ID: 1125721385

View in Genome Browser
Species Human (GRCh38)
Location 15:41846769-41846791
Sequence CCTGCAGCCCACTCGGGACG TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 144
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 133}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125721377_1125721385 -7 Left 1125721377 15:41846753-41846775 CCAGCTGCCTGCCCCTCCTGCAG 0: 1
1: 0
2: 10
3: 104
4: 836
Right 1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG 0: 1
1: 0
2: 0
3: 10
4: 133
1125721374_1125721385 28 Left 1125721374 15:41846718-41846740 CCTGTGCCTGCTGGATGTTGGCT 0: 1
1: 0
2: 0
3: 26
4: 205
Right 1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG 0: 1
1: 0
2: 0
3: 10
4: 133
1125721376_1125721385 4 Left 1125721376 15:41846742-41846764 CCTCATCAATACCAGCTGCCTGC 0: 1
1: 0
2: 0
3: 15
4: 164
Right 1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG 0: 1
1: 0
2: 0
3: 10
4: 133
1125721375_1125721385 22 Left 1125721375 15:41846724-41846746 CCTGCTGGATGTTGGCTACCTCA 0: 1
1: 0
2: 0
3: 6
4: 109
Right 1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG 0: 1
1: 0
2: 0
3: 10
4: 133

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125721385 Original CRISPR CCTGCAGCCCACTCGGGACG TGG Exonic
900393901 1:2445302-2445324 CCTGCAGCCTCGTCTGGACGAGG + Intronic
903212071 1:21824089-21824111 CCTGCCGGGCACTCGGGATGGGG - Exonic
913186206 1:116373007-116373029 CCCGCAGCCCTCCCGGGACACGG + Intronic
913534154 1:119755360-119755382 CCTGCAGCCCACGGGGGCGGAGG + Intronic
913576451 1:120180297-120180319 CCTGCAGCCCACCGGAGGCGTGG - Intergenic
914558357 1:148791735-148791757 CCTGCAGCCCACCGGAGGCGTGG - Intergenic
914614478 1:149338495-149338517 CCTGCAGCCCACCGGAGGCGTGG + Intergenic
914827410 1:151145859-151145881 CCTTCAGCCCGCTCGGCCCGGGG - Intronic
915146859 1:153800602-153800624 CATGCAGGCCCCTGGGGACGGGG - Intergenic
917958840 1:180126606-180126628 CTTGCAGCCCACTAGGGGCTTGG - Intergenic
921714242 1:218401826-218401848 CTTGATGCCCAGTCGGGACGCGG - Intronic
922191280 1:223320667-223320689 CCTGCAGCTCACACAGGAAGAGG + Intronic
923388710 1:233492132-233492154 CCAGCAGCTCACACAGGACGTGG + Intergenic
923679748 1:236110068-236110090 CCTACAGCCCACTGGTGACCCGG + Intergenic
1062844094 10:690905-690927 CCTGCGGCCCACTCTGAAAGGGG - Intergenic
1062895582 10:1100909-1100931 CGTGCAGCTCAGTCGGGACGGGG - Intronic
1065871459 10:29959746-29959768 GCTGCAGCCGAGACGGGACGGGG - Intergenic
1071481650 10:86069330-86069352 ACTGCAGCCCTCTCAGGGCGAGG - Intronic
1075673114 10:124277645-124277667 CCTTCAGCCCACTCGGTGCAGGG + Intergenic
1076650234 10:131982212-131982234 CGCGCAGCCCACTCGTCACGCGG - Intergenic
1077382024 11:2248524-2248546 ACTGCAGCCCACTCAGGTGGTGG + Intergenic
1077647264 11:3936674-3936696 GCTGCAGCCCATTCTGGACTTGG + Intronic
1078527445 11:12111251-12111273 GCTGGAGCCCAGTCGGGATGGGG + Intronic
1078547104 11:12254433-12254455 CCTGCAGCCCTCCGGGGACAAGG + Intronic
1079295099 11:19225975-19225997 CCTGCAGCCCACTCCGCTGGAGG - Intronic
1083330020 11:61893120-61893142 CCTGCAGCCCCCTTGGGCCAGGG - Intergenic
1083596624 11:63920781-63920803 CCTGCCGCCCACTGGGGCCCTGG + Intergenic
1083610207 11:64000733-64000755 CCTGCAGCGCGCCCGGGACAGGG - Intronic
1083673743 11:64314252-64314274 TCTGCCGCCCACCCCGGACGCGG - Exonic
1083805327 11:65070142-65070164 GCTGTAGCCCACAGGGGACGAGG + Intronic
1092611748 12:10180248-10180270 CATACAGCCCACTCTGTACGGGG - Intronic
1097011133 12:55954219-55954241 CCTGCTGCCCACTGAGGAGGGGG + Exonic
1100867052 12:98868222-98868244 CCTCCAGCCCCCTCGGGCCCAGG - Intronic
1102254169 12:111406400-111406422 CCTGCAGCCAACTCGGATGGAGG + Intronic
1102907745 12:116689953-116689975 CCTGCAGTTCACCCGAGACGAGG + Intergenic
1104897316 12:132170762-132170784 CCTGCAGCCCCATGAGGACGAGG + Intergenic
1105368860 13:19785453-19785475 CCTGCAGCCCTCTCCAGAAGTGG + Intergenic
1105409765 13:20161530-20161552 CCTGCAGCCGCCTGGGGACGCGG + Intergenic
1107276733 13:38687516-38687538 CCTGCAGCCCCCGCGAGACCAGG - Exonic
1113335048 13:109369675-109369697 CCAGCTTCCCACTCGGGAGGTGG - Intergenic
1116862001 14:50002648-50002670 CCCCCACCCCACTTGGGACGGGG - Intronic
1116973983 14:51095457-51095479 CCGGCAGCCCACTCGCTGCGGGG - Exonic
1117805216 14:59484058-59484080 CCGGCAGCTCGCTCGGGACTAGG + Exonic
1119851685 14:77870874-77870896 CCTGCAGGCCACTCAGGGCTGGG + Intronic
1122035427 14:98945947-98945969 CCAGCAGCTCACTGGGAACGAGG - Intergenic
1122819716 14:104335354-104335376 CCTGCAGCCCAGTGGAGACTGGG + Intergenic
1123758790 15:23417001-23417023 ACTCGAGCCCACTGGGGACGGGG + Intergenic
1123837865 15:24214251-24214273 CCTGCAAGCCACTGGGGAAGTGG - Intergenic
1123866449 15:24523928-24523950 CCTGCAAGCCACTGGGGAAGTGG - Intergenic
1125721385 15:41846769-41846791 CCTGCAGCCCACTCGGGACGTGG + Exonic
1129180178 15:73869338-73869360 CCTACAGCCCAGTGGGGAGGGGG - Intergenic
1129326008 15:74800635-74800657 CCTGGAGGCCACTAGGGACATGG - Intronic
1129525190 15:76209205-76209227 CCTGAAGCCCACCCAGGATGAGG + Intronic
1134452882 16:14374151-14374173 CCTGCCGCCCACTCTGCACCAGG + Intergenic
1134457469 16:14405659-14405681 CCTGGAGCCGCCTGGGGACGGGG - Intergenic
1136363713 16:29798660-29798682 CCTGCAGCTCACAAGGGAGGAGG + Exonic
1139875581 16:70143503-70143525 CCTGCAGTCCACTGGGGATCAGG + Exonic
1140360204 16:74337608-74337630 CCTGCAGACCACTGGGGATCAGG - Intergenic
1141755498 16:85987983-85988005 CCTGGGGTCCACTGGGGACGTGG + Intergenic
1143347193 17:6258519-6258541 CCTGCAGGCCACCCAGGATGGGG - Intergenic
1146058990 17:29594646-29594668 CTTGCAGCCCACCCTGGAGGCGG - Intronic
1146064286 17:29622687-29622709 CCCGCAGCCCGCTCAGGACCAGG - Exonic
1148496041 17:48054189-48054211 CATCCAGCCCACTCAGGACTGGG - Intronic
1149347248 17:55751163-55751185 CCAGCAGCCCGCTCTGGCCGGGG + Exonic
1151979336 17:77499386-77499408 CCTGCAGCCCGGTGGGGGCGGGG - Exonic
1152400872 17:80065463-80065485 CCTGCAGCCAACAGGGGAGGGGG - Exonic
1153514381 18:5890978-5891000 CCTGCAGCCCACCCGAGAGCTGG - Exonic
1158536001 18:58308943-58308965 GGTGCAGCCCACTCAGGACACGG - Intronic
1160569223 18:79805378-79805400 CCTGCCGCGCACTCGGGATGAGG + Intergenic
1160605100 18:80044370-80044392 CATGCAGGCTACTCGGGATGTGG - Intronic
1160691189 19:461226-461248 CCCGCAGCCAAGGCGGGACGGGG + Intergenic
1160838724 19:1136899-1136921 CCTGCAGCCCCATGGGGACCCGG + Intronic
1160919403 19:1512851-1512873 GCTGCAGCCCACACGGGGAGGGG - Intronic
1161403193 19:4077996-4078018 CCTGCAGCCCACCTGCCACGTGG + Intergenic
1162460532 19:10811570-10811592 CCCCCACCCCACTCAGGACGAGG - Intronic
1164498542 19:28792835-28792857 CCTGCTGCCCTCTCCAGACGTGG - Intergenic
1165013279 19:32863914-32863936 CCTGCAGCCCCCACGGGCCTGGG + Intronic
1165080368 19:33302985-33303007 GCTGCAGCCTCCCCGGGACGCGG - Intergenic
1166695306 19:44848428-44848450 CCTGGAGCCCACCCGGTGCGGGG - Intronic
1166995101 19:46716394-46716416 CCTGGAGCCCACCCGGGACCCGG + Exonic
1167696764 19:51019595-51019617 CCTGCACCCCACCCGGGTTGGGG - Intronic
925201338 2:1969590-1969612 CCCGCCTCCCACTCTGGACGGGG + Intronic
926780860 2:16470690-16470712 CCTGCAGTCAACTAGGGACTTGG + Intergenic
927985548 2:27408271-27408293 CCTGAAGCCCACCCGGTAGGTGG + Intronic
934576545 2:95405421-95405443 CCTGCATACCACACGGGAAGTGG - Intronic
934638770 2:96013590-96013612 CCTGCATACCACACGGGAAGTGG - Intergenic
934781461 2:96972092-96972114 CCTGCAGCACCCTCGGGTTGAGG + Exonic
934794881 2:97091822-97091844 CCTGCATACCACACGGGAAGCGG + Intronic
935732220 2:106073586-106073608 CCTGCAGCCCACTCGCACCCAGG - Intronic
948550050 2:238765228-238765250 CCTGCAGCCCTCTCCGGTGGTGG + Intergenic
948852420 2:240714958-240714980 CCTGCAGAGCACTCGCGGCGTGG - Exonic
948950037 2:241243518-241243540 CCTGCAGCTCAGTCGGGGCCTGG + Intronic
948950046 2:241243576-241243598 CCTGCAGCTCAGTCGGGGCCTGG + Intronic
949043479 2:241859682-241859704 CCTCCAGCCCACTCGTGCCAGGG + Intergenic
1171896489 20:30814191-30814213 CCTGGGGCCCGCTCAGGACGGGG + Intergenic
1175891425 20:62317721-62317743 CCTGCAGGCCACTCTGCATGCGG - Exonic
1175939695 20:62532328-62532350 CCTGCAGCCAACTCGGTTCCTGG - Intergenic
1179580069 21:42337966-42337988 CCTGCAGCCCAATGGGCAAGTGG - Intergenic
1183075775 22:35426005-35426027 CCAGCATCCCACTCAGGCCGAGG - Intergenic
1183985661 22:41568867-41568889 CCTGCAGCCCACTTAGCATGAGG + Intronic
1184149080 22:42628167-42628189 CCAGCAGCCCACTGGGGCCCCGG + Exonic
1185317178 22:50184279-50184301 CCTGCAGGCCACCCGAGCCGGGG + Intergenic
950773701 3:15332339-15332361 CCTGCCGCCTGCCCGGGACGAGG - Exonic
954223955 3:49171171-49171193 CCTGGAGGCCACTGGGGACATGG - Intergenic
954305006 3:49721013-49721035 CCTGCAGCCCACCAGTGAGGAGG + Exonic
960149916 3:114239053-114239075 CCTGCAGACCACTCGTCACGGGG - Intergenic
964118714 3:153161571-153161593 CCTGCAGCTCTCTCGGGGCAGGG - Intergenic
968502518 4:957519-957541 GCTGCAGCCCTCTCTGGCCGAGG - Intronic
969405987 4:6992120-6992142 CCAGCAGCCCACTCAGGGTGAGG + Intronic
969457183 4:7306783-7306805 CCTGCACCCCTCCAGGGACGGGG - Intronic
971199681 4:24500589-24500611 CCTGCACCTCACTCTGGACAGGG - Intergenic
972430431 4:38976202-38976224 CCTTCAACTCACTCGGGAGGCGG + Intronic
975557580 4:75680023-75680045 CCTGCAGCCCACTGAGGGCTAGG - Intronic
980562962 4:134501909-134501931 CCTGCAGCCCACCTGGCCCGAGG + Intergenic
982055047 4:151540310-151540332 CCTGCAGCCAACTTGGGAAGAGG + Intronic
985610479 5:885146-885168 CCAGCAGCACACTCGAGTCGGGG + Intronic
990288455 5:54325115-54325137 CCTGCATCCCACTAGGAACGGGG - Intergenic
990373893 5:55150428-55150450 CCTGCAGCCCCCAGGGGGCGAGG + Intronic
1002100134 5:176853497-176853519 CCTGGAGCCCACTGGGGAAGAGG + Intronic
1006581246 6:35079034-35079056 CCTCAAGCCCACTCGGGGAGGGG - Intronic
1008133034 6:47739991-47740013 CCTGCAGCCCACTCTAGCAGTGG - Intergenic
1029152816 7:98492894-98492916 CCAGCAGCCCCCTCTGGAAGTGG - Intergenic
1031626572 7:123999250-123999272 CCTGCAGCCATCTCAGGATGTGG - Intergenic
1034919976 7:155071579-155071601 CCTGGAGCCCACGCGGAACTTGG - Exonic
1035224000 7:157423774-157423796 CCTGCAGCCCACACTGGCTGTGG + Intergenic
1037593043 8:20329410-20329432 CCTGCAGCCCACCAGGGTCATGG + Intergenic
1039914016 8:41846426-41846448 GCTGCAGCCCACACGGGCCTTGG - Intronic
1046946594 8:119979755-119979777 CCTCCAGGCCACTGGGGAAGGGG + Intronic
1049616973 8:143579868-143579890 CCTACAGCCCACTCGGAGCCAGG + Intronic
1052781464 9:32784627-32784649 CCTGATGCCCATTCTGGACGAGG - Exonic
1057314198 9:93958487-93958509 ACTGCACCCCACTGGGGAGGAGG - Intergenic
1060473773 9:123970315-123970337 CGTGCAGCCCATTCGGGGCTGGG + Intergenic
1060983047 9:127804392-127804414 CCTGCAGCCCACTCCGTGCCAGG - Exonic
1061786251 9:133030375-133030397 CTTGCAGCCCCCTCGGGACTAGG - Intergenic
1062581687 9:137231732-137231754 CCCCCACCCCACTCTGGACGCGG + Exonic
1192213260 X:69140979-69141001 CCTGCAGCCCACTGGTGACAGGG + Intergenic
1192502659 X:71664008-71664030 CCTGCAGCCCAGTGGCGAGGTGG + Intergenic
1192504107 X:71670490-71670512 CCTGCAGCCCAGTGGTGAGGTGG - Intergenic
1192509861 X:71715376-71715398 CCTGCAGCCCAGTGGCGAGGTGG + Intronic
1192510898 X:71719798-71719820 CCTGCAGCCCAGTGGTGAGGTGG - Intergenic
1192515799 X:71761755-71761777 CCTGCAGCCCAGTGGTGAGGTGG + Intergenic
1192516836 X:71766177-71766199 CCTGCAGCCCAGTGGCGAGGTGG - Intronic
1192528999 X:71870501-71870523 CCTGCAGCCCAGTGGTGAGGTGG + Intergenic
1196883812 X:120224044-120224066 TCTGCAGCCCAGTAGGGTCGGGG + Intergenic