ID: 1125725648

View in Genome Browser
Species Human (GRCh38)
Location 15:41866924-41866946
Sequence CAGTGGAAGGCCCTGGGCTG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 647
Summary {0: 1, 1: 0, 2: 6, 3: 58, 4: 582}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125725636_1125725648 30 Left 1125725636 15:41866871-41866893 CCGCCTCACAGTGTTGCGGTGTG 0: 1
1: 0
2: 1
3: 15
4: 187
Right 1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG 0: 1
1: 0
2: 6
3: 58
4: 582
1125725637_1125725648 27 Left 1125725637 15:41866874-41866896 CCTCACAGTGTTGCGGTGTGAAG 0: 1
1: 0
2: 0
3: 17
4: 116
Right 1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG 0: 1
1: 0
2: 6
3: 58
4: 582

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125725648 Original CRISPR CAGTGGAAGGCCCTGGGCTG GGG Intronic
900351676 1:2238024-2238046 CTGTGCCAGGCGCTGGGCTGTGG + Intronic
900462650 1:2808942-2808964 CGGTGGAAGGTCTGGGGCTGTGG + Intergenic
900566055 1:3332392-3332414 CAGTGGGGGGCTCGGGGCTGGGG + Intronic
902332430 1:15737026-15737048 CAGAGCAAGGCCCTGGGCCAAGG - Intronic
902528465 1:17075004-17075026 CACGGGGAGGCCCTGCGCTGAGG + Intronic
902695712 1:18139493-18139515 GAGGGGAAGGCCCTGGGCTCTGG - Intronic
903002210 1:20274302-20274324 CATGGGAAGACCCTGGGCCGAGG + Intergenic
903133437 1:21293774-21293796 GAATGGAAGGCCCTGGGCGAAGG - Intronic
903972408 1:27127604-27127626 CACTGGAGGGCTCTGGCCTGGGG + Intronic
904012850 1:27399588-27399610 CTGGGGTAGGCCCTGGGATGGGG + Intergenic
904631641 1:31847274-31847296 CAGTGTAAGGCCCTTGGGGGAGG + Intergenic
904771715 1:32884721-32884743 CACTGGAGGGCCCTGGGGTGGGG + Intergenic
904909069 1:33920685-33920707 CAGTGGAGGGTTCTGAGCTGAGG + Intronic
905205637 1:36341410-36341432 CTGGGGAAGGCCCTGGAGTGGGG + Exonic
905284951 1:36873185-36873207 GAGTGCCAGGCCCTGTGCTGGGG - Intronic
905886490 1:41494718-41494740 CTGTGTCAGGCCCAGGGCTGGGG + Intergenic
906207528 1:43995168-43995190 CGGGGGAGGGCCCAGGGCTGCGG - Intronic
906862413 1:49375904-49375926 CAGTGTAAGGGCATGGGCTAAGG - Intronic
908087417 1:60650993-60651015 CAGCGGAAGGCCCTGGGACATGG - Intergenic
908580006 1:65505044-65505066 TAGTAGAAGTCCCTGAGCTGTGG + Intronic
908646042 1:66279037-66279059 CAGGGGAAGGCCTTGCTCTGTGG - Intronic
908766552 1:67559653-67559675 AGGTGGCAGGCACTGGGCTGAGG - Intergenic
909609702 1:77539472-77539494 TAGGGGATGGCCCTGGGCAGGGG - Intronic
909737048 1:78974714-78974736 AAGTGGAAGGCCATGAGCTAAGG - Intronic
909988149 1:82187927-82187949 CAGTCTAAAGCCCTGTGCTGAGG - Intergenic
912493565 1:110076707-110076729 CAGGAGCAGACCCTGGGCTGGGG - Intergenic
912760172 1:112359533-112359555 CAGTGGAAGGGCAGGAGCTGAGG + Intergenic
912762772 1:112383749-112383771 GAGTGGAATGCCAGGGGCTGAGG - Intergenic
913658384 1:120983362-120983384 CAGTGTGAGGCGCCGGGCTGCGG + Intergenic
914009744 1:143766449-143766471 CAGTGTGAGGCGCCGGGCTGCGG + Intergenic
915635540 1:157183998-157184020 CTGAGGCTGGCCCTGGGCTGGGG - Intergenic
915974315 1:160375063-160375085 AGATGGAAGTCCCTGGGCTGAGG + Intergenic
916446778 1:164879937-164879959 CTCTGGAAGTACCTGGGCTGGGG + Intronic
916722283 1:167493476-167493498 CTGTGCCAGGCCCTGTGCTGAGG + Intronic
917285250 1:173416206-173416228 CAGTGGCAGCAGCTGGGCTGTGG + Intergenic
918107190 1:181425291-181425313 AGGGGGAAGGCCCTGGACTGCGG - Intronic
918470611 1:184869075-184869097 CACTGGAATTCCCTGGCCTGGGG - Intronic
919548095 1:198949112-198949134 CAGGGCAAGGGCCTGGGCGGAGG + Intergenic
919759672 1:201089625-201089647 AAGAGGAATGCCTTGGGCTGAGG + Intronic
919901085 1:202044842-202044864 CAGTGCAAGGCGCTGAGGTGGGG - Intergenic
920057181 1:203201323-203201345 CGGTGGCCTGCCCTGGGCTGGGG + Intergenic
920450779 1:206059675-206059697 CAGGGGAAGGCACTTGCCTGAGG - Intronic
920456734 1:206107377-206107399 CAGTGGAAGGGCCTTGGATAGGG - Intergenic
921190552 1:212704318-212704340 CATTGGAAGCCTTTGGGCTGAGG + Intergenic
921687720 1:218109241-218109263 CAGGGGATGGCTCTGGGATGGGG - Intergenic
921691147 1:218152194-218152216 CATTGCAAGCCCCTGGGCTTGGG + Intergenic
921702623 1:218285015-218285037 AAGTGGACCGCGCTGGGCTGGGG + Intergenic
922709377 1:227815754-227815776 CAGCAGAAGGCCCAGGGCAGAGG - Exonic
923541255 1:234889842-234889864 CAGTGAAATGCCTCGGGCTGCGG + Intergenic
924052540 1:240092830-240092852 CCCAGGAAGGCCCCGGGCTGAGG - Exonic
924456008 1:244219502-244219524 CAGTGCCAGGCCCAGTGCTGGGG + Intergenic
1062764513 10:50474-50496 CAGTGCAGGGGCCTTGGCTGTGG + Intergenic
1062873983 10:931219-931241 CACGGGAAGGGCCAGGGCTGAGG - Intronic
1062902231 10:1154964-1154986 CAGTTGCAGGGCCTGGGATGGGG + Intergenic
1065845506 10:29739513-29739535 TAGTAGAAGGGCCTGGACTGAGG - Intergenic
1067057124 10:43058798-43058820 CTATGGGAGACCCTGGGCTGGGG - Intergenic
1068914651 10:62416179-62416201 CTGTGTAAGGACCTGTGCTGAGG - Intronic
1068935945 10:62635949-62635971 GTGTTGCAGGCCCTGGGCTGAGG - Intronic
1069703246 10:70441321-70441343 CAGAGCTAGGCCCTGGGCTCGGG + Intronic
1069776719 10:70931613-70931635 GAGGGGAAGGCACTGGGCCGAGG - Intergenic
1069776737 10:70931723-70931745 GAGGGGAAGGCACTGGGCCGAGG - Intergenic
1069905247 10:71728428-71728450 CAGTGGAGGACTCTGGGGTGGGG - Intronic
1069947825 10:71999709-71999731 CAGTGGAAGGGCCTGGTTGGAGG + Intronic
1070018487 10:72559754-72559776 CAGTCCACGGCCCAGGGCTGGGG - Intronic
1070646473 10:78205386-78205408 GAGTGGAAGGCCCTGCTCTCAGG + Intergenic
1070820213 10:79349953-79349975 CAGTGGCAGGCCCTGCCCGGGGG + Intronic
1070916946 10:80161098-80161120 CAGTGGAGGGCCCTGAGCAGAGG - Intronic
1071949124 10:90682822-90682844 CAGTGGAAGGCACTTGGGGGTGG + Intergenic
1072454359 10:95562852-95562874 TAGGGGAAGGCCGTGGGCTGGGG - Intergenic
1072617953 10:97062319-97062341 CAGTGTGAGGCTCTTGGCTGTGG - Intronic
1073291102 10:102413786-102413808 CAGAGGACAGCCTTGGGCTGGGG - Exonic
1073426393 10:103458010-103458032 CTCCGGATGGCCCTGGGCTGAGG + Intronic
1073482651 10:103796654-103796676 GAGTGGATGGGCCTGTGCTGAGG - Intronic
1073671353 10:105593717-105593739 CAGTGGGAAACCCTGGGTTGGGG - Intergenic
1074215617 10:111381297-111381319 CCGAGTAAGGCCCTGGGCAGGGG - Intergenic
1075442917 10:122493904-122493926 CAGGGGACAGCCCTGGCCTGTGG - Intronic
1075735287 10:124661082-124661104 CAATGGAAGGATCTGGCCTGTGG + Intronic
1075921295 10:126215414-126215436 AAGGGGAAGGCCCTGTCCTGTGG - Intronic
1076246020 10:128948584-128948606 CACAGCAAGGCCCTGGGATGAGG + Intergenic
1076344449 10:129770858-129770880 CAGTCCAAGGCCCTGGGGTGGGG + Intergenic
1076360755 10:129887153-129887175 CTGTTGCAGGCCCAGGGCTGAGG - Intronic
1076630149 10:131847457-131847479 GCGTGGCAGGCCCTGCGCTGTGG - Intergenic
1076714705 10:132357871-132357893 CAGAGGCAGACCCTCGGCTGTGG + Intronic
1076733604 10:132449498-132449520 AGGTGGAAGGCCCTGGGCCCTGG + Intergenic
1076743422 10:132499599-132499621 CAGTGGAAGGTGCTGGGCTGAGG + Intergenic
1076790223 10:132773078-132773100 CGGTGGAGGCCTCTGGGCTGTGG + Intronic
1076902322 10:133346034-133346056 CCGTGGAATGCCCTGGGCTTAGG + Intronic
1077187879 11:1243555-1243577 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188300 11:1245226-1245248 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077188835 11:1247326-1247348 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077189254 11:1248997-1249019 CCGTGGAAGGCTCTGTGATGTGG - Exonic
1077226400 11:1440713-1440735 CTGTGGGAGGCCCTGGGATGAGG + Intronic
1077338796 11:2016991-2017013 CAAAGGGAGGCCCTGGTCTGTGG + Intergenic
1077378354 11:2216013-2216035 CAGGAGAAGGCCCGGGGCAGTGG - Intergenic
1077491863 11:2864604-2864626 CAGTGACATGCCGTGGGCTGGGG + Intergenic
1078059426 11:8033656-8033678 CCGTGCCAGGCCCTGGGTTGGGG - Intronic
1078518882 11:12047656-12047678 CAGTGCCTGGCCCTGGGCAGGGG - Intergenic
1080278052 11:30525060-30525082 CAGTGGGAGGCCTAGGACTGGGG - Intronic
1080606203 11:33866973-33866995 CAGAGTAAGACCATGGGCTGTGG - Intronic
1081631719 11:44694071-44694093 CTGCAGCAGGCCCTGGGCTGGGG + Intergenic
1081633150 11:44702918-44702940 GAGTGGCAGGCCCTAGGCAGGGG + Intergenic
1081809668 11:45907793-45907815 GAGGGAAAGGCCCTGAGCTGGGG - Intergenic
1081989304 11:47329172-47329194 CAGGGGCGTGCCCTGGGCTGGGG - Exonic
1082000199 11:47389947-47389969 CAGGGGAAGGGTCTGGGGTGGGG - Intergenic
1082004245 11:47410890-47410912 CTGTGCCAGGCACTGGGCTGAGG + Intronic
1082813334 11:57491886-57491908 CAGTGGAAGGTCTGGGGCTCAGG - Intronic
1082946883 11:58770741-58770763 CAGGGGAAGGCTCTGGAATGCGG - Intergenic
1083592489 11:63903888-63903910 CAGGGGAAGGGCCAGAGCTGGGG - Intronic
1083627009 11:64077088-64077110 AGGTGGAGGGCACTGGGCTGAGG - Intronic
1083922833 11:65789729-65789751 CAGTGGAGGGCCCAGGAATGTGG + Intronic
1084303578 11:68266927-68266949 CAGCAGAAGGCCTGGGGCTGGGG - Intronic
1084454771 11:69262147-69262169 CATGGGGAGGGCCTGGGCTGTGG + Intergenic
1084647262 11:70465706-70465728 CAGAGGGAGGCCGTGGGCTGTGG + Intergenic
1085174832 11:74476649-74476671 CTGTGGGAGGCCCGGGACTGGGG + Intergenic
1085251263 11:75145350-75145372 CAGTGGCAGAGCCAGGGCTGGGG + Intronic
1085450404 11:76628802-76628824 GTGTGTCAGGCCCTGGGCTGAGG + Intergenic
1087179099 11:95124590-95124612 CCTTGGAAGGCCCAGGGCAGGGG + Intronic
1088882774 11:113984510-113984532 CTGTGCCAGGCCCTGTGCTGGGG - Intronic
1089455143 11:118621545-118621567 CTGTGGCTGGCCCGGGGCTGAGG - Intronic
1089704969 11:120271492-120271514 GAGAGGTGGGCCCTGGGCTGGGG - Intronic
1090387135 11:126363901-126363923 CAGAGGCAAGCTCTGGGCTGGGG - Intronic
1090482532 11:127080855-127080877 CATTGGAAGTCCCTGGGGTGGGG + Intergenic
1091365902 11:135020121-135020143 CAGTGGGAGGTACTGAGCTGAGG - Intergenic
1202821780 11_KI270721v1_random:72173-72195 CAAAGGGAGGCCCTGGTCTGTGG + Intergenic
1091513479 12:1153818-1153840 CAGGGGAAGGCGCAGGGCTGGGG - Intronic
1092288608 12:7144826-7144848 CTGTGGAAGGCCCCGGGCTGTGG + Intronic
1092894387 12:12999026-12999048 CAGTGGAGTGTCCTGAGCTGGGG - Intronic
1093984790 12:25518606-25518628 CAGTGGAAGACACTGTGCTAGGG + Intronic
1094359354 12:29613300-29613322 CAGTGGGAGGCTGTGGCCTGAGG + Intronic
1094814303 12:34168186-34168208 CAGTGCAGGGGCCTTGGCTGTGG + Intergenic
1095102621 12:38200403-38200425 CAGTGCAGGGGCCTTGGCTGTGG - Intergenic
1095986987 12:48005246-48005268 CAGGGGCAGGCCCTGGGAAGGGG + Intergenic
1096523284 12:52195985-52196007 GAGTGGGAGGACCTAGGCTGGGG + Intergenic
1096997621 12:55848698-55848720 CAGTAGAAGGCACCAGGCTGGGG - Intergenic
1097850537 12:64405901-64405923 CAGTGGAAGGCCGGGCGCGGTGG - Intronic
1100735488 12:97524994-97525016 CAGTAGAATGCCCAGGGCTAAGG - Intergenic
1101679186 12:106948201-106948223 CTTTGGAATGCCCTTGGCTGAGG + Intergenic
1102484520 12:113246863-113246885 CAGAGGAAGGGGCTGGACTGGGG + Intronic
1102495125 12:113314385-113314407 CAGGCGAAGCCCCTGGGCTGAGG + Intronic
1102579637 12:113878218-113878240 CAGAGAGGGGCCCTGGGCTGGGG - Intronic
1104898601 12:132176078-132176100 TGCTGGAAGGCTCTGGGCTGAGG - Intergenic
1105213442 13:18271239-18271261 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1106836280 13:33638775-33638797 CTTTGGAATGCCCTTGGCTGAGG + Intergenic
1108209199 13:48121262-48121284 GAATGGGAGGCCCTGGGATGAGG + Intergenic
1108500639 13:51066798-51066820 CAGTGGACGGCCCCAGTCTGTGG - Intergenic
1108587419 13:51882873-51882895 CTGAGCAAGGCCCTGGGCGGAGG - Intergenic
1109074752 13:57821056-57821078 CTGTGGCAGGCCCTGGGCCTGGG - Intergenic
1111987275 13:95077966-95077988 AAGTGGGAAGCCCTGGGTTGGGG + Intronic
1113667882 13:112153578-112153600 CAGTGGCAGGCCCTGTCCGGGGG + Intergenic
1113910189 13:113838050-113838072 CAAGGTAAGGCCCTGGGGTGAGG - Exonic
1115452912 14:33569362-33569384 CAGTTCAAGGCCCTTGGCAGAGG + Intronic
1115641163 14:35336597-35336619 AAGTGGAAGGTCAAGGGCTGGGG + Intergenic
1118603566 14:67487233-67487255 CATTGCAAGGGCCTGGGCTCTGG + Intronic
1119262280 14:73244929-73244951 GAGTGGAAGGCCCTGGGAAATGG - Intronic
1119738789 14:77000516-77000538 CTCTGGAAGGCCCTGCGGTGTGG - Intergenic
1120268011 14:82275821-82275843 CTTTGGAATGCCCTTGGCTGAGG + Intergenic
1120981978 14:90298332-90298354 CAGTGGAGAGCCCCGGGCTGGGG - Exonic
1123001808 14:105299943-105299965 CTGTGGAAGGAGCTGGACTGTGG - Intronic
1124504877 15:30264083-30264105 CAGTGCCAGGCCCTGTGCTGAGG + Intergenic
1124738675 15:32274552-32274574 CAGTGCCAGGCCCTGTGCTGAGG - Intergenic
1125348468 15:38742957-38742979 GGCTGGAAGGCCTTGGGCTGAGG + Intergenic
1125596907 15:40893335-40893357 AAGTGGAAGGCTCTGGACTAGGG - Intergenic
1125725648 15:41866924-41866946 CAGTGGAAGGCCCTGGGCTGGGG + Intronic
1126558994 15:50022791-50022813 CAGGGGAAAGCCTTGGGCTCAGG + Intronic
1127242290 15:57129711-57129733 AAGTGTTAGGCCCTGTGCTGGGG - Intronic
1128080718 15:64855365-64855387 CTGGGGGAGGCCCAGGGCTGAGG + Intronic
1128095282 15:64949578-64949600 CAGGAGAAGGCCTGGGGCTGGGG + Intronic
1128155450 15:65388967-65388989 GTGTGGAGGGCCCTGGGGTGCGG + Exonic
1128791493 15:70437887-70437909 CAGCCCATGGCCCTGGGCTGGGG + Intergenic
1129037285 15:72658373-72658395 AAGTAAGAGGCCCTGGGCTGAGG + Intronic
1129212602 15:74078852-74078874 AAGTAAGAGGCCCTGGGCTGAGG - Intronic
1129237041 15:74229903-74229925 CAGGGGAGGCCCATGGGCTGTGG + Intergenic
1129331924 15:74832251-74832273 CAGGAGGAGGCCCTGGCCTGGGG - Intergenic
1129397797 15:75262227-75262249 AAGTAAGAGGCCCTGGGCTGAGG + Intronic
1129401408 15:75286508-75286530 AAGTAAGAGGCCCTGGGCTGAGG + Intronic
1129468754 15:75738661-75738683 GAGTGGCTGGCACTGGGCTGGGG - Intergenic
1129907437 15:79198536-79198558 CAGTGGCTGGGACTGGGCTGGGG + Intergenic
1132643776 16:989631-989653 CACTGGCAGGGCCTGGGCAGTGG - Intergenic
1132756989 16:1490336-1490358 CCCTCGAAGGCTCTGGGCTGGGG - Intergenic
1132861182 16:2072573-2072595 CAGTGACATGCCCTTGGCTGGGG - Intronic
1133291993 16:4728457-4728479 CAGTGGCAGCCCCTGGCCAGGGG + Intronic
1133701140 16:8310323-8310345 CTGGGGAAGTCTCTGGGCTGGGG - Intergenic
1134049793 16:11129601-11129623 CAGTGCAAGGCCCTGGGGCAGGG - Intronic
1134132168 16:11657323-11657345 CAGTGGCTGAGCCTGGGCTGGGG + Intergenic
1134288376 16:12882269-12882291 CAGAAGAAGGCCCTGAGATGAGG + Intergenic
1135404498 16:22188733-22188755 CTGTGGAAGTTCCTTGGCTGTGG + Intronic
1136019476 16:27430873-27430895 CACTGGTGGTCCCTGGGCTGGGG + Intronic
1136714441 16:32265647-32265669 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136753448 16:32663770-32663792 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1136814665 16:33206595-33206617 TTGTGGATGGCTCTGGGCTGGGG + Intronic
1136821141 16:33316675-33316697 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136827704 16:33373214-33373236 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1136832770 16:33471985-33472007 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1137053927 16:35734601-35734623 CACAGGAAGGCCCCGGGCCGTGG - Intergenic
1137054396 16:35736347-35736369 CACAGGGAGGTCCTGGGCTGTGG - Intergenic
1137673897 16:50294376-50294398 CAGTGATAGGGCCTGGGGTGGGG + Intronic
1137717105 16:50604714-50604736 CACTGGAAGCCCCTGTGCAGAGG - Intronic
1138098780 16:54234976-54234998 AACTGGAAGGACCTGGGGTGTGG + Intergenic
1138339895 16:56281700-56281722 CAGATGTAGGCCCTGGGCTAAGG - Intronic
1139349832 16:66327976-66327998 GGGTGGCAGGCACTGGGCTGGGG + Intergenic
1139478927 16:67217614-67217636 CTGAGGAAGGCACAGGGCTGGGG - Intronic
1139572622 16:67822726-67822748 AAGTGCAAGGCCCTGGGCTGGGG + Intronic
1140073156 16:71670772-71670794 CAGTGCAAGGTCCAGGGCAGTGG + Intronic
1141591408 16:85071496-85071518 CAGGGGAAGGACATGGGCTTTGG + Intronic
1141658894 16:85430993-85431015 CGCCGCAAGGCCCTGGGCTGAGG + Intergenic
1141660080 16:85436872-85436894 CAGTGGGCGGCCCGGGACTGTGG + Intergenic
1141737373 16:85862527-85862549 CAGTGGCAGGCCCTGTCTTGGGG + Intergenic
1141932281 16:87213987-87214009 CCATGGAAGGCTGTGGGCTGTGG + Intronic
1142028572 16:87827264-87827286 CAGTGGAAAGCCCCGGGACGGGG + Intergenic
1142145811 16:88492551-88492573 CAGATGAGGGCCCTGGGCTCTGG - Intronic
1142398352 16:89845775-89845797 GAGAGGAAGGCCCTGCCCTGCGG - Intronic
1142440139 16:90092771-90092793 CAGTGCAGGGGCCTTGGCTGTGG - Intergenic
1202993241 16_KI270728v1_random:29569-29591 TTGTGGATGGCTCTGGGCTGGGG + Intergenic
1203055609 16_KI270728v1_random:924122-924144 TTGTGGATGGCTCTGGGCTGGGG - Intergenic
1142467519 17:144751-144773 CAGTAGAGGGCCCTGGACTGGGG + Intergenic
1142598535 17:1041271-1041293 GAATGGCAGGCCCTGGGCTGTGG - Intronic
1142880008 17:2876810-2876832 CTTTGGAATGCCCTTGGCTGAGG + Intronic
1142882023 17:2889352-2889374 CAGTGCCAGGCCCTGTGCTGGGG + Intronic
1143107204 17:4535795-4535817 GTGTGGAAGCCCCTGGGGTGAGG + Intronic
1143283706 17:5773519-5773541 ATGTGGAAGGCCTTGGGGTGGGG + Intronic
1143628254 17:8122966-8122988 CAGTGGGAAGCCCTGGGACGCGG + Intronic
1143632534 17:8147294-8147316 CACTGGAGGACCCAGGGCTGTGG + Exonic
1143697403 17:8630606-8630628 GAGTGCACGGCCCAGGGCTGGGG - Intronic
1144458713 17:15440166-15440188 CAGTGGAAGCTCCTGCACTGGGG - Intronic
1144628552 17:16857927-16857949 CACTGCAAGGCACTGGCCTGTGG + Intergenic
1144789457 17:17849374-17849396 GAGTGACAGGCCCTGTGCTGTGG - Intronic
1145062986 17:19744108-19744130 CAGTAGCAGGCCCGGCGCTGTGG + Intronic
1145272879 17:21413957-21413979 CTGGGGAGGGCCCTCGGCTGAGG + Intronic
1145311088 17:21701420-21701442 CTGGGGAGGGCCCTCGGCTGAGG + Intronic
1146558916 17:33851246-33851268 CAGGGGAGGGCCCTAGGCAGAGG + Intronic
1147133792 17:38423859-38423881 TGGTGGAAGGGCCTGAGCTGGGG + Intergenic
1147150414 17:38510757-38510779 GAGTGGAAGGAGCTGGGCGGAGG + Exonic
1148629059 17:49092595-49092617 CACTGGAGGTGCCTGGGCTGGGG + Intergenic
1148694424 17:49550394-49550416 CAGCGGAGGGCCCAGGGCTGTGG - Intergenic
1148854093 17:50569295-50569317 CAGGGTGAGGACCTGGGCTGGGG + Exonic
1150657836 17:67051887-67051909 CAGCGGAGGGCCCTGAGATGAGG - Intronic
1151491250 17:74433241-74433263 CAGTTGAAGGCACAGGGGTGGGG - Intronic
1151767330 17:76139215-76139237 CAGTGGAAGGCACCTGGCTCAGG + Intronic
1152101560 17:78304694-78304716 ACCTGGAAGGCCCTGGGCTCAGG - Intergenic
1152229438 17:79107087-79107109 CTGTGGACAGGCCTGGGCTGCGG - Intronic
1152603475 17:81277261-81277283 CACTGGAAGTCCCAGCGCTGAGG + Intronic
1152811298 17:82384041-82384063 CCCTGGAAGGCCCTGGGCAGTGG + Intergenic
1152931222 17:83111158-83111180 CTGTGGAATGCCCTGGACTCAGG + Intergenic
1152957415 18:50790-50812 CAGTGCAGGGGCCTTGGCTGTGG + Intronic
1152982653 18:293247-293269 CAGCGGGAGGCACTAGGCTGAGG + Intergenic
1153007193 18:507814-507836 CAGTGGAAAGCCATGAGCCGAGG + Intergenic
1153340904 18:3973734-3973756 CCGGGGAAGGCCCAGGGCTCGGG + Intronic
1153709672 18:7784908-7784930 CAGTTGGAGGCCATGGGGTGAGG + Intronic
1153863190 18:9234612-9234634 CAGTGGAAGCTCCTGGGATGTGG + Intronic
1154163540 18:11997333-11997355 CAGAGGCAGGGCCTGGGCAGTGG + Intronic
1156514906 18:37671278-37671300 CATTGGCAGGCCATGGACTGCGG + Intergenic
1156553587 18:38043356-38043378 CACTGTAAGGTCCAGGGCTGGGG + Intergenic
1157534404 18:48447934-48447956 CATTGGAAGGCTCTGAGCAGAGG - Intergenic
1158402508 18:57133725-57133747 CTGTGAATGTCCCTGGGCTGGGG + Intergenic
1159343489 18:67167888-67167910 CAGTAGAAGGCCGAGTGCTGTGG - Intergenic
1159928094 18:74286665-74286687 CATGGGAAAGCACTGGGCTGGGG - Intronic
1160045073 18:75379131-75379153 GAGTGGAAGGCCCCTTGCTGAGG - Intergenic
1160773931 19:846228-846250 CAGTGCCTGGCCATGGGCTGGGG + Exonic
1160775914 19:855645-855667 CAGTGCCTGGCCATGGGCTGGGG + Exonic
1160859674 19:1232350-1232372 CAGTGGGAGACCCTGTGTTGTGG - Intronic
1161312571 19:3603133-3603155 CTGAGGCAGGGCCTGGGCTGTGG + Intronic
1161588698 19:5118931-5118953 CCCTGGCAGGCCCTGGGGTGTGG + Intronic
1161636960 19:5395102-5395124 CCCTGGAAGGGCCTGGTCTGAGG + Intergenic
1162445216 19:10718549-10718571 CTGTGGGACGCCCTGGGCAGAGG + Intronic
1162732635 19:12728171-12728193 GGGTGGAAGGCACAGGGCTGTGG - Intergenic
1162915662 19:13873218-13873240 AAGGGGCAGGGCCTGGGCTGGGG + Intronic
1163607145 19:18281588-18281610 CAGTGGAGGGCCGGGCGCTGCGG - Exonic
1163863743 19:19755735-19755757 CAGTGGAGGGACCTGGTCAGTGG - Intergenic
1165014375 19:32870182-32870204 CAGAGGCAGGCCCTTGGCTTGGG - Intergenic
1165150559 19:33757895-33757917 CTCTGGAAGGCTCTGGCCTGAGG - Intronic
1165176023 19:33930401-33930423 GAGAGGAAGGCCTTGGGCTGTGG + Intergenic
1165489337 19:36114314-36114336 GAGTGGCGGGCCCTGAGCTGGGG - Intronic
1165761929 19:38326689-38326711 CAGTGACAGGCGCTGGGCTGAGG - Exonic
1166065576 19:40356513-40356535 CAGGACAAGGCCCAGGGCTGGGG + Intronic
1166741041 19:45114945-45114967 CAGCAGAAAGCCCTGGGCTAGGG + Intronic
1167053769 19:47096023-47096045 CAGTGGAGGGTCCTGGGAGGAGG - Intronic
1167059769 19:47136775-47136797 CAGGTGAAGGCCGGGGGCTGTGG - Intronic
1167315055 19:48758000-48758022 CAGCGGGAGGCCGTGGGCTTCGG - Exonic
1167573416 19:50305100-50305122 CATGGGAAGGCTGTGGGCTGGGG + Intronic
1167573622 19:50306340-50306362 GAGAGGAAGGCACAGGGCTGGGG - Intronic
1167612071 19:50512493-50512515 CAGTGCAAGGCCCAGGGCTGTGG + Exonic
1167928559 19:52844553-52844575 CAGAGTGAGACCCTGGGCTGAGG - Intronic
925130148 2:1488772-1488794 CAGAGGAAGGCCCAGGGACGGGG - Intronic
926620319 2:15041325-15041347 CAGTTGTTGGCCCTGGTCTGTGG - Intergenic
927472710 2:23386944-23386966 CAGTTGTCGTCCCTGGGCTGTGG + Intronic
927693044 2:25221903-25221925 CAGTGGAGGGCCCAGGGCTCCGG - Intergenic
927846165 2:26473845-26473867 TGGGGGCAGGCCCTGGGCTGGGG + Intronic
929091478 2:38221885-38221907 CAGGGGCAGGCCCTTGGCTGTGG + Intergenic
929142846 2:38681523-38681545 TTGTGGAATGTCCTGGGCTGTGG + Intronic
929211764 2:39365348-39365370 CTTTGGAATGCCCTTGGCTGAGG + Intronic
929443904 2:41988137-41988159 CAGTGGTAGGCAATGGGCTGCGG + Intergenic
929511328 2:42568381-42568403 AAGTGGAGGGCCCTGGGGTCAGG - Intronic
929579989 2:43075967-43075989 CACTGGAAGGTCCTGGCATGGGG + Intergenic
929581258 2:43082931-43082953 CAGTGCAAGTCCCTGGGATTTGG - Intergenic
929599326 2:43195075-43195097 CAGGGGCAGGCCCTAGGCTTAGG - Intergenic
930154762 2:48094670-48094692 CAGTGCAAGGCTCTTGGTTGGGG - Intergenic
930259342 2:49126766-49126788 AAGTGAAAAGACCTGGGCTGTGG - Intronic
931181871 2:59909666-59909688 CAGAGGCAGCCCCTGGACTGCGG - Intergenic
931258527 2:60596619-60596641 CAGTGGAAGGACCTGGTGGGAGG + Intergenic
932420137 2:71596692-71596714 CAATGGGAGGCCCTTGGCAGGGG - Intronic
932424635 2:71621224-71621246 CAGTGGGAGCCCCTGACCTGTGG + Intronic
932426250 2:71637308-71637330 CAGAGGTTGGCCTTGGGCTGGGG + Intronic
932934029 2:76080301-76080323 AAGTGGCTGGCCCTGGACTGAGG - Intergenic
932970374 2:76533805-76533827 CAGTGGAAGGCCATGGTAAGGGG + Intergenic
933175223 2:79166458-79166480 CACTGGAAGGCCCAGGGCCCCGG - Intergenic
934300882 2:91775505-91775527 CAGTGCCAGGCTCTAGGCTGAGG + Intergenic
934855030 2:97724364-97724386 CAGTCGAAGACCCCCGGCTGCGG - Exonic
935174938 2:100641481-100641503 CAGGAGCAGGCACTGGGCTGGGG + Intergenic
935285597 2:101561333-101561355 CAGGGGAGGGGCCTGGGTTGGGG + Intergenic
935701235 2:105813720-105813742 CACTGGAAAACCCTGGGTTGTGG + Intronic
936164130 2:110105353-110105375 AAAGGGAAGGCCTTGGGCTGGGG - Intronic
937248446 2:120509176-120509198 GAGAGGCAGGCCCTGGCCTGTGG + Intergenic
937261771 2:120591278-120591300 GGGTGGCAGGACCTGGGCTGGGG - Intergenic
938986695 2:136583479-136583501 CTGTGCCAGGCACTGGGCTGTGG + Intergenic
944483578 2:200180996-200181018 CAGAGGAAGTCTGTGGGCTGAGG + Intergenic
944529513 2:200653403-200653425 CCATGGAAGGACCTGGGCTGGGG + Intronic
945046581 2:205787226-205787248 ATGTGGAGGGCCCTAGGCTGGGG - Intronic
946181291 2:217950678-217950700 CAGTGGACAGCTCTGGGCTTTGG - Intronic
946339124 2:219057162-219057184 CTGTGGCAGGCTCTGGACTGTGG + Intronic
946872481 2:224096908-224096930 CATTGTAAGACCCTGAGCTGGGG + Intergenic
948212691 2:236206871-236206893 CAGCGGATGGCCCTGGTCTCTGG - Intronic
948223805 2:236293409-236293431 CCGTGGTAGGCCCTGGAATGTGG + Intergenic
948710035 2:239819733-239819755 CAGCCGATGGCCCTGGGCAGGGG - Intergenic
948725765 2:239933046-239933068 CCGTGGCAGGGCCTGGGATGGGG + Intronic
949032872 2:241805257-241805279 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032888 2:241805296-241805318 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032919 2:241805374-241805396 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032935 2:241805413-241805435 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032952 2:241805452-241805474 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032969 2:241805491-241805513 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949032986 2:241805530-241805552 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033033 2:241805643-241805665 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033079 2:241805756-241805778 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033199 2:241806050-241806072 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033215 2:241806089-241806111 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033232 2:241806128-241806150 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033247 2:241806163-241806185 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033291 2:241806272-241806294 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033323 2:241806351-241806373 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033355 2:241806428-241806450 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033388 2:241806506-241806528 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033418 2:241806580-241806602 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033434 2:241806619-241806641 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033480 2:241806732-241806754 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033511 2:241806806-241806828 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033527 2:241806845-241806867 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033543 2:241806884-241806906 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033574 2:241806962-241806984 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033650 2:241807149-241807171 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033710 2:241807305-241807327 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033755 2:241807422-241807444 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033772 2:241807461-241807483 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033804 2:241807538-241807560 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033855 2:241807663-241807685 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033902 2:241807780-241807802 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033919 2:241807819-241807841 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
949033971 2:241807944-241807966 CTGCGGAGGTCCCTGGGCTGAGG - Intergenic
1168827070 20:821265-821287 CAGTGTCAGGCCCAGAGCTGTGG + Intergenic
1168837962 20:890369-890391 CTGTGGGAGACCATGGGCTGGGG + Intronic
1169044813 20:2526810-2526832 TGGTGGAAAGCACTGGGCTGAGG + Intergenic
1169192879 20:3669124-3669146 TGCTGGAAGCCCCTGGGCTGGGG - Intronic
1170049020 20:12120441-12120463 CAGTGGAAAACCCTGGGTTTGGG - Intergenic
1171958422 20:31476541-31476563 GAGTGGAAGGCACTGTGCTCAGG - Exonic
1171977809 20:31606537-31606559 GAGGGGAGGGGCCTGGGCTGGGG + Intergenic
1172282262 20:33716296-33716318 CAGAGGAGGGCCCTGGGGTGAGG - Intronic
1172441352 20:34968759-34968781 CAGTGTAAGGGCCTGGGTAGTGG - Intergenic
1172613152 20:36266505-36266527 CTGTGTCAGGCCCAGGGCTGAGG - Intronic
1172634687 20:36402005-36402027 CAGTGGCAGGGCCAGGGTTGGGG + Intronic
1173503757 20:43571497-43571519 CAGGGGGAGGGCCTGAGCTGGGG + Intronic
1173642681 20:44614943-44614965 AAGTGGAGGGACCTGGGCTAGGG - Intronic
1174160686 20:48548219-48548241 AAGTGTAAGGCCCTGGGCTCAGG - Intergenic
1174487551 20:50870875-50870897 CAGAGGCGGGCCTTGGGCTGGGG + Intronic
1174749744 20:53100019-53100041 CAGTGCCAGGGGCTGGGCTGAGG + Intronic
1175074364 20:56360427-56360449 CAGTGCCAGGGCCTGAGCTGGGG - Intronic
1175170016 20:57073829-57073851 CTGTGGAAGAGCCTGGCCTGCGG - Intergenic
1175388204 20:58610658-58610680 CAGTGGAATGGCCTGTGCTAAGG - Intergenic
1175814080 20:61874530-61874552 CAGAGGGAGGCCCTGGGCGGTGG + Intronic
1176045758 20:63091877-63091899 GAGGGGAAGGCCTGGGGCTGGGG + Intergenic
1176132620 20:63502728-63502750 CCGTGGCTGGCCCTGGTCTGTGG - Intergenic
1176371125 21:6061861-6061883 CGCTGGAAGGCTCTGGGCGGTGG - Intergenic
1178358079 21:31924801-31924823 CCGTGGGTGGCACTGGGCTGTGG + Intronic
1179243829 21:39613064-39613086 CACGGTAAGGCCCGGGGCTGGGG + Intronic
1179752394 21:43476680-43476702 CGCTGGAAGGCTCTGGGCGGTGG + Intergenic
1179902625 21:44401923-44401945 AAGTGGGTGGCCCCGGGCTGGGG - Intronic
1180816274 22:18791639-18791661 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
1181065246 22:20302736-20302758 AAGGGGAAGGCCCTGCACTGGGG + Intergenic
1181166136 22:20984044-20984066 CAGTGCAAGGGCCTGAGCAGGGG - Intronic
1181202463 22:21225971-21225993 CAGTGCCAGGCTCTAGGCTGGGG - Intronic
1181432082 22:22887882-22887904 CCCTGGAAGGGCCTGGGCTAGGG + Exonic
1181699244 22:24610643-24610665 CAGTGCCAGGCTCTAGGCTGGGG + Intronic
1182152997 22:28043601-28043623 CTGTGGGAACCCCTGGGCTGTGG - Intronic
1182352992 22:29709326-29709348 CAGGGGCAGGACATGGGCTGTGG - Intergenic
1182476933 22:30581499-30581521 GAGCAGAAGGCACTGGGCTGGGG + Intronic
1182698010 22:32209287-32209309 CAGTGCAGGGTCCTGGCCTGAGG + Intergenic
1183063729 22:35350085-35350107 CATCGGAAGGCGCTGGGCCGGGG + Intergenic
1183247962 22:36708606-36708628 CTGTGTCAGGCCCTGTGCTGAGG + Intergenic
1183262954 22:36807775-36807797 TAGCGTAAGGCCTTGGGCTGTGG - Intronic
1183352744 22:37343196-37343218 CAGAGGAAGGAGCTGGGCTGAGG - Intergenic
1183451608 22:37898997-37899019 CAGTGGAAGGCGCTGGTCGCTGG - Intergenic
1183614773 22:38937266-38937288 CCGTGGGAAGCCCTGGGCTGGGG - Intergenic
1183630393 22:39029125-39029147 CATTGGTAGGCCCAGAGCTGGGG + Intronic
1183633852 22:39049211-39049233 CATTGGTAGGCCCAGAGCTGTGG + Intronic
1183745504 22:39689346-39689368 AAGCGGAAGGCTCTGAGCTGAGG - Exonic
1183910592 22:41075979-41076001 CCCTGGAAGACCCTGGGCAGAGG - Intergenic
1183934650 22:41255282-41255304 CGGTGCTAGGCCCTGAGCTGAGG - Intronic
1184058038 22:42065753-42065775 CAGTGGCCGGCCCTGGGCACTGG - Exonic
1184066323 22:42123815-42123837 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184068791 22:42135967-42135989 CCCTGGAAGGCCCAGGGCTGGGG + Intergenic
1184118262 22:42434398-42434420 CCCAGGCAGGCCCTGGGCTGTGG + Intergenic
1184316615 22:43698235-43698257 CAGAGAAAGGGACTGGGCTGAGG - Intronic
1184405901 22:44300641-44300663 CATGGGAAGTCCCAGGGCTGCGG + Intronic
1184552435 22:45211595-45211617 CAAGGGAGGGCCCTGGGCTCTGG + Intronic
1184645459 22:45892470-45892492 CTGGGCAGGGCCCTGGGCTGCGG + Intergenic
1184860073 22:47168617-47168639 GAGTGGCTGGCCCAGGGCTGAGG - Intronic
1185088820 22:48754888-48754910 CAGTGCAGGACCCTGGGGTGGGG - Intronic
1185373155 22:50470099-50470121 CAGGCGCAGGCCCTGAGCTGCGG + Intronic
1203224450 22_KI270731v1_random:69442-69464 CAGTGCCAGGCTCTAGGCTGGGG + Intergenic
1203266377 22_KI270734v1_random:17350-17372 CAGTGCCAGGCTCTAGGCTGGGG - Intergenic
950017037 3:9761608-9761630 GTGCGGAGGGCCCTGGGCTGGGG - Intronic
950110789 3:10417306-10417328 CAGTGGCAGGGGCTGGGCAGAGG + Intronic
950201107 3:11044775-11044797 TAGTGGAAGGATCTGGGCTCAGG - Intergenic
950553525 3:13681727-13681749 AACTGGAAGGGCATGGGCTGGGG + Intergenic
950769948 3:15303347-15303369 GTGTGGCAGGCTCTGGGCTGGGG - Intronic
950863549 3:16171348-16171370 CATGGGAAGGCCATGGGCTGAGG + Intergenic
950873122 3:16246238-16246260 CTCAGGATGGCCCTGGGCTGTGG - Intergenic
951527275 3:23665480-23665502 GCGTGGAGGACCCTGGGCTGTGG - Intergenic
951679695 3:25281942-25281964 CTCTGCAAGGCCCTGGGCTAGGG + Intronic
951867970 3:27328667-27328689 CACTGGAAGGCTCTGGGGAGAGG + Intronic
952210142 3:31222208-31222230 CACTGGAAGGCACGGGGCTCAGG + Intergenic
952240452 3:31526975-31526997 CAGAGGAAGGCCGGGGGCGGTGG - Intergenic
952314905 3:32224129-32224151 CATTGAAAAGCCCTGGACTGGGG + Intergenic
953178918 3:40578756-40578778 CACTTGAAAGCCCTGAGCTGTGG - Intergenic
954037488 3:47859432-47859454 CTGTGCCAGGCCTTGGGCTGTGG - Intronic
954458895 3:50615049-50615071 CAGTGGGATGCCTTTGGCTGGGG + Intronic
954757570 3:52849800-52849822 CAGTGGGAGTCCCTGCGCTTCGG - Exonic
954851717 3:53606561-53606583 CAGTGGCAGGCCAAGGGCTGTGG + Intronic
955492727 3:59499364-59499386 CCGTGCACGGCACTGGGCTGAGG + Intergenic
956639805 3:71404993-71405015 CAGTGTCAGTCCTTGGGCTGGGG - Intronic
957784148 3:84859562-84859584 CAGTGTAAGGATCTGGGCGGTGG + Intergenic
961119105 3:124358094-124358116 AAGTGCCAGACCCTGGGCTGGGG - Intronic
961429179 3:126868258-126868280 CAGTGGCAGAGCCTGGGCTGAGG + Intronic
961519927 3:127461202-127461224 CTGTGCTAGGCCCTGTGCTGGGG + Intergenic
961599902 3:128052464-128052486 CAGTGGAACGCGCTGGGCCGCGG + Exonic
961742212 3:129039993-129040015 CAATGGGAGGCTCTGGGCTCGGG - Exonic
961775210 3:129279263-129279285 CACTGGACGGCCCGGGGCCGGGG - Intronic
962630758 3:137273092-137273114 AAGTGGGAGGCCCGGAGCTGGGG + Intergenic
962821790 3:139055386-139055408 CAGTGGGAGCTCCTGGGATGTGG + Intronic
963374490 3:144446552-144446574 CAGTGGTAGCCCCTGGGATGTGG - Intergenic
964999619 3:162936689-162936711 CATTGGATGGCCCAGGGCTCAGG - Intergenic
967009823 3:185422262-185422284 TAGTGGAAGGAGCTGGGCTGAGG + Intronic
968487157 4:868205-868227 CAGGGGAAGGGCCTGGGCGGAGG - Intronic
968523219 4:1043887-1043909 GAAGGGGAGGCCCTGGGCTGGGG - Intergenic
968585195 4:1413109-1413131 CAGAGGAAGGCCATGGATTGCGG - Intergenic
969186396 4:5477894-5477916 CACTGGAAGGACCTGCACTGGGG - Intronic
969248570 4:5952549-5952571 GGGTGGAAGGTCCTTGGCTGGGG + Intronic
969298892 4:6285654-6285676 CAGTGGGAGACCATGGGATGTGG - Intronic
969609417 4:8218722-8218744 GCCTGGAAGGCCCTGGGCCGAGG + Intronic
969612643 4:8235880-8235902 CAGTGGGAGGCCCAGGGCCAGGG + Intronic
969659000 4:8515526-8515548 CAGGGGCAGGGCCAGGGCTGTGG + Intergenic
971233768 4:24822623-24822645 CAGTGGGATTCCCAGGGCTGGGG - Intronic
975067142 4:70080354-70080376 CAGTGAAAGGACATGGGCTTTGG + Intergenic
976214566 4:82704219-82704241 GAGTGGAAGGCCCATGGCAGAGG + Intronic
976376681 4:84353223-84353245 CAGGGGTAATCCCTGGGCTGTGG + Intergenic
976497359 4:85745914-85745936 CAGGGGAAGGCACTGGGTTTTGG - Intronic
977031124 4:91884993-91885015 CAGGGGGAGTCCCTGGGTTGGGG - Intergenic
977422620 4:96821963-96821985 CAGTGGGTGGCACTGTGCTGAGG - Intergenic
977932703 4:102765859-102765881 CTTTGGAATGCCCTTGGCTGAGG + Intergenic
979817321 4:125125877-125125899 CAGTGGAATGTGTTGGGCTGTGG + Intergenic
980730000 4:136812375-136812397 CAGGAGAAGACTCTGGGCTGGGG - Intergenic
981075551 4:140587610-140587632 CAGTGGAAAGTCTTGGGCTTTGG + Intergenic
981719371 4:147786110-147786132 CAGGGGGAGACCCTGGGCTGAGG + Intronic
981822502 4:148902031-148902053 CAGAAGATGACCCTGGGCTGAGG + Intergenic
982139721 4:152305896-152305918 CAGGGGAAGGCCCTAGGGTCTGG - Intergenic
982614660 4:157625346-157625368 CTTTGGAATGCCCTTGGCTGAGG + Intergenic
983178031 4:164614687-164614709 CAGTGGAAGAGCATTGGCTGGGG - Intergenic
985005877 4:185535257-185535279 CAGTGGATGCCCCGGGGCCGAGG - Intronic
985444658 4:190015347-190015369 CAGGGGGAGGTCCTGGGCTTCGG - Intergenic
985648002 5:1094055-1094077 CTGTGGGAGGCCCCGGCCTGGGG + Intronic
985764129 5:1768028-1768050 CAGTCTGGGGCCCTGGGCTGAGG + Intergenic
986255540 5:6100274-6100296 GAGTGGGAGGCCCTGGGGTGTGG - Intergenic
986418044 5:7547867-7547889 CAGTGGAAAGCAGTGAGCTGTGG - Intronic
987112543 5:14701168-14701190 CATGGGAAGGCCCTGAGCCGGGG - Intergenic
987586112 5:19859143-19859165 CTTTGGAATGCCCTTGGCTGAGG - Intronic
987707731 5:21476778-21476800 TATTGTAAGGTCCTGGGCTGTGG + Intergenic
988518991 5:31929560-31929582 CAGTGGAAGGCCAGGCGCAGTGG + Intronic
989066253 5:37465198-37465220 TATTGTAAGGTCCTGGGCTGTGG + Intronic
989270356 5:39526011-39526033 CAGTGGGAGGCACTGGCGTGGGG - Intergenic
994419792 5:99517746-99517768 TATTGTAAGGTCCTGGGCTGTGG + Intergenic
994487418 5:100397395-100397417 TATTGTAAGGTCCTGGGCTGTGG - Intergenic
994599279 5:101881677-101881699 ATGTGGAAGGCCATGTGCTGTGG + Intergenic
994754773 5:103780038-103780060 CAGTGGCATGACCTCGGCTGGGG - Intergenic
995059301 5:107796232-107796254 CATTGTAAGGCCCTGGCCTTTGG + Intergenic
997283632 5:132663486-132663508 CAGTGAAACCTCCTGGGCTGGGG - Intergenic
997465813 5:134087417-134087439 CAGTGGAGGGGGTTGGGCTGTGG - Intergenic
997821697 5:137071722-137071744 CTGTGGGAGGCCGTGGGCTCAGG - Intronic
998004656 5:138648989-138649011 CACAGGGAGGCCCTGGGCTCTGG - Intronic
998186801 5:139986313-139986335 TAGTGCAAGGTCCTGGGGTGTGG - Intronic
998216431 5:140241398-140241420 AAGTGCCAGGCCCTGTGCTGAGG - Intronic
998399851 5:141843009-141843031 CTCAGGAAGCCCCTGGGCTGAGG + Intergenic
999088360 5:148912973-148912995 GAGTGCAAGGCCCTGGTGTGAGG + Intergenic
999210776 5:149886517-149886539 CAGAGGACTGCCCAGGGCTGAGG + Intronic
999331081 5:150673765-150673787 TGGGGGAAGGCCTTGGGCTGAGG + Intronic
1000050929 5:157562393-157562415 CAGAGGAGAGCCCGGGGCTGTGG - Intronic
1001131909 5:169071339-169071361 TAGTTGAAGGCACTAGGCTGTGG - Intronic
1001942492 5:175750614-175750636 AAGCGGCAGGCCTTGGGCTGTGG - Intergenic
1001990734 5:176113642-176113664 CAGGGGAGGGGGCTGGGCTGGGG + Intronic
1002078821 5:176725899-176725921 CAGAGGAAGGACCTGGGCTTTGG + Intergenic
1002226139 5:177724498-177724520 CAGGGGAGGGGGCTGGGCTGGGG - Intronic
1002267710 5:178046715-178046737 CAGGGGAAGGGGCTGGGCTGGGG + Intronic
1003665049 6:8102674-8102696 CGGTGGAAGGGGCGGGGCTGAGG + Intergenic
1004232749 6:13847811-13847833 CTTTGGAAGGCACAGGGCTGGGG - Intergenic
1004245922 6:13975112-13975134 CAGTGAACTGCCCAGGGCTGGGG + Intronic
1004380693 6:15129789-15129811 CAGTGTTAGGCCCTGTGCTAGGG - Intergenic
1005812724 6:29529330-29529352 CAGTGAAAGGCCTTGGGGTCTGG + Intergenic
1006303512 6:33206435-33206457 CAGTGGAAGTCACTGGTATGAGG + Exonic
1006392819 6:33768765-33768787 CAGTGGGAGGGCTGGGGCTGTGG + Intergenic
1006639683 6:35483542-35483564 CAGTGCCAGGGCCTGGGATGAGG - Intronic
1006813646 6:36836944-36836966 CTGAGGAAGGCCCTGACCTGGGG - Intronic
1007315534 6:40985688-40985710 CAGTGGGAGGCCCAGGGGAGTGG + Intergenic
1007343441 6:41208860-41208882 CATTGGAAAGACCTGGGGTGGGG - Intergenic
1009020483 6:57943757-57943779 TATTGTAAGGTCCTGGGCTGTGG - Intergenic
1010198147 6:73260272-73260294 AAGGGGAAGGCTCTGGGCTGGGG + Intronic
1010585197 6:77650415-77650437 GAGTGGAAGGCCCTGGGCGCTGG + Intergenic
1010696491 6:78980707-78980729 CAGTGGAAGTTCCTGGGTTGTGG - Intronic
1012999195 6:106005365-106005387 CAGAGGAAGGCCAAGGCCTGTGG - Intergenic
1016022863 6:139254493-139254515 CAGTGGAAGTCTGTGGCCTGTGG + Intronic
1016536201 6:145109534-145109556 CAGAGGCAAGCCCTGAGCTGTGG + Intergenic
1017547888 6:155470860-155470882 CAGTGGAAGCCCCAAGGCAGGGG - Intergenic
1017869435 6:158474324-158474346 CTGAGGGAGGCCTTGGGCTGAGG - Intronic
1017876042 6:158524959-158524981 CCGTGGAAGGCTCTGGGCAGAGG - Intergenic
1018232465 6:161688748-161688770 CAGTGAAGGTCCATGGGCTGAGG + Intronic
1018420449 6:163636179-163636201 CTCTGGGAGGCTCTGGGCTGGGG + Intergenic
1018652711 6:166005444-166005466 CAGTAGGAGGACCTGGGCTCCGG - Intergenic
1018676060 6:166223301-166223323 CAGCAGGAGGCACTGGGCTGGGG - Intergenic
1018706487 6:166467447-166467469 CAGAGCAAGGCCGGGGGCTGGGG + Intronic
1018759383 6:166877999-166878021 CTTTGGAATGCCCTTGGCTGAGG + Intronic
1018969708 6:168517827-168517849 CGGTGGAGGGGCCTGGGCGGTGG + Intronic
1019133790 6:169896090-169896112 CTGTAAGAGGCCCTGGGCTGGGG - Intergenic
1019277708 7:184619-184641 CTGTGGGAGGGGCTGGGCTGAGG - Intergenic
1019288335 7:234788-234810 CAGAGGGAGGGCCTGGGCTGGGG - Intronic
1019471575 7:1224140-1224162 GAGTGGGGGGCCCAGGGCTGCGG - Intergenic
1019485799 7:1288723-1288745 CTGAGAAAGGGCCTGGGCTGGGG - Intergenic
1019490486 7:1311044-1311066 CTGTGGAGGGTGCTGGGCTGCGG - Intergenic
1019510249 7:1414146-1414168 CAGTGGCAGGCCCTGAACTCAGG + Intergenic
1019511300 7:1418936-1418958 AAGGGGAAGGCCCCGGGCTCTGG - Intergenic
1019712778 7:2525026-2525048 CCCTGGAAGGGGCTGGGCTGCGG + Intronic
1019732170 7:2634375-2634397 CAGTGGGTGGGCCTGGGCTGTGG + Intronic
1021259194 7:18432658-18432680 CAGTGGAAGGCCGGGCGCTGTGG + Intronic
1022112535 7:27240267-27240289 CTGGGGAAGGCTTTGGGCTGAGG + Intergenic
1022208276 7:28183547-28183569 CATTGGGAGGCACTGGGCTCTGG - Intergenic
1022525311 7:31033400-31033422 AAGAGGAAGGCCCTGAGGTGTGG + Intergenic
1022648798 7:32256317-32256339 CAGTGGGAGCCCCTGGTTTGTGG - Intronic
1023680141 7:42677123-42677145 CCGTTGAAGGCCCCAGGCTGAGG - Intergenic
1024189660 7:46993186-46993208 CAGTGGAAACCCTGGGGCTGGGG + Intergenic
1024674215 7:51623654-51623676 CAGTGGAAGGGCCTGGGTTATGG + Intergenic
1025140717 7:56461181-56461203 CACTGGAGACCCCTGGGCTGGGG + Intergenic
1026331087 7:69353270-69353292 GCGTGGAAGGGCATGGGCTGAGG - Intergenic
1026362943 7:69619442-69619464 CACAGGAAGGCTCTGAGCTGTGG + Intronic
1028369006 7:90069715-90069737 CTTTGGAATGCCCTTGGCTGAGG + Intergenic
1028466695 7:91160378-91160400 CTGTGGACTTCCCTGGGCTGTGG + Intronic
1029104761 7:98166003-98166025 CAGTGCCCGGCCCTGTGCTGGGG + Intronic
1029380441 7:100210964-100210986 CTGTCGCAGGCCCTGGGCTGTGG + Intronic
1029666430 7:101998075-101998097 CTGTGCTAGGTCCTGGGCTGGGG - Intronic
1030887447 7:114955581-114955603 ATGTGCATGGCCCTGGGCTGAGG - Intronic
1031645626 7:124221878-124221900 CCGTGAAAGCCCCTGGGATGGGG + Intergenic
1032075478 7:128833861-128833883 CAGGGGAAGGGGGTGGGCTGGGG + Intronic
1032109830 7:129066529-129066551 CAGTGGAACAGGCTGGGCTGCGG - Intergenic
1033361547 7:140641449-140641471 CAGGGAAATGCCGTGGGCTGCGG + Intronic
1033755322 7:144394325-144394347 CAGTGGAGGGCCCGAGGCTTGGG - Intergenic
1034516643 7:151586015-151586037 CATGGGATGGTCCTGGGCTGAGG + Intronic
1034529620 7:151687734-151687756 TGGAGCAAGGCCCTGGGCTGCGG - Intronic
1034562504 7:151890299-151890321 CAGAGGAAGGGCCAGGGCAGTGG - Intergenic
1034635695 7:152565692-152565714 CAGCAGAAGGACCTGGGGTGGGG - Intergenic
1034679731 7:152919506-152919528 CAGTGGAAGGAACCAGGCTGTGG - Intergenic
1035560639 8:601398-601420 CAGTGGAAGGCGCTGGGAGTGGG + Intergenic
1035561153 8:604433-604455 CAATGCCAGGCCCTGGGCCGGGG - Intergenic
1036745973 8:11409971-11409993 CAGTGAGAGTCCCTGGGCAGGGG - Intronic
1037101483 8:15052505-15052527 CAGTGGAAGGCATTGCACTGTGG + Intronic
1037822466 8:22141622-22141644 CAGTCGGAGGCCGTGGGCGGCGG - Exonic
1038486599 8:27939718-27939740 CAGTGCCAGGCAATGGGCTGGGG + Intronic
1038612633 8:29069926-29069948 CTCTGGAGGGCCCTGGGCTCTGG - Exonic
1038733206 8:30145992-30146014 CCCTGGAATGCCCTGGGCTCAGG - Intronic
1039922832 8:41905314-41905336 CAGTGGAGGGCCCGGGGGAGGGG - Intergenic
1040416931 8:47203465-47203487 CAGTGTGGGGCCCAGGGCTGAGG + Intergenic
1040434789 8:47379851-47379873 GAGTGGACAGCCCTGAGCTGTGG - Intronic
1040470910 8:47735187-47735209 GAGTGGAAGGTCGTGGACTGGGG + Intronic
1042201397 8:66282244-66282266 CACTGGAAGGCTCTAGGCAGTGG - Intergenic
1043147671 8:76677816-76677838 CAGTGGATGTGGCTGGGCTGGGG + Intergenic
1045034941 8:98169570-98169592 GAGTGGAAGGCACTGGCCCGAGG - Intergenic
1047522721 8:125607911-125607933 CAGGGGTAGGCTTTGGGCTGGGG + Intergenic
1048256197 8:132906879-132906901 CGTTGGCAGGCCCGGGGCTGAGG - Exonic
1048866982 8:138768436-138768458 CAGTGGAAGGGCGTGCACTGTGG + Intronic
1048970936 8:139644718-139644740 CAGTGGGAGGCTCTGGGGGGGGG - Intronic
1049133617 8:140872683-140872705 CACTGGAAGGCCCAGAGCCGTGG - Intronic
1049201268 8:141341708-141341730 CACTGGAGGGGCCTGGGCTCAGG + Intergenic
1049210790 8:141385551-141385573 CAGTGAAGGTCCCTGAGCTGAGG - Intergenic
1049254483 8:141606402-141606424 CAGGGCCAGGCCATGGGCTGGGG + Intergenic
1049312495 8:141940629-141940651 CTGTGGAAGTCCATGGGATGTGG + Intergenic
1049561044 8:143310415-143310437 CAGAGGAGGGCCGTGGGCGGAGG + Intronic
1051166982 9:14273332-14273354 GAGTGGAAGACTCGGGGCTGTGG + Intronic
1053286984 9:36855967-36855989 CAGTGATAGACCCAGGGCTGGGG - Intronic
1053538138 9:38946376-38946398 GAGTTGAGGGCTCTGGGCTGTGG + Intergenic
1053749505 9:41237321-41237343 CAGTAGGAGGTCCTGGGCTTCGG + Intergenic
1054627996 9:67417545-67417567 GAGTTGAGGGCTCTGGGCTGTGG - Intergenic
1056164023 9:83924564-83924586 CAGTGGGAGGAGCTGGGCTTGGG + Intergenic
1056988416 9:91386982-91387004 TAGTGGAAGGCACTTGACTGTGG - Intergenic
1057695760 9:97322014-97322036 CAGTGGAAGGTTCTGAGCTGGGG + Intronic
1059405225 9:114095089-114095111 CTCAGGAAGGCACTGGGCTGAGG + Exonic
1059460419 9:114426078-114426100 CAATGGAGGGCCCTGGTGTGGGG + Intronic
1059529544 9:115023253-115023275 CTGTGGAGGGACCTGGGCAGGGG + Intronic
1060528667 9:124334772-124334794 CTGTGGGAGGACCCGGGCTGAGG + Intronic
1060751761 9:126174181-126174203 AAGGGGAGAGCCCTGGGCTGAGG + Intergenic
1061001913 9:127907390-127907412 CTGGGGAAGGGGCTGGGCTGGGG + Intergenic
1061085132 9:128393848-128393870 CAGTGGAAGCCCCTGGGCAGGGG - Intergenic
1061313198 9:129777356-129777378 CAGGGACTGGCCCTGGGCTGCGG + Intergenic
1061627635 9:131850723-131850745 CATTGTAAGGCCCTGTGCTGAGG + Intergenic
1061664886 9:132154834-132154856 CAGTGGGAGGCAGAGGGCTGAGG + Intergenic
1062035981 9:134382732-134382754 CTCTGGGAGGCCCTGGTCTGTGG + Intronic
1062289940 9:135789947-135789969 CAGTGCCAGGGCCTGGGTTGTGG - Intronic
1062391698 9:136336412-136336434 CAGGGGGTGGCTCTGGGCTGCGG + Intronic
1062609682 9:137368401-137368423 CAGTGGACGGGCCAAGGCTGAGG + Intronic
1062740730 9:138173783-138173805 CAGTGCAGGGGCCTTGGCTGTGG - Intergenic
1203369066 Un_KI270442v1:285801-285823 CAGTGCAGGGGCCTTGGCTGCGG + Intergenic
1185505785 X:631432-631454 CACGGGAAGGTCCCGGGCTGGGG + Intronic
1187497540 X:19808417-19808439 CAGAGGAAGGCTATGGTCTGAGG - Intronic
1190252689 X:48738982-48739004 CATTGGAAGGCCCAGGCCAGTGG - Intergenic
1190435247 X:50418033-50418055 CAGTGGGAGGTCCTGGGCTATGG - Intronic
1192547715 X:72027592-72027614 CTGGGGAAAGCCCTGGGCTCTGG - Intergenic
1192635153 X:72808725-72808747 GAGGTGAAGGGCCTGGGCTGGGG + Intronic
1192646562 X:72912078-72912100 GAGGTGAAGGGCCTGGGCTGGGG - Intronic
1195094589 X:101492072-101492094 CAGTGTTAAGTCCTGGGCTGGGG + Exonic
1195094612 X:101492150-101492172 CAGTGGAGGGCTCTGGGCTGGGG + Exonic
1195094630 X:101492210-101492232 CAGTGGAGGAGCCTGGACTGGGG + Exonic
1195094681 X:101492372-101492394 CATTGGAGGGTCCTGGACTGGGG + Exonic
1195094818 X:101492924-101492946 CAATGGAGGGTCCTGGACTGGGG + Exonic
1195094901 X:101493251-101493273 CAGTGGAAGCTGCTGGACTGGGG + Exonic
1195830287 X:109050105-109050127 CAGTGGTAGGCCTAGGGCTTTGG + Intergenic
1197833295 X:130668367-130668389 GAGTGGAAGGCCTGGGGCTGTGG - Intronic
1198683091 X:139203183-139203205 CGATGGGAGGCCCTGGGCAGAGG + Intronic
1198967666 X:142244659-142244681 CAGGGGATGGCCTTGAGCTGTGG - Intergenic
1199239735 X:145532347-145532369 CAGTGCTAGGCCCTCTGCTGGGG - Intergenic
1199533865 X:148880036-148880058 CAGTGGTTGGCACTGGGCTAGGG + Intronic
1199875168 X:151922786-151922808 GAGTGGGAGGCCTTGGTCTGAGG + Intronic
1199976395 X:152897349-152897371 GTGTGCAAGGCCCTGGGCTGGGG - Intergenic
1200217273 X:154373601-154373623 CAGTGGGAGGGTCTGGCCTGGGG - Intronic
1201160198 Y:11159937-11159959 CGGAGGAAGGTCCTGTGCTGCGG + Intergenic
1201265546 Y:12203223-12203245 CAGTGCAAGGCCTTGGGCACGGG - Intergenic