ID: 1125718399

View in Genome Browser
Species Human (GRCh38)
Location 15:41832944-41832966
Sequence CAAAGGTACCACCTGAATAG AGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 88
Summary {0: 1, 1: 0, 2: 0, 3: 4, 4: 83}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125718395_1125718399 16 Left 1125718395 15:41832905-41832927 CCAGTAGAAAGACACTCCAGTCT 0: 1
1: 1
2: 0
3: 10
4: 131
Right 1125718399 15:41832944-41832966 CAAAGGTACCACCTGAATAGAGG 0: 1
1: 0
2: 0
3: 4
4: 83
1125718397_1125718399 0 Left 1125718397 15:41832921-41832943 CCAGTCTGAGTGAGCAGCTGGAA 0: 2
1: 0
2: 0
3: 12
4: 212
Right 1125718399 15:41832944-41832966 CAAAGGTACCACCTGAATAGAGG 0: 1
1: 0
2: 0
3: 4
4: 83

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125718399 Original CRISPR CAAAGGTACCACCTGAATAG AGG Intronic
907164269 1:52396353-52396375 TAAAGGTATCACCTGAATTTAGG + Exonic
908855642 1:68423853-68423875 CAAAGATACCACCTGAGAAGGGG - Intergenic
910429284 1:87145159-87145181 CAAAGGCACCAACTGAATGAAGG - Intronic
910992007 1:93066416-93066438 GAAAGGTACCATGTGAATAGTGG + Intergenic
912692502 1:111814968-111814990 CAAAGGTACCACATGAGTCAAGG - Intronic
916711737 1:167416674-167416696 CAAAGGCACCACCTGATGTGGGG - Exonic
919046472 1:192458937-192458959 CAGTGGTACCAACTGTATAGTGG + Intergenic
919951621 1:202369657-202369679 CAAAGGCATCACCTGAGGAGAGG - Intronic
921563646 1:216689257-216689279 AAAAGGTACCATGTGAATACTGG + Intronic
921953659 1:220959637-220959659 AAAAGGTACCACTTAAATAAGGG + Intergenic
924774882 1:247109395-247109417 CAATGGGACCATCTGATTAGAGG - Intergenic
1064771483 10:18728216-18728238 CAAAGCTACAACCTGACTGGTGG - Intergenic
1068090545 10:52427711-52427733 GAAAGGAACAAACTGAATAGAGG - Intergenic
1070286149 10:75085338-75085360 CATGGGCACCACCTGAAGAGAGG - Intergenic
1074354995 10:112774626-112774648 CAAATATGTCACCTGAATAGAGG - Intronic
1075424338 10:122329666-122329688 CAAGGGAATCACCTGAATCGTGG + Intronic
1079693785 11:23453222-23453244 AAAAGGGACCAGCTGAATATTGG + Intergenic
1080068013 11:28042742-28042764 CAAAGTGATAACCTGAATAGAGG + Intronic
1080997901 11:37626920-37626942 CAAAGGTATTTTCTGAATAGAGG + Intergenic
1081415663 11:42812070-42812092 GAAATATACCATCTGAATAGTGG + Intergenic
1082877783 11:58005548-58005570 CAAAGGCATCACCTGGAGAGAGG + Intergenic
1083370285 11:62173486-62173508 CAAAGGTACCACCCAAAGAAGGG - Intergenic
1088744488 11:112794261-112794283 CCAAGGTCCCACCTGACTGGTGG - Intergenic
1090093972 11:123725770-123725792 CCAAAGTACAACCTGAATTGAGG - Exonic
1091000485 11:131906833-131906855 CAAAGGTGCAACTTGAAAAGGGG - Intronic
1093414524 12:18905029-18905051 CACAGGTGCCACCTAATTAGTGG - Intergenic
1094300452 12:28958917-28958939 CAATGGTACAATCAGAATAGAGG - Intergenic
1097317809 12:58190913-58190935 CAAAAGTCCCACCAGAAGAGTGG - Intergenic
1098972143 12:76868004-76868026 GGAAGGTACCACCAGAAGAGAGG - Intronic
1115903933 14:38186108-38186130 AAAATGTACCAAGTGAATAGGGG - Intergenic
1117594042 14:57308030-57308052 CAAATGTACCACATGGATTGTGG - Intergenic
1119516081 14:75249543-75249565 CAGCTGTTCCACCTGAATAGTGG + Intronic
1123864672 15:24506083-24506105 AAAAGGTACAACATGAAAAGTGG - Intergenic
1125718399 15:41832944-41832966 CAAAGGTACCACCTGAATAGAGG + Intronic
1126082195 15:44974587-44974609 CAAGGGAACCAACTGAAAAGTGG + Intronic
1126119167 15:45236002-45236024 CAATGGGACCAACTGATTAGAGG + Intergenic
1128198507 15:65782737-65782759 CAAAGTTACCACAAGAATACAGG + Intronic
1130321298 15:82844391-82844413 CCAAGGTACAACCTACATAGAGG + Intronic
1138807913 16:60113093-60113115 CAAAGATGCCTCCTGAAAAGAGG + Intergenic
1144888221 17:18478107-18478129 CCAAGGTAGAACCTGCATAGAGG + Intronic
1145143985 17:20466196-20466218 CCAAGGTAGAACCTGCATAGAGG - Intronic
1155450432 18:25957707-25957729 CAAAGGTAGCAGCTGAGTTGTGG - Intergenic
1157439856 18:47702423-47702445 GAAAGGTACCATCTAATTAGGGG + Intergenic
1163740153 19:19006811-19006833 CTAAGGTACCACCTGCCTTGTGG - Intronic
1164690445 19:30207037-30207059 CAAAGGTCCCTTCTTAATAGAGG + Intergenic
933278124 2:80304172-80304194 CAAAGGGAGCAGCTGAATGGAGG - Exonic
935337319 2:102028496-102028518 CAAAGGTGCCACATTTATAGTGG + Exonic
936906888 2:117546566-117546588 TAAAGATACCACCTGAAAAGGGG - Intergenic
943922948 2:193732918-193732940 CAAAGTTACCACCAGAAATGCGG - Intergenic
945889084 2:215409469-215409491 CACAGATACCACCTGCCTAGAGG + Intronic
1173218860 20:41114631-41114653 CAAATGTACCACATGACCAGGGG - Intronic
1179107445 21:38415432-38415454 TAAAGTTATCAGCTGAATAGCGG - Intronic
960735671 3:120777104-120777126 CAAAGAGACCACATGAATAAAGG + Intronic
960986344 3:123283571-123283593 CCAAGGTACCACCAGAGCAGTGG - Exonic
965067983 3:163877345-163877367 CAAAAGTACCAACTGAAAAGAGG - Intergenic
971236444 4:24846606-24846628 CAAAAGTCCCACGTCAATAGAGG + Intronic
972699248 4:41477912-41477934 CACAGCTACCACCTTAATGGTGG + Intronic
975260323 4:72290325-72290347 GAAAGGTACCACCTGGAAGGTGG + Intronic
976132937 4:81904209-81904231 CATAGGTACCATCAGGATAGTGG + Intronic
976745269 4:88396877-88396899 AAAAGATACCACCTGACCAGTGG - Exonic
980329744 4:131395247-131395269 CTCAGGTAACACCTGATTAGTGG - Intergenic
981118260 4:141017453-141017475 CAAATGTACCACATTAATATGGG - Intronic
981687686 4:147473019-147473041 AAAAGCTACAACCTGAAGAGAGG + Intergenic
982990720 4:162270331-162270353 AACAGGTACTACCAGAATAGAGG + Intergenic
998250300 5:140547945-140547967 CAAAGCTACAACCTGTAGAGGGG - Intronic
999407333 5:151317924-151317946 CAAAGATACCCCCTTAATAAGGG + Intronic
1012131848 6:95504343-95504365 CAAAGGCATCACCTGAGGAGAGG + Intergenic
1013583580 6:111559408-111559430 CAAGGGAACCACCTGAAGGGTGG + Exonic
1013849347 6:114495299-114495321 CAAAGGTAAAGCCTGAATTGTGG + Intergenic
1018407862 6:163506191-163506213 CAAAGGTACCACCTGAGACTGGG - Intronic
1021075625 7:16300862-16300884 CAAAGATCCCAGCTAAATAGAGG - Intronic
1021635619 7:22689499-22689521 CAAAAGTACCACCTGTTTAAAGG - Intergenic
1027576568 7:79937856-79937878 CAAAGGTCCCACCTCACTATGGG + Intergenic
1033935673 7:146582650-146582672 CAAAGGTACTACTAGAATATTGG + Intronic
1034891304 7:154841542-154841564 CAAAGGTACGAGCTGAATTTTGG + Intronic
1039554618 8:38467484-38467506 CAAAGCTACCTGCTGAATTGGGG + Intronic
1040122164 8:43695533-43695555 CAATGGGACCATCTGATTAGAGG + Intergenic
1040138575 8:43883995-43884017 CAATGGGACCATCTGATTAGAGG + Intergenic
1041944808 8:63428853-63428875 CAAATGCACCACCTGAAAATAGG + Intergenic
1044238398 8:89858202-89858224 CATTGGTCCCATCTGAATAGGGG - Intergenic
1048960812 8:139575161-139575183 GAGAGGTACCACCTGAACATGGG + Intergenic
1052411438 9:28126768-28126790 CAAATGTAACACCTGAAAATAGG - Intronic
1059227144 9:112682568-112682590 CAAAGGAAACACCTGCACAGAGG - Intergenic
1189281097 X:39820705-39820727 CACAGGTACCACCTGGGTGGTGG - Intergenic
1193681387 X:84523301-84523323 CAAATGTACCACCTGAGCAAAGG - Intergenic
1195629047 X:107034512-107034534 CAAAGGTATTACCTCAGTAGTGG + Intergenic
1198927624 X:141816162-141816184 GAAAGGTCCCACCTGTAGAGAGG + Intergenic
1200733190 Y:6765056-6765078 CAAATGTACCACCTCAGTGGGGG - Intergenic