ID: 1125717811

View in Genome Browser
Species Human (GRCh38)
Location 15:41829530-41829552
Sequence CTTTGGAATGCTGAGGTGGA AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 130862
Summary {0: 2, 1: 77, 2: 2778, 3: 33356, 4: 94649}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125717811_1125717818 16 Left 1125717811 15:41829530-41829552 CCTTCCACCTCAGCATTCCAAAG 0: 2
1: 77
2: 2778
3: 33356
4: 94649
Right 1125717818 15:41829569-41829591 AACACATAAGCCACTGCTCCCGG 0: 1
1: 0
2: 10
3: 224
4: 3366
1125717811_1125717815 -7 Left 1125717811 15:41829530-41829552 CCTTCCACCTCAGCATTCCAAAG 0: 2
1: 77
2: 2778
3: 33356
4: 94649
Right 1125717815 15:41829546-41829568 TCCAAAGTTTTGGAACGCCATGG 0: 1
1: 0
2: 0
3: 24
4: 548

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125717811 Original CRISPR CTTTGGAATGCTGAGGTGGA AGG (reversed) Intronic
Too many off-targets to display for this crispr