ID: 1125722070

View in Genome Browser
Species Human (GRCh38)
Location 15:41849994-41850016
Sequence CTGGCGCCTGCAGATGGTCT GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 172
Summary {0: 1, 1: 1, 2: 3, 3: 17, 4: 150}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125722070_1125722077 9 Left 1125722070 15:41849994-41850016 CCCAGACCATCTGCAGGCGCCAG 0: 1
1: 1
2: 3
3: 17
4: 150
Right 1125722077 15:41850026-41850048 CTCCTTCCTCCAGCTTCTGGAGG 0: 1
1: 2
2: 25
3: 199
4: 935
1125722070_1125722081 26 Left 1125722070 15:41849994-41850016 CCCAGACCATCTGCAGGCGCCAG 0: 1
1: 1
2: 3
3: 17
4: 150
Right 1125722081 15:41850043-41850065 TGGAGGCTCAGCACAGCCTTAGG 0: 1
1: 0
2: 3
3: 29
4: 242
1125722070_1125722076 6 Left 1125722070 15:41849994-41850016 CCCAGACCATCTGCAGGCGCCAG 0: 1
1: 1
2: 3
3: 17
4: 150
Right 1125722076 15:41850023-41850045 CTGCTCCTTCCTCCAGCTTCTGG 0: 1
1: 0
2: 10
3: 58
4: 566

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125722070 Original CRISPR CTGGCGCCTGCAGATGGTCT GGG (reversed) Intronic
900241437 1:1619391-1619413 CTGGCCCCTCCAGAGGGTCCAGG + Intronic
900288167 1:1911696-1911718 ATGGTCCCTGCAGGTGGTCTAGG - Intergenic
900457331 1:2783602-2783624 GCGGCACCTGCAGCTGGTCTAGG + Exonic
900480500 1:2895868-2895890 CTGGCGGCTGCAGGTGGTTCTGG - Intergenic
901559451 1:10058657-10058679 CTGCCGCCTGCAGGTGGGCAAGG + Intronic
902842310 1:19082736-19082758 CTGCTGCCTGCAGATGGGCATGG + Intronic
903137714 1:21320224-21320246 CTGGAGCCTGGAGATAGTCGTGG - Intronic
903270604 1:22185929-22185951 CTGGTGCCTGCAGGTGCCCTGGG - Intergenic
905284291 1:36869201-36869223 CTGGAGCCTGTAGGTGGGCTGGG + Intronic
905824930 1:41020312-41020334 CTGGCGCCTGCAGACGGCCCTGG - Exonic
907483265 1:54759102-54759124 CTGGCGGCTGCAGGTGGCCAGGG + Exonic
907593312 1:55696595-55696617 TTGGCTACTGCAGATGATCTTGG + Intergenic
908514084 1:64874647-64874669 CTGTAGCCTACAGATGGCCTGGG - Intronic
913075477 1:115337903-115337925 CTGGCGCCTGCAGAAGCCCACGG - Intronic
915362277 1:155293334-155293356 CTGGCACCTGCAGATTGCCCGGG - Exonic
917307246 1:173639241-173639263 CTGGCAACTGGAGATTGTCTAGG - Intronic
917623013 1:176817336-176817358 CTGGAGTCTGCAGAGAGTCTTGG + Intronic
917968917 1:180195057-180195079 CAGGCGCCTGCACTTGGTCGTGG + Intronic
920650923 1:207836796-207836818 CTGGGGCCTGCAGAAGGACCAGG + Intergenic
922724195 1:227914922-227914944 CTGGGGGCTGCAGAGGGCCTAGG - Intergenic
922780541 1:228249525-228249547 TGGGCGCCTTCTGATGGTCTGGG - Intronic
922795932 1:228339844-228339866 CTGGCCCCTGCACAAGGGCTGGG - Intronic
923287443 1:232509926-232509948 GTTGTGCCTGCAGATGGGCTCGG - Intronic
1062786557 10:269954-269976 CTGGAGGATGCAGATGGTCCTGG + Intergenic
1062834962 10:629432-629454 CTGGGTCCTGCCGCTGGTCTGGG - Intronic
1063586550 10:7358018-7358040 CTGGGCCATGCAGATGTTCTAGG - Intronic
1064540128 10:16396816-16396838 GTGGCGTATGCAGGTGGTCTCGG - Intergenic
1065076710 10:22087316-22087338 CTGGGGCCTGCAGATGTGCTTGG + Intergenic
1065605497 10:27413918-27413940 CCGGTGCCTGCAGATGGCCGTGG + Exonic
1067062834 10:43086796-43086818 CAGGCCGCTGCAGCTGGTCTGGG + Intronic
1068507502 10:57920930-57920952 CTGTTGCCTGCAGCTGATCTAGG + Intergenic
1069024156 10:63521695-63521717 CTCGGGCCTGCCGAGGGTCTGGG + Intronic
1069566509 10:69466946-69466968 CCAGCGCCTGCAGCTGGCCTGGG + Intronic
1069611392 10:69774881-69774903 CTGGTCCCTGCTGATGGTCATGG + Intergenic
1070768259 10:79068565-79068587 CTGGGGCCTGCAGGGGGGCTGGG + Intergenic
1071573435 10:86710214-86710236 ATGGAGCCTGCATCTGGTCTGGG + Intronic
1077552733 11:3208530-3208552 GTGGAGCCTGCAGATGCGCTTGG - Intergenic
1078084959 11:8228392-8228414 CAGGCGCCTGCAGATGAGCTTGG + Intronic
1080743256 11:35084891-35084913 CAGGCCCCTGCAGAGGGTGTGGG - Intergenic
1081754218 11:45533034-45533056 CTTGGGCCTGAAGATCGTCTTGG + Intergenic
1082982467 11:59136246-59136268 CGGGTGCCTCCAGAGGGTCTTGG + Intergenic
1082982615 11:59137287-59137309 CGGGCGCCTTGAGAGGGTCTTGG + Intergenic
1084426323 11:69086270-69086292 CTGGCCCCAGCTGATGGTCCTGG + Intronic
1087111487 11:94474263-94474285 TTGGCACCTCAAGATGGTCTAGG - Intronic
1089457098 11:118632085-118632107 CTGGGGCCTTCAGTTGGCCTAGG - Intronic
1089747962 11:120630137-120630159 CTGTAGCCTGCAGCTGGGCTGGG - Intronic
1090995620 11:131863372-131863394 CTGGTGTCAGCAGATGTTCTTGG + Intronic
1093989998 12:25579448-25579470 CTGGCATCTGCAGAAGGTCCTGG + Intronic
1097700748 12:62817879-62817901 CTCTCCCCTGCTGATGGTCTTGG + Intronic
1102601914 12:114037705-114037727 CTGGCGGCTGCAGCTGCCCTGGG + Intergenic
1105439247 13:20402123-20402145 CTGGGAACTGCAGATGGCCTTGG + Intergenic
1106029534 13:25987636-25987658 CTGGTGGCTACAGGTGGTCTTGG - Intronic
1106757206 13:32834785-32834807 CTGTTGCCTGCAGCTGGTGTGGG - Intergenic
1107263292 13:38520459-38520481 CAGGCGCCTGCAGCTGATTTGGG + Intergenic
1112500148 13:99936664-99936686 CTGGATCCTGAAGTTGGTCTGGG - Intergenic
1122251286 14:100441583-100441605 CTGGGGCCTGCAGATGGGCTGGG + Intronic
1123220790 14:106853544-106853566 ATGGGGCCTGAGGATGGTCTTGG - Intergenic
1125722070 15:41849994-41850016 CTGGCGCCTGCAGATGGTCTGGG - Intronic
1126096653 15:45095177-45095199 TTGGTGTCTGCAGGTGGTCTGGG - Intronic
1126253616 15:46598310-46598332 CTGGTGCATGTAAATGGTCTTGG + Intergenic
1129356640 15:74996112-74996134 CTAGCGCCTGCAGGTGGACCCGG + Intronic
1129946116 15:79540617-79540639 CTCCAGCCTGCAGATGGACTTGG - Intergenic
1132674291 16:1115260-1115282 CTGGCTTCTGAAGATGCTCTGGG + Intergenic
1132751788 16:1461018-1461040 CCGGGGCCTGCAGGCGGTCTGGG - Intronic
1137013161 16:35344461-35344483 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137019867 16:35414648-35414670 CTGGGGCCTGCAGGTGGCCCTGG - Intergenic
1137445756 16:48531166-48531188 CTGGCTTCTGCAGATGTTGTCGG + Intergenic
1137611600 16:49821848-49821870 TTGGAGGCTGCAGAGGGTCTGGG - Intronic
1138542989 16:57699662-57699684 CTGGGGCCTACAGAGGTTCTGGG - Intronic
1138628456 16:58272799-58272821 CTGGCACCAGAAGATGCTCTAGG + Intronic
1139512030 16:67432978-67433000 CTAGTACCTGCAGATGGCCTGGG - Intronic
1141624110 16:85252501-85252523 CTGGCGCCTGCAGATGGGCTTGG - Intergenic
1142178376 16:88655525-88655547 TTGGCTCCTGCACGTGGTCTTGG + Intronic
1142747480 17:1967112-1967134 CTGGGGCCTGCAGAGGGGCCTGG - Intronic
1142759192 17:2033616-2033638 TTGGATCCTCCAGATGGTCTTGG - Exonic
1143450937 17:7036335-7036357 CCGGCTCCTGCAGAGGCTCTGGG + Exonic
1144406580 17:14957869-14957891 ATGGGGCCTGCAGATAGACTAGG + Intergenic
1144621712 17:16822472-16822494 CTGGCGGCTGCAGGTGCTCATGG + Intergenic
1144884708 17:18450242-18450264 CTGGCGGCTGCAGGTGCTCATGG - Intergenic
1144993100 17:19247585-19247607 CTGGCTCCTGCAGCTGGTGACGG + Intronic
1145147519 17:20494135-20494157 CTGGCGGCTGCAGGTGCTCATGG + Intergenic
1147573699 17:41586814-41586836 CTGGCGGCTGCAGGTGGTCATGG + Exonic
1147577814 17:41612668-41612690 CTGGCGGCTGCAGGTGGTCATGG + Exonic
1147747194 17:42702043-42702065 CTGGAGCCTACAAGTGGTCTGGG - Exonic
1147818623 17:43228506-43228528 CCGGCGCCGGCAGATGGCTTTGG - Intergenic
1147831906 17:43303208-43303230 CCGGCGCCGGCAGATGGCTTTGG - Intergenic
1149791222 17:59479119-59479141 CTGGCGCTTCCAGAATGTCTTGG + Intergenic
1151662519 17:75526157-75526179 CTGGCGCCTGCACGTGGGCCCGG - Intronic
1152246702 17:79188278-79188300 CTGGCCCCGGCAGCTGGGCTGGG - Intronic
1155402786 18:25457416-25457438 CTGTCTCCTGCAGAGGGTCATGG - Intergenic
1157901979 18:51526716-51526738 CAGGGGCCTGCAGGTGGTCCTGG - Intergenic
1160927813 19:1555521-1555543 CTGGCCCCCGCAGATGGCCCCGG + Exonic
1161008337 19:1947690-1947712 CTGGAGCCTGCAGGTGGGCTGGG + Intronic
1161558386 19:4957193-4957215 CTGGGGCCTGCAGTGGCTCTGGG + Intronic
1165824694 19:38699033-38699055 CTGGCCCCTGCAGATGGAGGGGG + Intronic
1166077696 19:40423254-40423276 CTGGGGGCTGCAGGTGGGCTAGG + Exonic
1168423051 19:56217670-56217692 CTGGCGCCTGCGGATCTTCTGGG + Intergenic
925265510 2:2563820-2563842 CAGGCGGCTGCAGAGGCTCTTGG + Intergenic
926941120 2:18138241-18138263 CTGGTGCCTGCTGATGGGCAAGG - Intronic
932668845 2:73719401-73719423 CGGGGGCCTGTAGCTGGTCTGGG + Intergenic
936372789 2:111917112-111917134 CTGGGGCCTGCAGAAAGTCAGGG - Intronic
936732894 2:115405443-115405465 CTGGTGCCTGCAGATTTCCTAGG + Intronic
942487645 2:176456115-176456137 TGGGAGCCTGCAGCTGGTCTGGG + Intergenic
943441738 2:187934390-187934412 TTGGAGACTGCAGCTGGTCTTGG + Intergenic
948981492 2:241497035-241497057 CTGGGGCCTCCACATGGGCTGGG + Intronic
1169898510 20:10529903-10529925 CTGTAGACTGCATATGGTCTTGG - Intronic
1171252800 20:23662382-23662404 CTGCCGCCTGCACATGGGCTGGG + Intergenic
1171257101 20:23697767-23697789 CTGGAGCCTGCAGATGGGCTGGG + Intergenic
1171259279 20:23717699-23717721 CTGCTGCCTGCACATGGGCTGGG + Intergenic
1171264460 20:23759622-23759644 CTGGAGCCTGCAAATGGGCTGGG + Intergenic
1171274258 20:23842272-23842294 CTGGAGCCTGCAGATGGGCTGGG + Intergenic
1171781980 20:29427783-29427805 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1173035200 20:39402253-39402275 CTGGGGCCTGTAGATGTGCTTGG + Intergenic
1173131395 20:40397529-40397551 CTGGGGCTTGCAGAAGGGCTAGG - Intergenic
1174199364 20:48796471-48796493 CAGGCCCCTTCAGATAGTCTGGG - Intronic
1175791479 20:61742972-61742994 CTGATGCCTGCAAATGGCCTTGG - Intronic
1176019044 20:62953287-62953309 CTGGAGCCTGCAGCTGGACGGGG + Intronic
1176932432 21:14829525-14829547 CTGGAGCCTTCAGATGAACTAGG + Intergenic
1180720363 22:17903364-17903386 CTGGTGCCTGCAGGTGCTCATGG - Intronic
1183468111 22:37990264-37990286 CTGGTGCAAGCAGAGGGTCTCGG + Intronic
1184461369 22:44640026-44640048 CTGGCCCCTGCTGGTGTTCTGGG - Intergenic
1184461382 22:44640063-44640085 CTGGCCCCTGCTGGTGGCCTGGG - Intergenic
1184461394 22:44640100-44640122 CTGGCCCCTGCTGGTGGCCTGGG - Intergenic
1184461408 22:44640137-44640159 CTGGCCCCTGCTGGTGGCCTGGG - Intergenic
1184461420 22:44640174-44640196 CTGGCCCCTGCTGGTGGCCTGGG - Intergenic
1184461434 22:44640211-44640233 CTGGCCCCTGCTGGTGGCCTGGG - Intergenic
1185150623 22:49161734-49161756 CTGGGCCCTGCGGATGGTCTGGG + Intergenic
950479019 3:13233386-13233408 CTGGCGGCTGCAGACCGTCCTGG + Intergenic
950566721 3:13773584-13773606 CTGGGGCCTGCAGATCATCTGGG + Intergenic
950633235 3:14297978-14298000 CTGACGCCCGCAGATGGGCAGGG + Intergenic
953134727 3:40172709-40172731 CTGGTGGCAGCAGGTGGTCTGGG - Intronic
953679092 3:45026318-45026340 CTGCTGCCTGCAGCGGGTCTGGG - Exonic
953786906 3:45917760-45917782 CTTGAGCCAGCAGATGTTCTGGG - Intergenic
954863002 3:53705790-53705812 CTGTCTCCTCCAGAGGGTCTGGG - Intronic
981449905 4:144884993-144885015 CTGGCAAATGCAGATGGGCTGGG + Intergenic
983229013 4:165111382-165111404 CTGGAGCCTGGGGATGGTCTGGG - Intronic
985950199 5:3217214-3217236 CTGGGTCCTGAAGGTGGTCTGGG - Intergenic
992269879 5:75053351-75053373 CTGCCGCCTGGAGATGGACGCGG + Intergenic
997297645 5:132777644-132777666 CTGGAGCCTGCAAATGTGCTGGG + Intronic
999297179 5:150467042-150467064 ATGGGTCCTGCAGAGGGTCTGGG - Intergenic
1002518281 5:179775079-179775101 CTGATGCCAGCAGATGGGCTGGG - Exonic
1004785848 6:18966431-18966453 CTGGAGCCTGAAGACAGTCTAGG + Intergenic
1010020797 6:71157703-71157725 CTGTCCCCTGCACATGGTCTTGG - Intergenic
1013013216 6:106138254-106138276 CTGGTGCCAGCCCATGGTCTAGG - Intergenic
1014158936 6:118144424-118144446 CTGGGGCCTGCAGGGGGTCGGGG + Intronic
1020125729 7:5531581-5531603 CAGCGGCCTCCAGATGGTCTGGG - Intronic
1026321720 7:69274240-69274262 GTGACGTCTGCAGTTGGTCTTGG + Intergenic
1034435396 7:151060651-151060673 TGGGCGCCTGCAGGTGCTCTGGG + Intronic
1034877996 7:154742187-154742209 CTGCTTCCTGCAGGTGGTCTTGG - Intronic
1036212296 8:6852303-6852325 CTGGAGGCTGAGGATGGTCTTGG + Intergenic
1037183832 8:16037851-16037873 CTGGCTGTTGCAGATGGTTTTGG + Intergenic
1038372425 8:27007463-27007485 CTGGAGACTGCAGATGGGCCAGG + Intergenic
1040386583 8:46918414-46918436 CTGGTTCCTGCAGAGGCTCTGGG - Intergenic
1040864462 8:52034190-52034212 CGGGAGCCTGCAGATGGGCAGGG - Intergenic
1041460704 8:58108648-58108670 CTGGCGCCTGAGGACGGTCATGG - Intronic
1043510849 8:80948881-80948903 CTTGAGGCTGCTGATGGTCTGGG + Intergenic
1045506384 8:102781647-102781669 CTGGGTCGTGCAGAGGGTCTGGG + Intergenic
1048979035 8:139693263-139693285 CTGGCGCCAGCAGCTGGCCTTGG + Intronic
1056757056 9:89388543-89388565 CTGGGGCCTGCTCATGGGCTGGG - Intronic
1059953281 9:119490064-119490086 CTGGCGCCTTGAGATTGGCTAGG - Intergenic
1060185998 9:121564586-121564608 CTGGTGCCTGCAGCTAGCCTGGG + Intergenic
1061932403 9:133839997-133840019 CTGGTGCCTGAAGATGGCCTCGG - Intronic
1062291917 9:135799265-135799287 CTTGAGCCTGGAGCTGGTCTGGG - Intergenic
1062453346 9:136624682-136624704 CTGGCGGCTGGAGCAGGTCTGGG - Intergenic
1203441768 Un_GL000219v1:16008-16030 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1203512578 Un_KI270741v1:134917-134939 CCGGGGCCTGCAGGTGGTCCTGG - Intergenic
1185467237 X:362223-362245 CTGGGGCCTGCAGATATACTGGG - Intronic
1188079263 X:25815726-25815748 CTGCAGCATGCAGATGGTCTGGG + Intergenic
1190708732 X:53050263-53050285 CTGGCCCCTGCAGGTTGTCATGG - Intronic
1192157839 X:68759544-68759566 CTGGACCCTGCAGAAGGTCCTGG - Intergenic
1198413500 X:136395377-136395399 CTGTCTCCTACAGATGGGCTGGG + Exonic
1198974580 X:142321914-142321936 TTGGGCCCTGCAGATGGTCTTGG + Intergenic