ID: 1125725837

View in Genome Browser
Species Human (GRCh38)
Location 15:41867713-41867735
Sequence TGCCATACCCAGAGTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125725837_1125725843 10 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725843 15:41867746-41867768 AGTGCCCACTGAGCTTGGCATGG 0: 1
1: 0
2: 1
3: 25
4: 180
1125725837_1125725847 25 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725847 15:41867761-41867783 TGGCATGGAGCTGTGAGGAGTGG 0: 1
1: 0
2: 4
3: 57
4: 651
1125725837_1125725842 5 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725842 15:41867741-41867763 TTAGGAGTGCCCACTGAGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 108
1125725837_1125725846 20 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725846 15:41867756-41867778 GAGCTTGGCATGGAGCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 429
1125725837_1125725848 26 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725848 15:41867762-41867784 GGCATGGAGCTGTGAGGAGTGGG 0: 1
1: 0
2: 1
3: 30
4: 403

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125725837 Original CRISPR TGCCATACCCAGAGTGCCCA TGG (reversed) Intronic