ID: 1125721628

View in Genome Browser
Species Human (GRCh38)
Location 15:41847829-41847851
Sequence TGCAGCGGAGGCGGCAGCGC AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 828
Summary {0: 1, 1: 1, 2: 5, 3: 76, 4: 745}

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125721622_1125721628 12 Left 1125721622 15:41847794-41847816 CCAGGAGCAGCTGCTGGAGGCTC 0: 1
1: 0
2: 8
3: 58
4: 487
Right 1125721628 15:41847829-41847851 TGCAGCGGAGGCGGCAGCGCAGG 0: 1
1: 1
2: 5
3: 76
4: 745

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125721628 Original CRISPR TGCAGCGGAGGCGGCAGCGC AGG Exonic