ID: 1125718659

View in Genome Browser
Species Human (GRCh38)
Location 15:41834712-41834734
Sequence AGAAAGAAGAAGACAGGGGA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 3028
Summary {0: 1, 1: 1, 2: 21, 3: 290, 4: 2715}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125718659_1125718663 15 Left 1125718659 15:41834712-41834734 CCATCCCCTGTCTTCTTCTTTCT 0: 1
1: 1
2: 21
3: 290
4: 2715
Right 1125718663 15:41834750-41834772 GCCTCTTGCTGTGCCCTACCTGG 0: 1
1: 0
2: 2
3: 19
4: 193

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125718659 Original CRISPR AGAAAGAAGAAGACAGGGGA TGG (reversed) Intronic
Too many off-targets to display for this crispr