ID: 1125717460

View in Genome Browser
Species Human (GRCh38)
Location 15:41827464-41827486
Sequence GCGGCTGGTGTGGGAAGTCG GGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 296
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 279}

Found 7 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125717460_1125717474 12 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717474 15:41827499-41827521 TGGGACTCAGGTTCGCCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 152
1125717460_1125717475 13 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717475 15:41827500-41827522 GGGACTCAGGTTCGCCCTCTGGG 0: 1
1: 0
2: 0
3: 9
4: 109
1125717460_1125717479 30 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717479 15:41827517-41827539 TCTGGGCCAGGTCCTTCACGAGG 0: 1
1: 0
2: 0
3: 17
4: 188
1125717460_1125717470 0 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717470 15:41827487-41827509 GCCCACCGCAGGTGGGACTCAGG 0: 1
1: 0
2: 1
3: 12
4: 129
1125717460_1125717468 -7 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717468 15:41827480-41827502 CAGCCGCGCCCACCGCAGGTGGG 0: 1
1: 0
2: 0
3: 8
4: 137
1125717460_1125717476 18 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717476 15:41827505-41827527 TCAGGTTCGCCCTCTGGGCCAGG 0: 1
1: 0
2: 1
3: 10
4: 171
1125717460_1125717467 -8 Left 1125717460 15:41827464-41827486 CCCCGACTTCCCACACCAGCCGC 0: 1
1: 0
2: 1
3: 15
4: 279
Right 1125717467 15:41827479-41827501 CCAGCCGCGCCCACCGCAGGTGG 0: 1
1: 0
2: 0
3: 10
4: 195

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125717460 Original CRISPR GCGGCTGGTGTGGGAAGTCG GGG (reversed) Exonic
900250310 1:1665380-1665402 ATGGCTGGTGTGGGAAGCCGAGG + Exonic
900472672 1:2862597-2862619 GCGGCAGGTGTGAGGAGGCGGGG - Intergenic
900495689 1:2974997-2975019 GAGGCTGGGGTAGAAAGTCGAGG - Intergenic
900936041 1:5766775-5766797 GCGGCAGGTGCGGGAAGAAGCGG - Intergenic
902394546 1:16125403-16125425 GCGGCTGGGGAGGGGAGTGGAGG + Intronic
902456867 1:16539584-16539606 GAGGCAGGTGTGGGAAGATGTGG + Intergenic
902474388 1:16673521-16673543 GAGGCAGGTGTGGGAAGATGTGG + Intergenic
902484415 1:16733921-16733943 GAGGCAGGTGTGGGAAGATGTGG - Intergenic
902495302 1:16868329-16868351 GAGGCAGGTGTGGGAAGATGTGG - Intronic
902503388 1:16924884-16924906 GAGGCTGGTGTGGGCACCCGCGG + Intronic
902519078 1:17005598-17005620 GGGGCTGGAGTAGGAAGTTGGGG + Intronic
903614883 1:24644069-24644091 GCGGGTGGTGAGGGATGTGGAGG - Intronic
904919031 1:33992289-33992311 GAGGCTGAGGTGGGAGGTCGAGG - Intronic
905037726 1:34929104-34929126 GCTGGTTGTGGGGGAAGTCGTGG - Intronic
905307456 1:37029478-37029500 GCAGCTGCTGTGGCAAGTAGAGG + Intronic
906087916 1:43151755-43151777 GCGGCTGGGATGGGAAGTGGGGG + Intronic
907445013 1:54501918-54501940 GGGAGTGGTGTGTGAAGTCGGGG - Intergenic
907520172 1:55018615-55018637 GGGGCAGCTGTGGGAAGCCGGGG + Intergenic
908920709 1:69188242-69188264 GTGGCTGGTGTCAGAAGTCTGGG - Intergenic
912612463 1:111062245-111062267 GCAGCTGGTGTGGGGAATGGGGG + Intergenic
913662116 1:121013227-121013249 GAGGCAGGTGTGGGAAGATGTGG + Intergenic
914013490 1:143796412-143796434 GAGGCAGGTGTGGGAAGATGTGG + Intergenic
914164334 1:145164773-145164795 GAGGCAGGTGTGGGAAGATGTGG - Intergenic
914652115 1:149705021-149705043 GAGGCAGGTGTGGGAAGATGTGG + Exonic
914871266 1:151476724-151476746 GCTGCTGGGGTGGGGAGTTGGGG - Intergenic
919035971 1:192309285-192309307 GCACCTGTTGTGGGAAGTCAGGG - Intergenic
919484265 1:198127639-198127661 GTGGCAGGTGTGGGAAGTGTGGG + Intergenic
919620001 1:199853609-199853631 GAGGCTGGGGTGGGAGGTCAAGG + Intergenic
922494806 1:226048146-226048168 GGGGGTGGTGGGGGAAGTGGGGG - Intergenic
922706969 1:227795201-227795223 GCGGCTCCTGTGGGAAGGAGGGG - Intergenic
922897074 1:229108768-229108790 GTGGCTGGTCTGGGAAGCGGAGG + Intergenic
923745887 1:236699999-236700021 GAGGCAGCTGTGGGAAGTAGGGG - Intronic
1063393318 10:5664236-5664258 GCTGCTGCTCTGGGAAGCCGGGG - Intronic
1063816294 10:9777706-9777728 GCTGCTTTTGTGGGAAGTCCTGG - Intergenic
1065167433 10:22994348-22994370 GGGGCTGGCGTGAGAAGTGGGGG + Intronic
1067078778 10:43202599-43202621 GGGGCTGGTGTGGGCTGGCGCGG - Intronic
1067274021 10:44818833-44818855 TCAGCTGGTGGGGGAAGTCCAGG - Intergenic
1068690151 10:59906284-59906306 GCGGCGGCGGTGGGAAGTCGGGG - Exonic
1069608138 10:69753117-69753139 GAGGCTGGGGTGGGGAGTCCTGG - Intergenic
1069660331 10:70119376-70119398 GCAACTGGTGTTTGAAGTCGGGG + Intronic
1069858548 10:71455942-71455964 GCAGCTGGTGTGCGAAGTCAGGG - Intronic
1071676325 10:87659540-87659562 GAGGCTGGTGAGGGGAGTGGAGG + Intergenic
1072270750 10:93774087-93774109 GCCGTTGGTGTGGGGAGTGGAGG - Intronic
1072453594 10:95558357-95558379 GGAGCTGGGGTGGGAACTCGGGG - Intronic
1073290696 10:102411905-102411927 GCAGCTGGGGTGGGAAGGGGAGG + Intronic
1073290970 10:102413138-102413160 GCAGCTGGGGTGGGAAGGGGAGG - Intronic
1074720026 10:116256446-116256468 GGGGCTGGGGTGGGAAGAGGTGG - Intronic
1074801446 10:117004984-117005006 GCGCCAGGTGTGGGCAGCCGCGG - Intronic
1076297348 10:129397121-129397143 GGGGCTGGGGTGGCCAGTCGTGG - Intergenic
1076601418 10:131659109-131659131 GAGGCTGGGGTGGGGAGTGGAGG + Intergenic
1076793080 10:132786844-132786866 GCGGCCCGTGGGCGAAGTCGTGG - Intergenic
1077207156 11:1350139-1350161 GAGGCTGATGTGGGAGGGCGAGG + Intergenic
1077885265 11:6382758-6382780 GAGGCTGGGGTGGGGGGTCGGGG - Intergenic
1082063010 11:47876553-47876575 CAGGCTGTTGTGGGAAGTCAGGG - Intergenic
1082143374 11:48635606-48635628 GAAGCTGTTGTGGGAAGTCAGGG - Intergenic
1082570558 11:54732880-54732902 GAAGCTGTTGTGGGAAGTCAGGG - Intergenic
1083155861 11:60822361-60822383 GCGTGTGGTGGGGGGAGTCGTGG + Intergenic
1083514461 11:63243589-63243611 GCTGCTGGAGTGGGAACTGGTGG + Intronic
1083756415 11:64794041-64794063 GTGGGTGGTGTGGGAAGCAGTGG - Intronic
1084188867 11:67489921-67489943 GCTGCTGGTGTGTGATGTCTGGG + Intronic
1084276925 11:68056986-68057008 GCAACTGGTGTTGGAAGTGGGGG + Intronic
1086064680 11:82732989-82733011 GCGGCGGGTGTGGCCCGTCGGGG - Exonic
1086998995 11:93393453-93393475 GTGGCTTGTGTGGGAAGCTGAGG - Intronic
1087279485 11:96194208-96194230 GAGGCTGGGGTGGGCAGTCTGGG + Intronic
1088239520 11:107759005-107759027 GCGGCTGCTGTGGGGAATGGGGG - Intergenic
1089139010 11:116271635-116271657 GCGGGTGGTTTGGGAAGGTGAGG - Intergenic
1089954235 11:122555737-122555759 GCAGCTGCTGTGGGAAATAGAGG + Intergenic
1089963667 11:122637730-122637752 GCAGCTGGTGGGGGATGACGTGG - Intergenic
1090895027 11:130964385-130964407 GCGGCTGCTGTGGGAGATGGGGG + Intergenic
1091692890 12:2609148-2609170 GAGGCTTGTGTGGGAGGTGGGGG + Intronic
1094468789 12:30782931-30782953 GCAATTGGTGTGGGAAGTAGTGG - Intergenic
1097008009 12:55932472-55932494 GAGGATGGGGTGGGAAGTTGGGG - Intronic
1097197415 12:57250942-57250964 GCAGCTGGGGTGAGCAGTCGTGG + Intronic
1100657416 12:96661588-96661610 GCTGCTGGTGTTTGAAGTCCTGG + Intronic
1102396317 12:112589151-112589173 GAGGCTGGAGGGGGAAGTGGGGG + Intronic
1102575613 12:113854438-113854460 GGGGGTGGTGTAGGAAGTCAAGG - Intronic
1103473248 12:121198990-121199012 GCGGCGGGGGTGGGGGGTCGGGG - Intergenic
1104660693 12:130609754-130609776 GCTGCAGGTCTGGGAAGTGGGGG + Intronic
1106308670 13:28534607-28534629 GCGGGTTGTGGGGGAAGTGGTGG - Intergenic
1107707968 13:43125702-43125724 GAGGCTGGGAAGGGAAGTCGGGG + Intergenic
1110318740 13:74136170-74136192 GCGGCGGGAGCGGGAAGGCGCGG + Intergenic
1117051063 14:51860169-51860191 GAGGCTGGTGTGGGATCTCGGGG + Intronic
1117140674 14:52788234-52788256 GAGGCTGATGTGGGAAGCTGAGG - Intronic
1119655336 14:76413353-76413375 GGAGTTGGTGTGGGAAGTCCGGG - Intronic
1121565851 14:94908546-94908568 GAGGCTGGTGTGGAAAATGGAGG + Intergenic
1122272731 14:100575634-100575656 GGGGCTGGTGGGGGAAGGTGGGG + Intronic
1122904172 14:104794470-104794492 ACGGAGGCTGTGGGAAGTCGGGG - Intronic
1123931135 15:25172160-25172182 GGAGCTGGTGTGGGTAGTGGAGG + Intergenic
1123936619 15:25197108-25197130 GGAGCTGGCGTGGGCAGTCGAGG + Intergenic
1125512987 15:40302774-40302796 GCGGCTGGGATGGGAAGGAGAGG + Intronic
1125717460 15:41827464-41827486 GCGGCTGGTGTGGGAAGTCGGGG - Exonic
1125756041 15:42065660-42065682 GCGGCTGGTGGCTGAAGTTGGGG - Intergenic
1126069669 15:44854908-44854930 GCAGCTGGTGGGGGAAGCCTGGG - Intergenic
1126088862 15:45034254-45034276 GCAGCTGGTGGGGGAAGCCTGGG + Intronic
1126726574 15:51637996-51638018 GCGTGTGGTGGGGGAAGTCAAGG - Intergenic
1127259957 15:57320147-57320169 GCGGGTGGTGTGGGAAGAGAAGG + Intergenic
1127396285 15:58546227-58546249 GGGGCTGGAGTGAGAAGTGGAGG - Intronic
1127624218 15:60764260-60764282 GAGGCTGGGGTGGGAAGCGGGGG + Intronic
1127730791 15:61800349-61800371 GTGGCTGTTGTGGGAAGACAGGG - Intergenic
1127755173 15:62085125-62085147 GCTCCTGTTGTGGGAAGTCAGGG - Intergenic
1128418170 15:67466084-67466106 GCGGCAGCTGTGGGAAGAGGTGG - Intronic
1128633268 15:69285958-69285980 GCGGTTGGCGGCGGAAGTCGGGG + Intergenic
1129036183 15:72649581-72649603 GAGGCTGAGGTGGGAGGTCGAGG + Intergenic
1129144880 15:73637811-73637833 GAGGCTGCTGGGGGAAGTGGTGG - Intergenic
1129213704 15:74087646-74087668 GAGGCTGAGGTGGGAGGTCGAGG - Intergenic
1129400307 15:75277717-75277739 GAGGCTGAGGTGGGAGGTCGAGG + Intronic
1129730844 15:77931979-77932001 GAGGCTGAGGTGGGAGGTCGAGG - Intergenic
1130649086 15:85751913-85751935 GGGGGTGGGGTGGGAAGTCCAGG - Intergenic
1130875337 15:88008908-88008930 GGGGCTGGTCTGTGAAGTCTGGG - Intronic
1131095956 15:89654606-89654628 GCTCCTGGTCTGGGAGGTCGGGG - Intronic
1131315908 15:91337208-91337230 GGGGCTGGAGTGGGAAGATGTGG + Intergenic
1132618274 16:852847-852869 GCGGCAGTTGTGGGAACCCGAGG - Intergenic
1134098653 16:11436224-11436246 GGGGCTGGTGGGGGAAGCAGAGG + Intronic
1136771694 16:32846415-32846437 GCGGCGGGTGTAGAAAGCCGAGG + Intergenic
1136898888 16:34015011-34015033 GCGGCGGGTGTAGAAAGCCGTGG - Intergenic
1137266534 16:46873594-46873616 GTGGCTGGTGTCTGAAGTGGGGG + Intergenic
1137738426 16:50742137-50742159 GCGGTGGGTGTGGGGAGCCGGGG + Intronic
1203074120 16_KI270728v1_random:1108526-1108548 GCGGCGGGTGTAGAAAGCCGAGG + Intergenic
1142680994 17:1548576-1548598 GTGGCTGGTGGGGCACGTCGTGG - Intronic
1142743788 17:1945006-1945028 GCGGCTGGGGAGGGAAGGAGGGG - Intronic
1144478707 17:15611558-15611580 ACGGGTGGTGTGGGGAGTAGCGG - Intronic
1145292366 17:21558537-21558559 GGGGGTGTTGTGGGAAGTCAGGG + Intronic
1145305130 17:21669922-21669944 GCGGGTGGTGTAGGAAGCAGGGG - Intergenic
1148615818 17:48998627-48998649 GGGGCTGGTTTGGGAAGGGGTGG - Intronic
1148670615 17:49407352-49407374 GGAGCTGCTGTGGGAAGACGCGG - Intronic
1148781349 17:50123797-50123819 GGGGTTGGTGTGGGGAGTAGAGG + Intronic
1151527066 17:74677745-74677767 GCAGCTGGTGTGGGGAGTGGTGG + Intronic
1151976953 17:77488550-77488572 GAGGCTGGTTTGGGAGGCCGAGG + Intronic
1155258662 18:24020767-24020789 GCGGCTGGTTGTGGAATTCGCGG + Intronic
1157164324 18:45344341-45344363 TTGGCTGGTGTTGGAAGTTGGGG - Intronic
1160366181 18:78327819-78327841 GCGGATGGTGTGGGAGGCCGGGG - Intergenic
1160532820 18:79575477-79575499 GCGGCTGGGCTGGGCAGACGGGG + Intergenic
1160616211 18:80131155-80131177 GCTGCTGCTGTGGGAGGTCTCGG + Intronic
1160761048 19:784662-784684 GCGGCTGGTGTGCGGGGTTGGGG + Intergenic
1161459065 19:4385710-4385732 GAGGCTGCTGTGGGAAGGCTGGG + Intronic
1162146134 19:8613015-8613037 GGGGCTGTGGTGGGAAGTAGTGG - Intergenic
1163442420 19:17328674-17328696 GCGGCGGGCGGGGGAAGGCGGGG - Exonic
1166937413 19:46342904-46342926 AGGGCTGGGGTGGGAAGTGGAGG - Exonic
1167457018 19:49601682-49601704 GCGGCTGGTGGGGGTGGTGGTGG - Exonic
1167795803 19:51707716-51707738 GCGACTGGTGTCTGAAGTGGGGG - Intergenic
1202707765 1_KI270713v1_random:35925-35947 GAGGCAGGTGTGGGAAGATGTGG + Intergenic
925441908 2:3895321-3895343 GCAGCTGCTGTGGGAAGATGGGG + Intergenic
926874258 2:17457525-17457547 GGGGCTGTTGTGGGAAGTCAGGG - Intergenic
927826114 2:26311330-26311352 CTGGCTGGTGTGGAGAGTCGTGG - Exonic
929576333 2:43055164-43055186 GCAGCTGGATTGGGAAGTTGGGG - Intergenic
931283230 2:60811705-60811727 GCGACTGGTGTCTGAAGTGGGGG - Intergenic
931335309 2:61336226-61336248 GAGGCTGAGGTGGGAAGTCAAGG - Intronic
932291512 2:70583975-70583997 GTGGGTGGTGTGGGGAGGCGTGG + Intergenic
932489487 2:72111324-72111346 GCAGTTGTTGTGGGAAGTCAGGG + Intergenic
932917045 2:75870908-75870930 GCGGCTGGAGTGGGGAGGCCAGG - Intergenic
933234036 2:79844595-79844617 GCAACTGGTGTGGTAAGTTGGGG + Intronic
937696932 2:124818650-124818672 GCGGATGGAGTGGAAAGTGGGGG - Intronic
937986260 2:127639516-127639538 GAGGCTGGTGTGGGGAGGCTGGG - Intronic
938128162 2:128689416-128689438 GAGGCTGCAGTGGGAAGTCAGGG + Intergenic
938308798 2:130271769-130271791 GCTGCTGTTGGGGGAAGTCAGGG - Intergenic
939131730 2:138243268-138243290 GCGGCTGGTTTCTGAAGTGGGGG - Intergenic
940156579 2:150662939-150662961 GTGGCTGTTGTGGGAAGTCAGGG - Intergenic
941473662 2:165921614-165921636 GTGGCTGGTGTCTGAAGTCAGGG + Intronic
946992314 2:225348498-225348520 GCCCCTGGTGTTGGAATTCGTGG - Intergenic
947589260 2:231375862-231375884 GCAGGTGTTGTGGGAAGTCAGGG + Intergenic
948423490 2:237874475-237874497 GGGGCTGGTGTGAGCAGTGGAGG - Intronic
948890697 2:240905694-240905716 GCCCCTGGGGTGGGAAGCCGTGG + Intergenic
1168959738 20:1860666-1860688 GAGGCTGGTGTGGGAGGACCAGG - Intergenic
1169745938 20:8942946-8942968 GCTCCTGGTGTTGGAAGTGGGGG - Intronic
1171522645 20:25787396-25787418 GCGGGTGGTGTAGGAAGCAGGGG - Intronic
1171554182 20:26068487-26068509 GCGGGTGGTGTAGGAAGCAGGGG + Intergenic
1172106810 20:32521988-32522010 GCAGTTGCTGTGGGAAGGCGGGG - Intronic
1173827684 20:46057960-46057982 GCGGCGGGAGTGGGAAGGGGAGG - Intronic
1174119092 20:48248880-48248902 GTGGCTGGTGTCTGAAGTAGGGG - Intergenic
1174806447 20:53608051-53608073 GCGCGGGGTGGGGGAAGTCGGGG + Intronic
1175483645 20:59329279-59329301 GTGGCTGGTGTCTGAAGTAGGGG - Intergenic
1175544785 20:59771229-59771251 GGGGCTGGGGTGAGAAGTAGAGG + Intronic
1175806044 20:61829929-61829951 GAGGCAGGTGTGGGAAGTGCAGG + Intronic
1176090760 20:63317693-63317715 GAGGATGGTGAGGGAAGCCGGGG - Intronic
1176547036 21:8206557-8206579 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1176554941 21:8250766-8250788 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1176565987 21:8389604-8389626 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1176573862 21:8433791-8433813 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1176885365 21:14248965-14248987 ATGGCTGTTGTGGGAAGTCAGGG + Intergenic
1178138070 21:29650785-29650807 GTGGCTGGTGGGGGAAGAGGAGG - Intronic
1180793842 22:18592281-18592303 GCTGGTGGTGGGGGAAGGCGAGG - Intergenic
1181118721 22:20650847-20650869 GAGGCTGGTGTGGGAATTGTGGG - Intergenic
1181227898 22:21403039-21403061 GCTGGTGGTGGGGGAAGGCGAGG + Intergenic
1181250755 22:21531800-21531822 GCTGGTGGTGGGGGAAGGCGAGG - Intergenic
1181536170 22:23546896-23546918 CTGGCTGTTGTGGGAAGTCAGGG + Intergenic
1184109070 22:42384605-42384627 GGGGCTGGCGTGGGAGGTCTGGG - Exonic
1184729344 22:46364407-46364429 GGGGCTGGTGGGGCAAGTCAGGG - Intronic
1185038279 22:48490580-48490602 GCGGCTGGTGGGGTAAGTGGGGG + Intronic
1203251911 22_KI270733v1_random:122842-122864 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1203259962 22_KI270733v1_random:167925-167947 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
953134070 3:40167656-40167678 GTGGCTGGTGTCTGAAGTAGGGG - Intronic
953664346 3:44915422-44915444 GTTGCTGGTGTGGGGAGGCGAGG + Intronic
954709468 3:52498201-52498223 GCTGCTGCTGGGGGAAGTTGAGG - Intronic
955411190 3:58656611-58656633 GGAGCTGGTGTGGGAAGTCTGGG - Intronic
956715532 3:72076537-72076559 TCGTCTGCTGTGGGAAGTCAGGG - Intergenic
960668777 3:120136605-120136627 GAGGCTGGGGGGGGGAGTCGGGG + Intergenic
960870446 3:122244018-122244040 GAGGCTGGAGAGGGTAGTCGGGG + Intronic
962375677 3:134857063-134857085 GCGACTGGGGTGGGGTGTCGTGG + Intronic
963047939 3:141117079-141117101 GCGGCTGGTGTAGGGAGCTGAGG - Intronic
963430555 3:145196900-145196922 GTGGCTGCTGTGGGGAGTTGGGG - Intergenic
964586577 3:158312844-158312866 GTGGCTGTTGTGGGTAGTCCAGG - Intronic
964642594 3:158925979-158926001 GTGGCTGGTGTGGGAAAGAGTGG + Intergenic
964734037 3:159898282-159898304 ACAGCTGGTGTGGGAATTCAGGG - Intergenic
967041533 3:185697877-185697899 GAGGCTGGGGTGGGAAGATGAGG + Intronic
967567085 3:190986055-190986077 GAGACTGTTGTGGGAAGTCAGGG + Intergenic
968830552 4:2931271-2931293 GCGGCTGGTGGGAGACATCGAGG + Exonic
972048813 4:34702597-34702619 GCGGCTGCTGTGGGAAATGGGGG - Intergenic
974974149 4:68869279-68869301 GCGTGTGGAGTGGGAAGTCAAGG + Intergenic
976154685 4:82129612-82129634 GGGACTGGTGTTGGAAGTGGTGG + Intergenic
977958130 4:103053951-103053973 GCTGCTGGTTTGGGAGGCCGAGG - Intronic
981580098 4:146242394-146242416 GAGGCGGGTGTGGGAAGGCGGGG - Intergenic
981829673 4:148985523-148985545 ACTGCTGTTGTGGGAAGTCAGGG - Intergenic
984737247 4:183121113-183121135 GAGGCTGAGGTGGGAAGTCAAGG + Intronic
985846654 5:2354471-2354493 GTGGCTGGTGTGGGAAACCCAGG - Intergenic
986671529 5:10146944-10146966 GCTGCTGGTCTGGAAAGTCTTGG - Intergenic
989598191 5:43177617-43177639 GTGGCTGGTGTCTGAAGTGGGGG - Intronic
994049913 5:95350780-95350802 GCAGCTGGTGTCTGAAGTAGTGG - Intergenic
999280635 5:150363104-150363126 GAGGCGGGTGCAGGAAGTCGGGG - Intronic
1000029599 5:157390479-157390501 GCAGCTGGAGTGAGAGGTCGGGG - Intronic
1001846006 5:174922263-174922285 GAGGCTGAGGTGGGAGGTCGAGG - Intergenic
1001853902 5:174994341-174994363 GACGCTGGTGTTGGAAGTTGGGG + Intergenic
1002061341 5:176627674-176627696 GAGGCTGGTGTGGGAAGACAGGG + Intronic
1002467660 5:179415892-179415914 GGGGCTGGTGTGGGAACTTCTGG - Intergenic
1002590014 5:180284251-180284273 CCGGCTGGTGTGGGAAGTGGAGG - Intronic
1003318891 6:5035488-5035510 GCAGCTGGTGGGGGAGGTGGAGG - Intergenic
1006420490 6:33930953-33930975 GCAGCTGGTGTGGGGAGTGAAGG + Intergenic
1007920516 6:45605393-45605415 TCGGCTGGTGGGGGAGGTGGAGG - Intronic
1008800371 6:55361753-55361775 TAGGCTGATGTGAGAAGTCGGGG - Intronic
1010384914 6:75268818-75268840 GCAGCTGGTGTCTGAAGTGGGGG + Intronic
1011581809 6:88876429-88876451 GAGGCTGAGGTGGGAGGTCGAGG + Intronic
1011734371 6:90296701-90296723 GCGGCGGGAGTGGGCAGGCGGGG + Exonic
1014861944 6:126479591-126479613 GCTGGTGGTGTGGGAAGTAAGGG + Intergenic
1015194480 6:130510341-130510363 GGGGATGGTGTGGGAAGAAGGGG + Intergenic
1015327599 6:131941090-131941112 GCGGGTGGTGGGGGAAGGGGAGG + Intergenic
1017429267 6:154354620-154354642 GGGGGTGGTGTTGGAAGTGGTGG - Intronic
1017703136 6:157095200-157095222 GCTGCTGGTCTGGGAAGTACTGG + Intronic
1018990007 6:168667408-168667430 GGGGCTGGTGTTGGCAGCCGGGG + Exonic
1019304087 7:324328-324350 GAGGCTGGGGTGGGAGGTCCAGG - Intergenic
1019407783 7:892837-892859 GTGTCTGGTGTGGGTAGTTGGGG + Intronic
1019506766 7:1395271-1395293 GCCGCTGGGGTGGGGAGTCAGGG + Intergenic
1019602703 7:1893251-1893273 CCGGCTGGGATGGGAAGTCCTGG + Intronic
1020035289 7:4959975-4959997 GTGGAGGGAGTGGGAAGTCGGGG + Intergenic
1020140228 7:5607738-5607760 GCTGCTGCAGAGGGAAGTCGGGG + Intergenic
1021727227 7:23559913-23559935 GAGGCTGAGGTGGGAGGTCGAGG - Intergenic
1022805998 7:33823393-33823415 ATGGCTGCTGTGGGCAGTCGTGG - Intergenic
1025807552 7:64849615-64849637 GCAGCTGCAGTGGGAAGTGGGGG + Intergenic
1026881323 7:73908439-73908461 GCGTCTGGTGTGGTAAGTACAGG - Intergenic
1026981062 7:74526782-74526804 GCTGCTGATGTGGGAGGTGGGGG + Intronic
1027182623 7:75951566-75951588 GGGGCTGGTCTGGGAAGCCAGGG - Intronic
1028779691 7:94722367-94722389 GCGGGTGGAGTGGGAAATCAGGG + Intergenic
1029008486 7:97233845-97233867 TGGGCTGTTGTGGGAAGTCAGGG + Intergenic
1030310131 7:108060409-108060431 GCTGCAGGTGTGGGGAGTGGAGG + Intronic
1030400904 7:109049012-109049034 GAGGCTGGTGAGGAAAGTGGAGG - Intergenic
1034538521 7:151740851-151740873 GCGGCTTGTTTGGGAAGGCTGGG - Intronic
1035239219 7:157519290-157519312 ACGGCTGGGGTGGGAGGTTGTGG - Intergenic
1035291375 7:157841454-157841476 GCGGGTGGGGTGGGAAGGGGAGG - Intronic
1036708143 8:11060098-11060120 GTGGCTGCTGTGGGGAGTGGAGG - Intronic
1037699557 8:21262412-21262434 GCAGCAGGTGTGCGAAGTAGAGG - Intergenic
1037954377 8:23042723-23042745 GGGGCTGCTGTGGGGAGTGGAGG - Intronic
1039458867 8:37727011-37727033 GGGGCGGGTGTGGAAAGACGAGG + Intergenic
1039826311 8:41176831-41176853 GAGGCTGGTGTGTGAGGTGGTGG - Intergenic
1040276170 8:46015184-46015206 GCAGCTGTTGTGGGAAGTCAGGG - Intergenic
1040634244 8:49253980-49254002 TTGGCTGTTGTGGGAAGTCAGGG + Intergenic
1040914775 8:52557880-52557902 GAGGCTGAGGTGGGAGGTCGAGG + Intronic
1042340026 8:67668974-67668996 GCTGCAGGTGAGGGAAGTCATGG + Intronic
1045259461 8:100559570-100559592 GCGGAAGGTGTGGGAAGCCCGGG + Intronic
1047481052 8:125283434-125283456 GAGGCTGAGGTGGGAAGTGGAGG + Intronic
1047555356 8:125923489-125923511 GAGGCTGGAGTGGGAAGGAGAGG - Intergenic
1050101957 9:2128950-2128972 GTGGCTGGTGTCTGAAGTCAGGG - Intronic
1052731479 9:32291320-32291342 GCAGGTGGTCAGGGAAGTCGGGG + Intergenic
1055830521 9:80372758-80372780 GTGGGTGTTGTGGGAAGTCAGGG - Intergenic
1056773538 9:89496555-89496577 GAGGCTGGGGTGGGAAGATGAGG - Intronic
1057102794 9:92378958-92378980 GCAGCTGGAGTGTGAAGTGGAGG - Intronic
1058110950 9:101029872-101029894 GCGGCGGCAGTGGGAAGACGGGG + Intronic
1060297965 9:122355826-122355848 GAGGCTGGTGTGGGTTGGCGGGG + Intergenic
1060935559 9:127513285-127513307 GAGGCTGGAGAGGGTAGTCGAGG + Intronic
1060947275 9:127577416-127577438 GAGGATGGTGTGGGAAGTGTGGG - Intronic
1060947284 9:127577451-127577473 GAGGATGGTGTGGGAAGTGTGGG - Intronic
1060947293 9:127577486-127577508 GAGGATGGTGTGGGAAGTGTGGG - Intronic
1061024793 9:128041506-128041528 GCTGCTGGTGTCTGAAGTGGGGG + Intergenic
1062072535 9:134565010-134565032 GCAGCTGCTGTGGGAAGCAGGGG + Intergenic
1062436360 9:136548157-136548179 CCAGCGGGTGTGGGCAGTCGGGG + Intergenic
1062554979 9:137109819-137109841 GTGGCTGCTGTGGGATGTTGGGG - Intergenic
1062707847 9:137955048-137955070 GGGGCTGGGGTGAGATGTCGGGG + Intronic
1203468313 Un_GL000220v1:105993-106015 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1203476134 Un_GL000220v1:149965-149987 GCGGTGCGTGTGGGAAGGCGTGG + Intergenic
1187391926 X:18891724-18891746 GCGGCTGTTGTGGGATGGGGAGG + Intergenic
1187718452 X:22127733-22127755 GGGGATGGTGTGGGGAGTGGAGG + Intronic
1189333329 X:40155839-40155861 GCGGCTGGGGTGGGGAGGGGGGG + Intronic
1189603176 X:42648797-42648819 GCAGCTGCTGTGGGGAATCGGGG - Intergenic
1192495929 X:71616688-71616710 GCGGCTGGTGGTGGTGGTCGTGG - Exonic
1194478272 X:94388093-94388115 GAGGCAGGTGGGGGAAGTGGAGG + Intergenic
1196574009 X:117297487-117297509 GGGGGTGTTGTGGGAAGTTGGGG - Intergenic
1197572159 X:128163154-128163176 GCAGCTGTTGTGGGAAATGGGGG + Intergenic
1200128703 X:153830038-153830060 ACGGGTGGGGTGGGAAGTTGGGG - Intronic
1200878439 Y:8184635-8184657 ACAGCTGTTGTGGGAAGTCAGGG - Intergenic