ID: 1125718514

View in Genome Browser
Species Human (GRCh38)
Location 15:41833897-41833919
Sequence CACCGTCTCCTCTCCTCCAC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 294
Summary {0: 1, 1: 0, 2: 2, 3: 17, 4: 274}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125718514_1125718517 -6 Left 1125718514 15:41833897-41833919 CCAGTGGAGGAGAGGAGACGGTG 0: 1
1: 0
2: 2
3: 17
4: 274
Right 1125718517 15:41833914-41833936 ACGGTGGGTTTGAGAGACATAGG 0: 1
1: 0
2: 0
3: 8
4: 107
1125718514_1125718519 30 Left 1125718514 15:41833897-41833919 CCAGTGGAGGAGAGGAGACGGTG 0: 1
1: 0
2: 2
3: 17
4: 274
Right 1125718519 15:41833950-41833972 AGGACTCAGAGCCAATCAGTAGG 0: 1
1: 1
2: 1
3: 14
4: 175
1125718514_1125718518 10 Left 1125718514 15:41833897-41833919 CCAGTGGAGGAGAGGAGACGGTG 0: 1
1: 0
2: 2
3: 17
4: 274
Right 1125718518 15:41833930-41833952 ACATAGGAGACAGAATCAACAGG 0: 2
1: 0
2: 0
3: 32
4: 286

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125718514 Original CRISPR CACCGTCTCCTCTCCTCCAC TGG (reversed) Intronic