ID: 1125723578

View in Genome Browser
Species Human (GRCh38)
Location 15:41856834-41856856
Sequence TCCCCGGGTGGGCCCACACC TGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 163
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 148}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125723567_1125723578 16 Left 1125723567 15:41856795-41856817 CCTTGGCTGAGAAGCCCTGCTCA 0: 1
1: 3
2: 6
3: 58
4: 479
Right 1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG 0: 1
1: 0
2: 2
3: 12
4: 148
1125723570_1125723578 1 Left 1125723570 15:41856810-41856832 CCTGCTCATGTGCGAGGCCAGCC 0: 1
1: 0
2: 1
3: 14
4: 140
Right 1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG 0: 1
1: 0
2: 2
3: 12
4: 148
1125723566_1125723578 22 Left 1125723566 15:41856789-41856811 CCATTTCCTTGGCTGAGAAGCCC 0: 1
1: 0
2: 1
3: 25
4: 245
Right 1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG 0: 1
1: 0
2: 2
3: 12
4: 148
1125723569_1125723578 2 Left 1125723569 15:41856809-41856831 CCCTGCTCATGTGCGAGGCCAGC 0: 1
1: 0
2: 0
3: 9
4: 107
Right 1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG 0: 1
1: 0
2: 2
3: 12
4: 148

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125723578 Original CRISPR TCCCCGGGTGGGCCCACACC TGG Exonic
900154366 1:1198118-1198140 TCCGCGGCTGGGCCCAGTCCTGG + Intergenic
900171466 1:1271143-1271165 TCCCCAGGAGGGCCCCCACCAGG + Intronic
900293944 1:1939319-1939341 TCCCCTGCTGGGGCCACACAAGG - Intronic
900390996 1:2433856-2433878 TCCACGGATGTGCCCACACTGGG + Intronic
903069617 1:20720724-20720746 CCCCCGGCAGGGCCCACATCAGG + Intronic
903700946 1:25247747-25247769 GCCCCGCGTGGGGCTACACCAGG + Intronic
905402849 1:37716065-37716087 TCCCAGGGTGAGCTCAGACCAGG + Exonic
905866946 1:41381844-41381866 TCCCCGAGTGCGCCCGCCCCGGG + Exonic
915064212 1:153211177-153211199 TCCCAGGTTGGGCCCACAGTAGG + Intergenic
917497598 1:175555358-175555380 TCTCAGGCTAGGCCCACACCTGG + Intronic
919263948 1:195237571-195237593 TCCTCGAGTGTGCACACACCTGG - Intergenic
922809834 1:228409274-228409296 TCCTCCGGTGGGCACACACAGGG + Exonic
923804957 1:237247636-237247658 TCCCATGGTGTGCCCACTCCTGG - Intronic
924179392 1:241424900-241424922 GCCCCGTGTGTGCACACACCTGG - Intergenic
924948751 1:248863727-248863749 TGCCCGAGTGTGCGCACACCCGG - Intergenic
1066963472 10:42241836-42241858 TCCCGGGCTGCGCCGACACCTGG + Intergenic
1075586464 10:123662004-123662026 TCTCCTGGTGGGCACACTCCAGG + Intergenic
1076726689 10:132417172-132417194 TCCCCGGGGGGCCTCACACCAGG - Exonic
1076821843 10:132943401-132943423 TCCCCTAGTGTGCCCACCCCGGG - Intergenic
1076823834 10:132957409-132957431 CCTCAGGGTGGGCCCGCACCTGG + Intergenic
1077269097 11:1666641-1666663 TCCCCGGATGGGGCCGCCCCGGG + Intergenic
1077271450 11:1684073-1684095 TCCCCGGATGGGGCCGCCCCGGG - Intergenic
1077323049 11:1950972-1950994 TCCTCGGGCTGGGCCACACCGGG - Exonic
1077337638 11:2012553-2012575 TCCCCGGGCGGGTCCCCACCTGG + Intergenic
1078107266 11:8366181-8366203 TCCCCTGATGGGCCCACTCCAGG - Intergenic
1083823145 11:65183589-65183611 TCCCCAGGGGAGCCCTCACCTGG - Exonic
1090933848 11:131324300-131324322 GCCCTGGGTGGGAGCACACCTGG - Intergenic
1202806034 11_KI270721v1_random:6167-6189 TCCTCGGGCTGGGCCACACCGGG - Intergenic
1202820622 11_KI270721v1_random:67735-67757 TCCCCGGGCGGGTCCCCACCTGG + Intergenic
1091583613 12:1803418-1803440 TCCCCAGATGCGCCCACACCAGG + Intronic
1092569562 12:9708032-9708054 TGCCTGGGTGTGCCCACAGCAGG + Intergenic
1096106342 12:48998648-48998670 TCCCGGGCGCGGCCCACACCTGG + Exonic
1102505981 12:113384891-113384913 ATCCCGGGTGGGCCCAGCCCCGG + Exonic
1103511907 12:121480806-121480828 TCCCATGCTGGCCCCACACCCGG + Intronic
1121769404 14:96519201-96519223 TACAGGGGTGAGCCCACACCTGG + Intronic
1124653358 15:31488558-31488580 TCCCCTGCAGGCCCCACACCTGG + Intronic
1125723578 15:41856834-41856856 TCCCCGGGTGGGCCCACACCTGG + Exonic
1125937369 15:43648777-43648799 TCCCGGGGTGAGCCGAAACCTGG - Exonic
1125950276 15:43746198-43746220 TCCCGGGGTGAGCCGAAACCTGG - Intergenic
1128374680 15:67066357-67066379 CCCCCGGGCGGGCCCCCACCTGG - Exonic
1129412348 15:75356884-75356906 TCCAGCGATGGGCCCACACCTGG + Exonic
1131177255 15:90217823-90217845 CCCACAGGTGAGCCCACACCTGG + Exonic
1131261896 15:90891935-90891957 TCCCCACGTGGTCCCACCCCTGG + Intronic
1131827245 15:96331421-96331443 TCCCTGGGCGCGCCCGCACCCGG + Exonic
1132670514 16:1100555-1100577 TCTCCGGGTGGGCCCCATCCTGG + Intergenic
1132794469 16:1712647-1712669 TCCCCAGGTGGCCCCCCACTGGG + Intronic
1136487534 16:30583022-30583044 TCCACAGGCGGGCTCACACCGGG - Exonic
1137580792 16:49632400-49632422 TCCCCAGGTGTGCCCACACAGGG + Intronic
1138221807 16:55258181-55258203 ACCCAGGGTGGGGCCACACAAGG + Intergenic
1143625911 17:8110059-8110081 TGCCCCGCTGGGCCCCCACCCGG + Intronic
1145211403 17:21015830-21015852 GCCTCGCGTGGGTCCACACCAGG + Exonic
1145248563 17:21285126-21285148 CCCCCGCCTGGGCCCTCACCTGG + Intronic
1146439844 17:32884248-32884270 TTCCCGGGTGGGCCAAGATCGGG + Intergenic
1147319314 17:39636498-39636520 TCCCCGGTGGGGCACACAGCGGG + Exonic
1147466458 17:40614850-40614872 TCCCCAGCTGCACCCACACCAGG - Intergenic
1147550337 17:41437439-41437461 TCCACAGGTGGGCCCACAGGTGG + Exonic
1148688319 17:49513000-49513022 TCCCCGGTTGGGCTCACACCGGG - Exonic
1151551831 17:74826780-74826802 TCCCAGAGAGGGCACACACCTGG + Intronic
1151882271 17:76902916-76902938 TCCCCAGGTGGCCTCACTCCTGG - Intronic
1152516450 17:80827591-80827613 CCCCAGGGAGGGGCCACACCTGG + Intronic
1154376028 18:13810646-13810668 GGCCCGGGTGGTCCCAGACCTGG - Intergenic
1155268190 18:24114081-24114103 TCCCCGTGTGCGCCCAGCCCTGG - Intronic
1156269414 18:35517267-35517289 TGCCCTGGTGGCACCACACCTGG + Intergenic
1157433663 18:47651241-47651263 TCTCCTGCAGGGCCCACACCTGG - Intergenic
1159004441 18:63000129-63000151 TCCCAGGCTGGGCGCACACATGG - Intergenic
1160681216 19:412437-412459 TCCCTGGTGGGGCCCCCACCTGG - Intergenic
1160700077 19:501887-501909 TCCCAGGCTGGGCCCACGCAGGG + Exonic
1161943316 19:7419262-7419284 ACCCCAGGTGTGCCCACACTCGG + Intronic
1161943338 19:7419320-7419342 CACCCGGGTGTGCCCACACTTGG + Intronic
1161943488 19:7419966-7419988 ACCCCAGGTGCGCCCACACTCGG + Intronic
1162821320 19:13225221-13225243 TCCCTGGCTTGGCCCAGACCAGG + Intronic
1164401214 19:27903558-27903580 TCCCCAGGAGGGACCACAGCAGG + Intergenic
1165008260 19:32823908-32823930 TCCCCCGAGGGCCCCACACCAGG - Intronic
1165026671 19:32967618-32967640 TCCCAGGCTGGCCCCAGACCTGG - Intronic
1166314088 19:41978888-41978910 TGCCAGGATAGGCCCACACCAGG + Intronic
925304449 2:2838473-2838495 TCCCCGGGTGAACACACACCAGG - Intergenic
925341215 2:3138762-3138784 TCCCCCAGTGTGGCCACACCTGG + Intergenic
925990622 2:9251381-9251403 TCCCTGTGGGGGCCCAGACCTGG + Intronic
932054809 2:68433135-68433157 TCCCCGAGTGTGTGCACACCTGG + Intergenic
932435546 2:71700827-71700849 TCCCCGGAAGGGGCCCCACCAGG - Intergenic
932487721 2:72094592-72094614 GCCCTGGGTTGGCCAACACCTGG + Intergenic
935822609 2:106909241-106909263 TCCAAGGGAGGGCCAACACCTGG + Intergenic
938157230 2:128952007-128952029 GTCCCAGGTGGGCCCATACCAGG - Intergenic
948656474 2:239479636-239479658 TCTCCGGATGGGGCCACTCCTGG + Intergenic
948762293 2:240199582-240199604 TCCCCGGGCAGCCCCTCACCTGG + Intergenic
948787829 2:240362320-240362342 TCATGGGGTGGCCCCACACCTGG + Intergenic
1171518692 20:25759452-25759474 GCCCAGGGTGGGCCCACAGAAGG - Intergenic
1172771489 20:37384820-37384842 GCCCCGGTTGGGCCCGCGCCAGG + Intronic
1174136764 20:48385261-48385283 TCCCAGCGTGGGCACACAGCGGG - Intergenic
1175418170 20:58815508-58815530 TCCCCAGGACGGCCCCCACCAGG + Intergenic
1175878482 20:62242827-62242849 TCCCCGTATGAGCCCACAACAGG - Intronic
1176297863 21:5083752-5083774 TCCCCTGCTGGGGCCTCACCTGG - Intergenic
1176382608 21:6120742-6120764 ACCCCGGGTGGGCACACGGCAGG + Intronic
1176385082 21:6135083-6135105 TCCCCGGGAGACCCCAGACCTGG - Intergenic
1176652839 21:9565857-9565879 GCCCAGGGTGGGCCCACAGAAGG - Intergenic
1178311077 21:31530617-31530639 CCCCCTGGTGGGCACACACCTGG + Intronic
1179738391 21:43403169-43403191 TCCCCGGGAGACCCCAGACCTGG + Intergenic
1179740861 21:43417497-43417519 ACCCCGGGTGGGCACACGGCAGG - Intronic
1179859166 21:44178197-44178219 TCCCCTGCTGGGGCCTCACCTGG + Intergenic
1182662241 22:31933301-31933323 CACCCTGGTGGGCCCACGCCAGG - Intergenic
1183281700 22:36935859-36935881 TTCCCTGGAGTGCCCACACCTGG + Intronic
1183663687 22:39235454-39235476 TCCCTGGCTGGGCCCACACCTGG + Intronic
1185080611 22:48707586-48707608 TCCCTGGGTGGAGCCACGCCGGG + Intronic
950479745 3:13236963-13236985 GCACTGGGTGGCCCCACACCTGG + Intergenic
953438416 3:42897852-42897874 TCCCCAGGTTGGCCCCCAACTGG + Intronic
960064753 3:113359247-113359269 TTCCTGGGTGGGGTCACACCAGG - Intronic
964472543 3:157070237-157070259 TTCCCGGGTGGGCCCTGCCCTGG - Intergenic
967835077 3:193955815-193955837 GCCCCAGGTGGGCCAACCCCTGG + Intergenic
968065655 3:195757602-195757624 GCCCTGGCTGGGCTCACACCAGG + Intronic
968497315 4:925991-926013 CCCCCGGGTGGGCTCACCACTGG - Intronic
968744830 4:2354152-2354174 TCCCAGGCTGAGCCCACACATGG - Intronic
999204438 5:149837922-149837944 TCCACTGGCCGGCCCACACCCGG + Intronic
999887237 5:155936923-155936945 GCCCCGGGTGTGCGCACACCTGG + Intronic
1001276397 5:170354674-170354696 GCCCCAGATGGGCCCACAGCCGG + Intronic
1002417340 5:179127357-179127379 TGCCATGCTGGGCCCACACCTGG - Intronic
1002606023 5:180383193-180383215 TCCTCAGGTTGGCCCACAGCAGG + Intergenic
1003021705 6:2515422-2515444 TCCCAGGGTGTGGCCACCCCTGG - Intergenic
1003306769 6:4936008-4936030 GGCCTGGGTGGACCCACACCCGG - Intronic
1003642413 6:7887182-7887204 CTCCCTGGTGGGGCCACACCAGG - Intronic
1004202262 6:13560064-13560086 TCCCCTGGTGGTTGCACACCTGG - Intergenic
1006319600 6:33312743-33312765 TCCCCACCTGCGCCCACACCCGG - Intronic
1006505370 6:34485736-34485758 TCCCTGGGTGGGCCCTCACAGGG - Intronic
1007295690 6:40819038-40819060 CCCCTGGGATGGCCCACACCAGG + Intergenic
1007414409 6:41683559-41683581 TCCCCAGGTGGGCGGCCACCCGG - Intergenic
1012419856 6:99052794-99052816 TCCATGGGAGGCCCCACACCTGG - Intergenic
1017470684 6:154734199-154734221 GACCCGGTTGGGCCCTCACCCGG + Intronic
1018795030 6:167179265-167179287 TCCCTGGTTGGGTCCTCACCTGG + Intronic
1018808120 6:167277052-167277074 TCCCCTGATGAGCCCACATCAGG - Intronic
1018821288 6:167375797-167375819 TCCCTGGTTGGGTCCTCACCTGG - Intronic
1019166047 6:170098199-170098221 TCACCGTGAGGGCACACACCCGG + Intergenic
1019181513 6:170190097-170190119 TGCCCTGCTTGGCCCACACCTGG + Intergenic
1019417811 7:935318-935340 TCCCCGGGTGGCCTCAGCCCGGG - Intronic
1019608066 7:1920032-1920054 TCCCCAGGAGGGCGCACAGCAGG + Intronic
1019616646 7:1965965-1965987 TCCCTGGGTCGGCCCATGCCTGG + Intronic
1021637926 7:22709574-22709596 TCCCCGGGTGGGGGCAGGCCTGG - Intergenic
1025279185 7:57614569-57614591 GCCCAGGGTGGGCCCACAGAAGG - Intergenic
1025305546 7:57850931-57850953 GCCCAGGGTGGGCCCACAGAAGG + Intergenic
1026023405 7:66727715-66727737 TCCCCAGGTGTGCCCACTTCTGG - Intronic
1026888205 7:73966907-73966929 TCCCCGGGCGTGCCCACTTCTGG - Intergenic
1027189329 7:75988561-75988583 TCCCGGGGTGGGGGCACACATGG - Intronic
1029147780 7:98458866-98458888 TCCCCAGGTGGGCCGAGGCCTGG - Intergenic
1032083053 7:128869604-128869626 TCCCGGCGTGGGGACACACCCGG + Intronic
1034276472 7:149826090-149826112 GTCCCTGGTGTGCCCACACCAGG + Intergenic
1035263386 7:157675410-157675432 CGCCCGGGTGAGCCAACACCCGG - Intronic
1035725539 8:1823402-1823424 TCCTCGGCTGGGCGCACCCCGGG + Intergenic
1045975961 8:108131147-108131169 TCCCAGGGTGGGCTGAGACCTGG + Intergenic
1046187079 8:110734989-110735011 TACCCGAGTGTGCGCACACCTGG + Intergenic
1049158929 8:141084918-141084940 GCCCCGGGAGGGCCCAGACTCGG + Intergenic
1049284421 8:141766942-141766964 TGCTGGGGTGGGCCCACCCCAGG + Intergenic
1049408442 8:142461911-142461933 TCCCGGGGTGAGCCCAGTCCTGG - Intronic
1051929016 9:22363552-22363574 TCCCCGGGTGGGCTCCCAAGCGG - Intergenic
1052772189 9:32699892-32699914 TCCCGTGGGAGGCCCACACCTGG - Intergenic
1054798972 9:69327706-69327728 TCCTCTGGTGTGCCCAGACCTGG - Intronic
1057293870 9:93824386-93824408 GCCCCTGGTGCCCCCACACCCGG + Intergenic
1057908927 9:99003517-99003539 TCCCCCGGTGGGCACACTGCTGG - Exonic
1059442308 9:114315331-114315353 TCCCAGGCTGGGCCAACTCCAGG + Intergenic
1060207589 9:121691309-121691331 TCCCCGGATGTCCCCACACTAGG - Intronic
1061796251 9:133087426-133087448 TCACAGGTTGGGCCCCCACCTGG - Intergenic
1062162215 9:135086975-135086997 GCCCTGGGAGGGCGCACACCCGG - Intronic
1062571182 9:137186105-137186127 GGCCTGGGTGGGCCCAGACCGGG - Intronic
1203630568 Un_KI270750v1:69398-69420 GCCCAGGGTGGGCCCACAGAAGG - Intergenic
1186524760 X:10238292-10238314 ACCCCTGGTGGGCCCCCAGCAGG - Intergenic
1201979453 Y:19891466-19891488 TCCCCTCGTGATCCCACACCAGG - Intergenic