ID: 1125722222

View in Genome Browser
Species Human (GRCh38)
Location 15:41850828-41850850
Sequence GGCTTCAGGGGAAGGATGCG GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 344
Summary {0: 1, 1: 0, 2: 2, 3: 30, 4: 311}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125722222_1125722229 -3 Left 1125722222 15:41850828-41850850 CCCCGCATCCTTCCCCTGAAGCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1125722229 15:41850848-41850870 GCCCACCTGCAGTGCTGCCCAGG 0: 1
1: 0
2: 2
3: 39
4: 320
1125722222_1125722238 28 Left 1125722222 15:41850828-41850850 CCCCGCATCCTTCCCCTGAAGCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1125722238 15:41850879-41850901 CCAGCTCTCAGCCTGCTCTTCGG 0: 1
1: 0
2: 3
3: 32
4: 327
1125722222_1125722231 -2 Left 1125722222 15:41850828-41850850 CCCCGCATCCTTCCCCTGAAGCC 0: 1
1: 0
2: 2
3: 30
4: 311
Right 1125722231 15:41850849-41850871 CCCACCTGCAGTGCTGCCCAGGG 0: 1
1: 0
2: 6
3: 34
4: 376

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125722222 Original CRISPR GGCTTCAGGGGAAGGATGCG GGG (reversed) Intronic