACTGAGCTGGGCATCAGAGG + Intergenic
1027682613 7:81239350-81239372 CAGAGTGAGCTCCAGATAAAAGG + Intergenic
1029720531 7:102361164-102361186 CAGACTGTGATGCCCATCACAGG - Intergenic
1029817167 7:103108032-103108054 CAGACTAAGTTACCCATAAAGGG + Intronic
1029914805 7:104198359-104198381 CAGACTGAGGTGGTCATAGATGG + Intronic
1030583637 7:111390104-111390126 CTGACTGCACTGCCCATATATGG - Intronic
1030670636 7:112332080-112332102 CAGATTGTGCTGCTCATACAGGG + Intronic
1035485271 7:159218613-159218635 AAGACTGAGATGCCCAGAAGGGG + Intergenic
1037326464 8:17696174-17696196 CAGTCTGAGCTGACGGTAAATGG - Intronic
1037884173 8:22587731-22587753 CAGACTGCCCAGCCCAGAAAAGG - Intronic
1046650975 8:116836261-116836283 GAGAATGAACTCCCCATAAAGGG + Intronic
1049499645 8:142955061-142955083 GAGTCTGACCTGCCCATTAAGGG - Intergenic
1049692903 8:143970434-143970456 CAGTCTGAGCTCCCTGTAAAGGG - Intronic
1049881957 8:145071116-145071138 CAGATTCAGCTCCTCATAAAAGG + Intergenic
1053173204 9:35905399-35905421 CAGTCTCAACTGGCCATAAATGG - Intergenic
1060031488 9:120218341-120218363 CAGACTGAGGTGCCCCTCAGAGG - Intergenic
1186281622 X:7999242-7999264 CAAACTCAGCTGCCCATGACAGG + Intergenic
1186858082 X:13644827-13644849 CAGAAAGAGCTGCCCCTAAGTGG + Intergenic
1194400872 X:93436690-93436712 CAGATTCAGCTCCTCATAAAAGG - Intergenic
1195991907 X:110691255-110691277 CAGGCTGAGGGGCCTATAAAGGG + Intronic