ID: 1125720024

View in Genome Browser
Species Human (GRCh38)
Location 15:41840856-41840878
Sequence CTCTGCGGGCTGGGGAGTTC CGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 241
Summary {0: 1, 1: 1, 2: 1, 3: 24, 4: 214}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125720012_1125720024 27 Left 1125720012 15:41840806-41840828 CCTGGTGACCGGAGATGACCCTG 0: 1
1: 0
2: 0
3: 7
4: 147
Right 1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG 0: 1
1: 1
2: 1
3: 24
4: 214
1125720013_1125720024 19 Left 1125720013 15:41840814-41840836 CCGGAGATGACCCTGTGTTGTCA 0: 1
1: 0
2: 0
3: 12
4: 167
Right 1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG 0: 1
1: 1
2: 1
3: 24
4: 214
1125720014_1125720024 9 Left 1125720014 15:41840824-41840846 CCCTGTGTTGTCAGTACTGTTTG 0: 1
1: 0
2: 0
3: 12
4: 176
Right 1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG 0: 1
1: 1
2: 1
3: 24
4: 214
1125720015_1125720024 8 Left 1125720015 15:41840825-41840847 CCTGTGTTGTCAGTACTGTTTGA 0: 1
1: 0
2: 0
3: 15
4: 170
Right 1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG 0: 1
1: 1
2: 1
3: 24
4: 214

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125720024 Original CRISPR CTCTGCGGGCTGGGGAGTTC CGG Exonic
900388299 1:2420504-2420526 CCCCGAGGGCTGGGGAGTCCCGG + Intergenic
901168837 1:7239770-7239792 TTCTGGAGGCTGGGAAGTTCAGG + Intronic
904236936 1:29122423-29122445 CGCTGCGGGCGGAGGAGGTCTGG - Exonic
904256723 1:29259275-29259297 CCCTGCGGTCTGGGGAGATGAGG - Exonic
904322938 1:29708433-29708455 CCCTGGTGGCTGGGGTGTTCTGG - Intergenic
906515732 1:46437836-46437858 CACTGGGGGCAGGGGAGTTTGGG - Intergenic
906533303 1:46536154-46536176 CCCTGCGGGCTGGAGAGTCCAGG + Intergenic
906617706 1:47245751-47245773 CTCTCCGGCCTGAGGAATTCAGG - Intergenic
907229603 1:52984122-52984144 CTCTGCAGGCTGGAGAGTAAGGG - Intronic
910377184 1:86585547-86585569 CTCTGGGGTCTGGAGAGTTCTGG - Intergenic
910892540 1:92032719-92032741 TTCTGGAGGCTGGGAAGTTCAGG + Intronic
912378205 1:109230063-109230085 CACTGCAGGCTGGGGTGTGCAGG + Intronic
913565749 1:120070293-120070315 CGCTGTGGGCTGGGGGATTCAGG + Intergenic
913609605 1:120497212-120497234 CAGTGCTGGCTGGGAAGTTCTGG + Intergenic
913632380 1:120723261-120723283 CGCTGTGGGCTGGGGGATTCAGG - Intergenic
914286341 1:146229667-146229689 CGCTGTGGGCTGGGGGATTCAGG + Intergenic
914547373 1:148680409-148680431 CGCTGTGGGCTGGGGGATTCAGG + Intergenic
914581585 1:149024632-149024654 CAGTGCTGGCTGGGAAGTTCTGG - Exonic
914619142 1:149389951-149389973 CGCTGTGGGCTGGGGGATTCAGG - Intergenic
917149641 1:171930001-171930023 CTCTGTGGGCTGGAGAATACAGG + Intronic
917982341 1:180278154-180278176 CCCTGCTGGCTGGGGAGGTATGG - Exonic
918458909 1:184755274-184755296 CTCGGTGGGCTGCGGAGTCCCGG + Intergenic
919102771 1:193113981-193114003 CCCTGGGGGCTGGGAAGTTCAGG + Intergenic
919882338 1:201908848-201908870 CTCTGAGGGCTCTGGAGTTGAGG - Intronic
920275390 1:204800685-204800707 TTCTGCAGGCTGGGAAGTCCAGG + Intergenic
920836811 1:209518707-209518729 TTCTGCAGGCTGAGAAGTTCAGG - Intergenic
921207175 1:212858623-212858645 CGCTGCCGCCTCGGGAGTTCTGG + Exonic
1063121422 10:3107535-3107557 CTCTGTCTGCTGGGGAGTCCCGG - Intronic
1063158699 10:3403394-3403416 CTCTGGGGACTGGGGGGCTCAGG + Intergenic
1069830137 10:71277889-71277911 CCCTGTGGACTGTGGAGTTCTGG + Intronic
1070569152 10:77627974-77627996 CTCTGCTGGCTGGGGGCTTCAGG - Intronic
1071101565 10:82044722-82044744 CTCTGTGGGGTGGGGAGAGCAGG - Intronic
1072359754 10:94647873-94647895 CACTGGGGGCTGGGGGGTGCTGG + Intergenic
1072670869 10:97427941-97427963 CTCTGCGGGGTGGGGTGGGCAGG + Intronic
1072685659 10:97535063-97535085 CTCTGGAGGCTGGGGGCTTCTGG + Intronic
1073474582 10:103744505-103744527 CTCTGCAGCCTGGGGACTGCAGG + Intronic
1074677713 10:115870553-115870575 TTATGCAGGCTGGGGAGTTCAGG - Intronic
1077049768 11:561367-561389 CTCTGCGGCCTGAGCAGGTCGGG + Exonic
1077917603 11:6621623-6621645 CTGAGGGGGCTGGGGAGTTCAGG + Exonic
1078245928 11:9573479-9573501 CTGGGCGGGCTGTGGTGTTCCGG - Intergenic
1079386941 11:19988935-19988957 ATCTGCAGGCTGGGGACCTCTGG - Intronic
1080606812 11:33870441-33870463 CTCTGCGGGCTGCGGGCTACGGG + Intronic
1081668462 11:44930154-44930176 CTCTTGGAGCTGGGGAGTTGGGG - Exonic
1081763208 11:45591507-45591529 CTCTGGGGGCTGGGGAAGTCAGG - Intergenic
1083779408 11:64910194-64910216 CTCTGAGGGCGAGGGCGTTCAGG + Exonic
1083994948 11:66267240-66267262 CTCTGGGGTCTGGGGAGGCCAGG - Exonic
1085475454 11:76786085-76786107 CTCTGCCCGCTGGTGAGATCAGG - Intronic
1089291800 11:117441761-117441783 CTCTCAGAGCAGGGGAGTTCTGG + Intronic
1089557640 11:119323410-119323432 CTCTGGTGGCTGGGGAGCCCGGG - Intergenic
1089630835 11:119783248-119783270 CTCTGGAGGCTGGGAAGTCCAGG + Intergenic
1091796625 12:3300984-3301006 CTCTCGGGGCTGGAGAGGTCAGG + Intergenic
1096670900 12:53197739-53197761 CGCTGCGGCCTGGTGAGTTAGGG - Exonic
1100355082 12:93821246-93821268 CTATGCGGGCTGGGGAGAACTGG - Intronic
1102047551 12:109839477-109839499 TTGTGAGGGCTGGGCAGTTCGGG + Intergenic
1102489933 12:113284465-113284487 CTCTACGGGATGGGGAGAACAGG - Intronic
1103886423 12:124205112-124205134 TCCTGGAGGCTGGGGAGTTCAGG - Intronic
1104932846 12:132348897-132348919 TTCTGAGGCCTGGGGAGTCCTGG - Intergenic
1104977256 12:132557748-132557770 CCCAGGGGGCTGGGGAGTTGGGG - Intronic
1105515116 13:21082666-21082688 TTCTGCAGGCTGGAAAGTTCAGG + Intergenic
1108363812 13:49691211-49691233 CTCTCTGGGATGGGGAGTGCAGG + Intronic
1112468186 13:99663536-99663558 CACTCCAGGCTGTGGAGTTCGGG + Intronic
1112561725 13:100521311-100521333 CGCTGCCGGCTCGGGACTTCAGG - Intronic
1112767414 13:102760710-102760732 CTTTGTGGGCAGGGGAGTACGGG - Intergenic
1112771786 13:102800412-102800434 CTCTGCGGGCTGGGGACTCGGGG + Intronic
1113180232 13:107616768-107616790 CACTGTGGGGTGGGGAGTACTGG - Intronic
1113536099 13:111067371-111067393 CTCTGCGGCCCGGTGAGATCGGG + Intergenic
1118190684 14:63577414-63577436 CTCTGAAGGCTAGGAAGTTCGGG - Intergenic
1118303950 14:64639050-64639072 CCCTGTGTGCTGGGGAGTGCAGG + Intergenic
1118820627 14:69343224-69343246 CTCTGAGGGGTGGAGTGTTCTGG - Intronic
1121119832 14:91369689-91369711 CTCTTCGGGGCGGGGAGTCCTGG + Intronic
1122149261 14:99715974-99715996 CTCTGCGGACTGGGGAGGGCGGG + Intronic
1122777396 14:104126953-104126975 CTCTCCAGGCTGGGGCGGTCAGG + Intergenic
1125180564 15:36878153-36878175 CTCTGCGGGCTGAGCGCTTCAGG + Intergenic
1125720024 15:41840856-41840878 CTCTGCGGGCTGGGGAGTTCCGG + Exonic
1128637718 15:69313873-69313895 CTCTGCCAGCTGGGGAGTCCTGG + Intronic
1128724184 15:69975608-69975630 CTCTGAAGGCTGGGGAGACCTGG - Intergenic
1128791204 15:70435188-70435210 AGCTGCGTGCTGGGGAGTCCTGG + Intergenic
1129220639 15:74129851-74129873 CACGGTGGGCTGGGGACTTCAGG - Exonic
1131055280 15:89371269-89371291 CTCTCCGGCCTGTGGAGATCCGG - Intergenic
1131560762 15:93437359-93437381 TTCTGGGGGCTGGGAAGTCCTGG - Intergenic
1132856038 16:2044927-2044949 CCCTGTGGGGTGGGGAGGTCTGG + Intronic
1132944789 16:2526955-2526977 TTGTGTGGGTTGGGGAGTTCAGG + Intronic
1133353568 16:5119328-5119350 GTCTGGGGGCTGGGGACCTCTGG + Intergenic
1136287560 16:29253393-29253415 CTCTGCAGCCTGGGGAGGTGGGG - Intergenic
1136544805 16:30948988-30949010 CTCTGCGGGCCCGGGACTGCGGG + Intergenic
1138108823 16:54307138-54307160 CTCTGCTGGCTGGGGTGTCATGG - Intergenic
1138181723 16:54945068-54945090 CACAGCGGGGTGGGGAGTTGGGG + Intergenic
1138973251 16:62171347-62171369 TTCTGGAGGCTGGGAAGTTCAGG + Intergenic
1139691662 16:68645563-68645585 CCCTGCGGTGTGGGGAGTGCAGG + Intronic
1141950975 16:87339167-87339189 CTCTGCTGGCTGAGAACTTCTGG - Intronic
1142132273 16:88436522-88436544 CTCTCCAGGCTGGGGGGCTCGGG - Exonic
1142366170 16:89650945-89650967 CTCAGTGGGCTGGGAAGGTCTGG + Intronic
1142967717 17:3591616-3591638 CTCTGCCTGCTCGGGAGCTCGGG + Intronic
1143294397 17:5859866-5859888 CTCTGCGGGCTTGGTACTGCTGG + Intronic
1143372715 17:6450273-6450295 CACTGCGGGGTGGGGGGTGCTGG - Intronic
1143714712 17:8758544-8758566 CTCTGGTTGCTTGGGAGTTCAGG - Exonic
1145762626 17:27434730-27434752 CTCTGAGGGCTGGGGATATCAGG + Intergenic
1147382424 17:40063425-40063447 CGCGGCGGGCGGGGGAGCTCCGG - Intronic
1147891192 17:43718292-43718314 GTCGGCGGACTGGGGAGTGCAGG - Intergenic
1147996703 17:44363596-44363618 CCCTGCGGGCTGGGGGGCTCCGG + Exonic
1148559161 17:48596248-48596270 CTGTGCGGGCGGGGGCGTCCAGG + Exonic
1150160768 17:62895967-62895989 CTCTGAGGGATGGGGAGCTCTGG - Intergenic
1153926566 18:9839935-9839957 CGCTGCGGGATGGGGAGGGCGGG - Intronic
1161439874 19:4284847-4284869 CTCCGCAGGCTGGGGGCTTCTGG - Exonic
1165152786 19:33770805-33770827 CTCAGCTGGCTCTGGAGTTCTGG - Intronic
1165388600 19:35526029-35526051 CTCTCCTGGCTGGGCAGTGCAGG + Intronic
1166317794 19:41998610-41998632 CTCCAGGGGCTGGGGACTTCGGG - Exonic
1167199608 19:48055229-48055251 CTAGGTGGGCTGGGGAGTGCGGG - Intronic
1167734947 19:51288459-51288481 TTCTGAAGGCTGGGAAGTTCAGG + Intergenic
1168110501 19:54189261-54189283 CTCTGCGGGCTGGCGGGTGCGGG - Intronic
925046556 2:777277-777299 GGCTGCGGGCTGGGGAGATTTGG - Intergenic
925982853 2:9191211-9191233 CTCTGCCCACTGGAGAGTTCAGG + Intergenic
926367495 2:12146469-12146491 CTCTGGGGGCTGGGGTGAGCTGG - Intergenic
927359926 2:22221321-22221343 CTCTGAAGGCTGGGAAGCTCAGG + Intergenic
927611212 2:24543105-24543127 TTCTGCAGGCTGGGAAGTTCAGG + Intronic
928004766 2:27554433-27554455 CTCTGGAGGCTGGGAAGTCCAGG + Intronic
930156451 2:48111826-48111848 CGCTGCGGTCTCGGGTGTTCAGG - Intergenic
931176280 2:59858220-59858242 CACTGCGGGCTGGGGAGTTAAGG - Intergenic
931753460 2:65350891-65350913 CTGAGAGGGCTGGGGACTTCAGG - Intronic
933805877 2:85997799-85997821 CTCCTGGGGCTGAGGAGTTCGGG - Intergenic
934859140 2:97749465-97749487 CCCTGCTGGCTTTGGAGTTCCGG + Intergenic
935102797 2:100012601-100012623 CTCTGCAGGCTGGTGAGCACCGG - Intronic
935147507 2:100405877-100405899 CTCTGTGGTCTGTGGAGTGCTGG - Intronic
936267682 2:111022881-111022903 CTCTGTGGCCTGGGAAGATCTGG + Intronic
936539140 2:113336081-113336103 CTCTCCGGGCTTGGGATTTAGGG - Intergenic
936970180 2:118169485-118169507 CACTGCAGGCTGTGGAGCTCAGG + Intergenic
938650947 2:133382812-133382834 CTCTGTAGTCTGGAGAGTTCAGG + Intronic
939022363 2:136974346-136974368 CTGTGCGGGGCGGGGGGTTCAGG - Intronic
939289522 2:140176028-140176050 GTCTGCTGTCTGGGGAGTACTGG - Intergenic
941454062 2:165694722-165694744 TTCTGTGGTGTGGGGAGTTCAGG - Intergenic
942131098 2:172880226-172880248 CTCCGCGCTCTGGGGAGCTCAGG + Intronic
942555205 2:177165796-177165818 CTCTGGGAGCTGCGGAGGTCTGG + Intergenic
942675424 2:178421689-178421711 ATCTGCGGGCTAGGTACTTCAGG - Intergenic
942919922 2:181359989-181360011 CCCTGTGGGCTGGGGAGTCTAGG + Intergenic
942928061 2:181457236-181457258 CTCTGCGGGCTGGGAGGCCCGGG + Exonic
943420434 2:187661870-187661892 CTCTGTCGGCTGGGTAGCTCAGG + Intergenic
943767419 2:191677990-191678012 CTCTGCGGGCTGCGGCGGCCGGG + Intergenic
948640563 2:239373327-239373349 CCCTGGGGGCTGGGGAGTTTGGG + Intronic
948936255 2:241166877-241166899 CTCTGTGGGCTGGGAAGTAGGGG - Intronic
1169292952 20:4368347-4368369 CCCTGATGGTTGGGGAGTTCTGG - Intergenic
1171297530 20:24031750-24031772 CTCTGGGTGGTGGGGAGTTTGGG + Intergenic
1172671966 20:36640882-36640904 CTCTGGGGGCTGGGGAGGTGGGG + Intronic
1172908660 20:38388995-38389017 CTCTGCGGGCTGGGAGATGCAGG - Intergenic
1174047195 20:47741848-47741870 CACTGGGGGCTGCGGAGTGCAGG - Intronic
1174698679 20:52585900-52585922 ATCTGCTGGGTGGGGATTTCTGG - Intergenic
1175070555 20:56330019-56330041 ATCTTCAGGCTGGGGAGGTCTGG + Intergenic
1175301866 20:57948682-57948704 CGCTCCGGGCTTGGAAGTTCAGG - Intergenic
1176108421 20:63400144-63400166 GTCTGAGGGCCGGGGACTTCTGG - Intergenic
1177853208 21:26373408-26373430 CTGTGGGGGCTGGGGAGCTAGGG - Intergenic
1178446032 21:32643329-32643351 CACTGCGGGGTGGGGAGGTGGGG + Intronic
1178847372 21:36184769-36184791 CTCTGCGGGCTGCGGGGAACAGG + Intronic
1179875912 21:44267329-44267351 CGCTGGGGGCTGGGGAGCCCCGG + Intergenic
1184036287 22:41919860-41919882 CTCTGCGCCCTCGGGAGTCCGGG - Intergenic
1184649189 22:45911851-45911873 CTCTGCGGGGTGGGGACTGTTGG + Intergenic
1184668014 22:45998633-45998655 CTCTGCGGGCCGGGCAGGGCTGG - Intergenic
1184694558 22:46132199-46132221 CTCTGTGGGGTGGAGAGTGCCGG - Intergenic
1184779071 22:46637192-46637214 CTCTGCAGCCTGAGGAGATCAGG + Intronic
1185094650 22:48799750-48799772 TTCTGCAGGCTGGGAAGTTCAGG + Intronic
1185217102 22:49607591-49607613 CTCTGTGGCCTTGGGAGTCCTGG - Intronic
949920101 3:8993591-8993613 CTCAGAGGTCTGGGGACTTCGGG + Intronic
954627459 3:52030373-52030395 CTCTAAGGGCTGGAGTGTTCAGG + Intergenic
954713590 3:52516538-52516560 CACTGAGGGCTGGTGATTTCTGG - Exonic
955018050 3:55090777-55090799 CTCTGAGGGCTGGGTGGCTCTGG - Intergenic
956237533 3:67090867-67090889 TTCTGGAGGCTGGGAAGTTCAGG - Intergenic
961295936 3:125884410-125884432 GTCTGGGGGCTGGGGACCTCTGG - Intergenic
962462931 3:135631287-135631309 GTCTGCTGGCTGGGGATTCCAGG - Intergenic
965317700 3:167211798-167211820 CTCTGTTGGCTGGAGAGTTTGGG - Intergenic
966315717 3:178643654-178643676 TCCTGTGGGCTGGGGAGATCAGG - Intronic
966620251 3:181955585-181955607 CTTTGTGGGCTGGGAAGTGCAGG - Intergenic
966919258 3:184601731-184601753 CTCTGCGGGCTGGGGCTCCCGGG - Intronic
969871304 4:10106824-10106846 CTCTGCGAGCTGAGGAGCTGGGG - Intronic
971254528 4:25002181-25002203 CTGTGCAGGCTGGGGATCTCAGG - Exonic
976194133 4:82516969-82516991 CTAAGCGTTCTGGGGAGTTCGGG - Intronic
976336668 4:83895782-83895804 TTCTGGAGGCTGGGAAGTTCAGG + Intergenic
977067178 4:92332991-92333013 CTCTGGGGGCTGTATAGTTCTGG + Intronic
979542245 4:121898248-121898270 ATCTGCGGGTTGGGGACTCCTGG - Intronic
979722774 4:123921333-123921355 TTCTGCAGGCTGGAAAGTTCAGG + Intergenic
983484061 4:168312888-168312910 TACTGTGGGCTGGGGAGTTTAGG + Intronic
984856155 4:184197932-184197954 CTCTGGGTGCTGGGAAGTCCAGG + Intronic
990509666 5:56479226-56479248 TTCTGCAGGCTGGGAAGTCCAGG + Intronic
990645561 5:57839916-57839938 CTCAGAGGGCTCAGGAGTTCAGG - Intergenic
993900920 5:93584122-93584144 CTCGCCGGGCTCGGGAGTGCGGG - Exonic
994802444 5:104396353-104396375 CTTGCCAGGCTGGGGAGTTCCGG - Intergenic
999776230 5:154814757-154814779 CTCTCTGGGCTGGGGAGTAAAGG - Exonic
1000235309 5:159353733-159353755 CTCTGAGGGTAGGGGAGTTGAGG + Intergenic
1004082182 6:12405763-12405785 TTCTGATGGCTGGGAAGTTCAGG + Intergenic
1004605661 6:17192880-17192902 TTCTGGAGGCTGGGGAGTCCAGG + Intergenic
1005421097 6:25652107-25652129 CTCTGCGCTTTGGGGAATTCAGG - Intergenic
1006100100 6:31681277-31681299 TTCTGTGGGCTCCGGAGTTCAGG - Intronic
1007687169 6:43673805-43673827 CTGAGCGGGAGGGGGAGTTCAGG - Intronic
1012121044 6:95367114-95367136 CTCTGAGTTCTGGGGAGATCTGG - Intergenic
1013481726 6:110558628-110558650 CTCTGTGGGCTGGGCTATTCTGG - Intergenic
1017067284 6:150540758-150540780 CTCAGGGGGCTGGGGAGCTCTGG - Intergenic
1017724551 6:157267902-157267924 CTCTGCCGGCTGGGGAGTTCTGG + Intergenic
1018434264 6:163746985-163747007 CTGTGCTGGCTGCAGAGTTCTGG + Intergenic
1018757495 6:166862758-166862780 CGCGGCGGGCTGGGGAGGTGGGG - Intronic
1020078773 7:5275417-5275439 CTCTCCGGCCTGGGGTGTCCTGG + Intronic
1021414029 7:20361410-20361432 CTCTGGAGGCTGGGGAGTCCAGG + Intronic
1024204287 7:47142714-47142736 CTCTGAGTGCTGTGGAGTGCAGG - Intergenic
1025200123 7:56956768-56956790 CTCTCCGGCCTGGGGTGTCCTGG - Intergenic
1025671821 7:63620164-63620186 CTCTCCGGCCTGGGGTGTCCTGG + Intergenic
1027978520 7:85187144-85187166 TTCTGCACGCTTGGGAGTTCTGG - Intergenic
1028986984 7:97016862-97016884 CTCTTCCGGCTGGAGAGCTCAGG + Intergenic
1031652770 7:124311451-124311473 CTGTGCGGGGTAGGGAATTCTGG + Intergenic
1032002164 7:128272327-128272349 CTAGGCTGGCTGGGGGGTTCGGG - Intergenic
1032035248 7:128516924-128516946 CAGTGAGTGCTGGGGAGTTCTGG + Intergenic
1037784751 8:21895988-21896010 CTCTGCTGGCTTGGGCCTTCAGG - Intergenic
1038267047 8:26045656-26045678 CTCTGCGGGCTGGGGACGCAGGG + Intergenic
1039555061 8:38469227-38469249 CACTGCAGGCTGGAGACTTCTGG - Intergenic
1043614920 8:82113855-82113877 CTCTGGAGGCTGGGAAGTCCAGG + Intergenic
1045500470 8:102740687-102740709 CTCTGGGGGCTGGGTGGTTATGG + Intergenic
1045803825 8:106133339-106133361 TTCTGCAGGCTGGGAAGTACAGG - Intergenic
1048235234 8:132683421-132683443 CTGTGCTGGCTGGGTCGTTCTGG - Intergenic
1048342975 8:133555048-133555070 CTCTGAGGGCTGGGGAGACAAGG + Intronic
1049530026 8:143149426-143149448 CACTGTGGGCTGGGGGATTCAGG - Intergenic
1049656946 8:143803224-143803246 CCGTGCGGGCTGGGGAGCTGTGG - Intronic
1050713449 9:8492391-8492413 CTCTAGGGGCTGAGAAGTTCTGG - Intronic
1051036565 9:12754065-12754087 CCCTGAGTGCTGGGGAGTGCTGG - Intergenic
1051170839 9:14316340-14316362 CGCTGGGGGGTGGGGAGTTCGGG + Intronic
1056258518 9:84824689-84824711 CTCTGTGTCCTGGTGAGTTCTGG + Intronic
1056497500 9:87173693-87173715 GTTTGCAGGCTGGGAAGTTCAGG + Intergenic
1056967631 9:91178391-91178413 CCCTGCTGGCTGCTGAGTTCTGG - Intergenic
1057839787 9:98477084-98477106 CTCTGCCAGTTGGGGAGTTTTGG + Intronic
1059541345 9:115133375-115133397 TTCTGGAGGCTGGGAAGTTCAGG + Intergenic
1061921544 9:133785220-133785242 CTCTGCGGGCAGGTGAGCTGGGG - Intronic
1062585460 9:137247495-137247517 GTCTGTGGGCTGGGGAGCCCTGG - Intronic
1185447473 X:266932-266954 CTCTGCTGGTTTGGGGGTTCAGG - Intergenic
1185888787 X:3806057-3806079 CTCAGGAGGCTGAGGAGTTCAGG + Intergenic
1189375747 X:40465234-40465256 CTCTCAGAGCTGGGGAATTCTGG - Intergenic
1189847051 X:45147813-45147835 ATCAGCTGGGTGGGGAGTTCTGG + Intergenic
1189847660 X:45151465-45151487 CTCTGCTGGCTGGGACGTCCTGG - Exonic
1190263983 X:48816641-48816663 CTCTGTGGGCTGGGGAGAGGAGG + Intronic
1190591245 X:52003930-52003952 CTCTGTGGTCTGGGGAGATCTGG + Intergenic
1193046828 X:77062842-77062864 CACTGTGGGCTGGGGAGTTGTGG - Intergenic
1193056203 X:77153834-77153856 AGCTGCGGTGTGGGGAGTTCTGG + Intergenic
1194594102 X:95836553-95836575 CTCTGTGGGCTGGAGAGCACTGG + Intergenic
1197973677 X:132141713-132141735 TTCTGCAGGCTGAGAAGTTCAGG - Intergenic
1198601513 X:138289053-138289075 CTCTGCTGGCTGGGGAGAAGAGG + Intergenic
1198808150 X:140508998-140509020 CTCTGCGTGCTGGGTGGTTTGGG + Intergenic
1200071074 X:153529710-153529732 GGCTGGGGGCTGGGGAGTTGGGG - Intronic
1200105616 X:153710386-153710408 CTCTGCAGGCTGAAGACTTCTGG + Intronic