ID: 1125725685

View in Genome Browser
Species Human (GRCh38)
Location 15:41867070-41867092
Sequence GGCGCCCCCGGGTGCGGGAC CGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 178
Summary {0: 1, 1: 0, 2: 0, 3: 11, 4: 166}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125725685_1125725692 3 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725692 15:41867096-41867118 GCGTCTTCAGCCGCTCACGCAGG 0: 1
1: 0
2: 0
3: 7
4: 36
1125725685_1125725697 19 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725697 15:41867112-41867134 ACGCAGGGCTGCCTCCTGTGGGG 0: 1
1: 0
2: 2
3: 14
4: 179
1125725685_1125725693 4 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725693 15:41867097-41867119 CGTCTTCAGCCGCTCACGCAGGG 0: 1
1: 0
2: 0
3: 4
4: 48
1125725685_1125725695 17 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725695 15:41867110-41867132 TCACGCAGGGCTGCCTCCTGTGG 0: 1
1: 0
2: 1
3: 24
4: 175
1125725685_1125725698 23 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725698 15:41867116-41867138 AGGGCTGCCTCCTGTGGGGCAGG 0: 1
1: 0
2: 5
3: 48
4: 421
1125725685_1125725699 24 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725699 15:41867117-41867139 GGGCTGCCTCCTGTGGGGCAGGG 0: 1
1: 0
2: 4
3: 30
4: 411
1125725685_1125725700 25 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725700 15:41867118-41867140 GGCTGCCTCCTGTGGGGCAGGGG 0: 1
1: 0
2: 6
3: 40
4: 443
1125725685_1125725696 18 Left 1125725685 15:41867070-41867092 CCGGTCCCGCACCCGGGGGCGCC 0: 1
1: 0
2: 0
3: 11
4: 166
Right 1125725696 15:41867111-41867133 CACGCAGGGCTGCCTCCTGTGGG 0: 1
1: 0
2: 2
3: 12
4: 185

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125725685 Original CRISPR GGCGCCCCCGGGTGCGGGAC CGG (reversed) Exonic