ID: 1125722358

View in Genome Browser
Species Human (GRCh38)
Location 15:41851415-41851437
Sequence GCGTGGACAGGCCCTAGCTC TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 103
Summary {0: 1, 1: 0, 2: 0, 3: 10, 4: 92}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125722358_1125722367 20 Left 1125722358 15:41851415-41851437 CCAGAGCTAGGGCCTGTCCACGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1125722367 15:41851458-41851480 TCCCAGGAAAAGCGGTGGATTGG 0: 1
1: 0
2: 1
3: 9
4: 129
1125722358_1125722365 12 Left 1125722358 15:41851415-41851437 CCAGAGCTAGGGCCTGTCCACGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1125722365 15:41851450-41851472 GTGGAGCTTCCCAGGAAAAGCGG 0: 1
1: 0
2: 1
3: 23
4: 285
1125722358_1125722360 -7 Left 1125722358 15:41851415-41851437 CCAGAGCTAGGGCCTGTCCACGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1125722360 15:41851431-41851453 TCCACGCCTCACCATGTGTGTGG 0: 1
1: 0
2: 0
3: 5
4: 111
1125722358_1125722364 4 Left 1125722358 15:41851415-41851437 CCAGAGCTAGGGCCTGTCCACGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1125722364 15:41851442-41851464 CCATGTGTGTGGAGCTTCCCAGG 0: 1
1: 0
2: 1
3: 17
4: 177
1125722358_1125722366 15 Left 1125722358 15:41851415-41851437 CCAGAGCTAGGGCCTGTCCACGC 0: 1
1: 0
2: 0
3: 10
4: 92
Right 1125722366 15:41851453-41851475 GAGCTTCCCAGGAAAAGCGGTGG 0: 1
1: 0
2: 0
3: 28
4: 221

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125722358 Original CRISPR GCGTGGACAGGCCCTAGCTC TGG (reversed) Intronic
900786548 1:4653899-4653921 GCCTGGCCAGGCCCTTGCTCCGG - Intergenic
901240595 1:7690901-7690923 GCAAGGACAGGCTCTAGCCCTGG - Intronic
903349949 1:22711311-22711333 GCGTGGGCAGCCCCCAGCCCTGG - Intronic
904160361 1:28518371-28518393 GCGTGGACCGGCCCGTGCTCCGG - Intronic
905324172 1:37138711-37138733 GCATGGACAGGCCAGAGCTAGGG - Intergenic
906319778 1:44808759-44808781 GCCTGGCCAGGCCCTAGAGCTGG - Exonic
908171004 1:61504634-61504656 GCATGGGCAGGCACCAGCTCTGG - Intergenic
910546350 1:88423250-88423272 GGGTGGATAGGCCCAACCTCAGG - Intergenic
915318870 1:155045036-155045058 GGGAGGGCAGGCCCTGGCTCAGG + Intronic
915601860 1:156927550-156927572 GCGTGGACAGCGCCTGGCCCAGG - Exonic
1066649399 10:37640423-37640445 CCTTGGACAGGCCCTGGCCCAGG + Intergenic
1069840785 10:71338079-71338101 CTGTGGACAGGCCCTGGCCCAGG - Intronic
1070932470 10:80271111-80271133 GTGTGGACAGGACTCAGCTCTGG - Intergenic
1071289346 10:84177221-84177243 TGGCGGACAGGCCCAAGCTCAGG + Intronic
1071500534 10:86200490-86200512 GCCTGGCCAGGCCATAGCTGTGG + Intronic
1076521895 10:131086496-131086518 GCATGGAGAGGCCCCAGCTGAGG - Intergenic
1077146943 11:1050637-1050659 GCGGGGACAGGCCCGAGGTGCGG + Intergenic
1079822783 11:25151834-25151856 GCCTGGACATCCCCAAGCTCAGG + Intergenic
1082661755 11:55920490-55920512 GCTTGGACAGCCCTTAGTTCTGG - Intergenic
1085593759 11:77789881-77789903 GGGTAGACAGGCCCAACCTCAGG - Intronic
1086647780 11:89246096-89246118 GACTGGACAGGCACTAGCTTAGG + Intronic
1091548159 12:1518378-1518400 GGGTGGCCAGGGCCTGGCTCAGG + Intergenic
1091750902 12:3020703-3020725 GCGTGGCCAGCTCCAAGCTCTGG + Exonic
1102519206 12:113468488-113468510 GCCTGGGCAGGCCGTAGCTTGGG - Intronic
1102624741 12:114225986-114226008 GACTGGACAGACCTTAGCTCAGG - Intergenic
1104602629 12:130163419-130163441 GCGGGAACAGGCCCGAGCCCCGG - Exonic
1112284640 13:98093516-98093538 CTGGGGACAGACCCTAGCTCAGG - Intergenic
1116167354 14:41350425-41350447 GCATGGAGAGCCCCTAGGTCTGG - Intergenic
1118749426 14:68795446-68795468 GCGGGGACAGGCCCTGGGCCGGG - Intronic
1121224484 14:92311263-92311285 GCCTGGACAAGCCCTCGTTCTGG - Intergenic
1122023796 14:98859936-98859958 GTGTGTCCAGGCCCTGGCTCAGG - Intergenic
1122885558 14:104708888-104708910 GCCTGGACAGCCCCTAGCTGGGG - Intronic
1123477258 15:20598685-20598707 GGGAGGACAGGCCCCAGCTCTGG - Intergenic
1123640755 15:22401679-22401701 GGGAGGACAGGCCCCAGCTCTGG + Intergenic
1125722358 15:41851415-41851437 GCGTGGACAGGCCCTAGCTCTGG - Intronic
1132743923 16:1428930-1428952 GCTTGGCCAGGCCCTGGCTGTGG - Intergenic
1137003990 16:35255598-35255620 GCGTGGGCGGGGCCGAGCTCAGG - Intergenic
1139552274 16:67680971-67680993 GGGTGGCCAGGCCCTTGCACGGG + Intronic
1139592625 16:67941977-67941999 GGGGGGTCTGGCCCTAGCTCTGG + Intronic
1145398355 17:22512881-22512903 GCCTGGACTGCCCCAAGCTCTGG - Intergenic
1147115668 17:38297381-38297403 AGGTGGACAGGACCTAGCTGCGG + Intronic
1148414013 17:47492239-47492261 AGGTGGACAGGACCTAGCTGCGG - Intergenic
1152446967 17:80350779-80350801 GGGAGGACAGGCTCTTGCTCTGG - Intronic
1152890584 17:82879505-82879527 GCGTTGCCAGGCCATCGCTCGGG + Intronic
1155807642 18:30192309-30192331 GAGTGAACAAGCCCAAGCTCAGG + Intergenic
1161255749 19:3308315-3308337 GGAGGGACAGGCCCTAACTCGGG - Intergenic
1162267113 19:9584654-9584676 GCGCGGACAGGCCCTTACTTGGG + Intergenic
1162345541 19:10116056-10116078 GCCTGCACCGGCTCTAGCTCTGG + Exonic
1164675870 19:30101031-30101053 ACGTGGACATCCCTTAGCTCAGG + Intergenic
1168271855 19:55254462-55254484 GCTTGGACAGGCACTAACTGCGG + Intronic
925914919 2:8597959-8597981 GCATGGAAATGCCCTGGCTCAGG + Intergenic
932715830 2:74100324-74100346 GCCTGGAGAGGCCCTGGGTCGGG - Intronic
934490873 2:94761401-94761423 GCTTGGACCGTCCCTAGCTTGGG - Intergenic
934783888 2:96990646-96990668 GTGTGTGCAGGCACTAGCTCAGG + Intronic
938278796 2:130050548-130050570 GCTTGGACCATCCCTAGCTCGGG - Intergenic
938329772 2:130441409-130441431 GCTTGGACCATCCCTAGCTCAGG - Intergenic
938360174 2:130680094-130680116 GCTTGGACCATCCCTAGCTCAGG + Intergenic
946190762 2:218006649-218006671 GTGAGGACAGGCCCCAGCTGAGG + Intergenic
946386134 2:219385635-219385657 GCATTGAGAGGCCCTGGCTCAGG + Exonic
946444687 2:219728176-219728198 GCATGGAGAGCCGCTAGCTCAGG - Intergenic
947366595 2:229402859-229402881 GGGTGGACAGGACCTAGGCCAGG + Intronic
947518727 2:230828431-230828453 ACCTGGCCACGCCCTAGCTCCGG - Intergenic
948510017 2:238457870-238457892 GCGTGGACATGACCTAGCTTCGG + Intergenic
1169812683 20:9624655-9624677 TTGTGGAAAGGCCCTGGCTCTGG + Intronic
1170745986 20:19099307-19099329 CCCTGCACTGGCCCTAGCTCAGG + Intergenic
1175725673 20:61316801-61316823 GGGTGGCCAGGCCCCAGCTCTGG - Intronic
1176029750 20:63006198-63006220 GCGCGGCCAGGCCCTGGCCCTGG + Exonic
1178673919 21:34614979-34615001 GCGTGGCCGGTCCCCAGCTCGGG - Exonic
1179812824 21:43883321-43883343 GCGAGGACAGGCCCTCTCCCTGG - Intronic
1180957548 22:19747690-19747712 GCCTGGACAGGCCCCACCCCCGG + Intergenic
1181496793 22:23291840-23291862 GCCTGGCCAGGCCCTGGCTGTGG + Intronic
1182255022 22:29031747-29031769 GCGTGGCCAGTCCCTAGGACCGG + Intronic
1182395624 22:30033889-30033911 CCGTGGAGAGGGACTAGCTCAGG - Intergenic
1183262852 22:36807083-36807105 GTGTGGACTTTCCCTAGCTCTGG - Intronic
1184031051 22:41894960-41894982 GCGTGGACAGGTCCTAAGGCAGG - Intronic
1184783998 22:46663044-46663066 GCGAGGACAGCCCCTGGCTCCGG - Exonic
952784258 3:37136983-37137005 GCGGGGACAGGCTCTCACTCTGG + Intronic
954717666 3:52534326-52534348 GAGTGGACTGGCCCGGGCTCTGG - Intronic
954800922 3:53186491-53186513 GCAGGGACAGGCCCTGGCTGAGG - Intronic
965860323 3:173141126-173141148 GCGGGGACAGGGCGAAGCTCTGG + Exonic
968626817 4:1629520-1629542 GCCTGGACAGGCCCAACCCCAGG - Intronic
969688216 4:8688750-8688772 GAGTGCACAGGCCCGTGCTCTGG + Intergenic
973648942 4:52978260-52978282 GCGAGCACAGTCCCTTGCTCTGG - Intronic
981782494 4:148444145-148444167 GCGTGCCCAGGCTCTAGGTCCGG - Intronic
997607546 5:135185942-135185964 ACGTTGTCAAGCCCTAGCTCAGG + Intronic
998175699 5:139900735-139900757 GCCTGGGCAGGCCCTAGCCCTGG - Intronic
1004431611 6:15549959-15549981 GCGTAGTCAGGATCTAGCTCTGG - Intronic
1005738606 6:28771297-28771319 GAATGGACAGATCCTAGCTCAGG - Intergenic
1006022631 6:31126431-31126453 GTGTGGACAGGCCCCAGGACAGG - Intronic
1007470722 6:42088584-42088606 GCCTGAGCAGGCCCCAGCTCTGG + Intergenic
1018245167 6:161815690-161815712 GAGTGGCCAGGCCCTGGTTCAGG + Intronic
1019173502 6:170148024-170148046 GCGTGTCCAGGGCCGAGCTCGGG - Intergenic
1019544528 7:1567177-1567199 GCGTGCACAGGCCCAAGCATGGG + Intergenic
1022328530 7:29355610-29355632 GGGTGCGCAGGCCCTGGCTCAGG + Intronic
1026980051 7:74521120-74521142 CAGTGCACAGGCCCTGGCTCTGG - Intronic
1029274828 7:99397819-99397841 GCAGGGACAGGCCCCAACTCTGG - Intronic
1058937114 9:109779943-109779965 GCGTGGACACGCGCTTGCTGGGG - Intronic
1059578032 9:115512909-115512931 GCATGAACAGGGCCTTGCTCAGG + Intergenic
1185462319 X:339132-339154 GCGTGGACTGGGACTAGCGCAGG + Intronic
1186139095 X:6552276-6552298 GGGTGGACTAGCCCTGGCTCGGG + Intergenic
1187071803 X:15895957-15895979 TCGGGGAAAGGCCCTAGCTGAGG - Intergenic
1192451825 X:71249701-71249723 TGGTGGCCAGGCCCTAGCTCAGG - Intronic
1201620858 Y:15956030-15956052 GGGTGGACTAGCCCTAGCTTGGG + Intergenic