ID: 1125725837

View in Genome Browser
Species Human (GRCh38)
Location 15:41867713-41867735
Sequence TGCCATACCCAGAGTGCCCA TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 4, 3: 10, 4: 159}

Found 5 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125725837_1125725842 5 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725842 15:41867741-41867763 TTAGGAGTGCCCACTGAGCTTGG 0: 1
1: 0
2: 2
3: 11
4: 108
1125725837_1125725847 25 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725847 15:41867761-41867783 TGGCATGGAGCTGTGAGGAGTGG 0: 1
1: 0
2: 4
3: 57
4: 651
1125725837_1125725846 20 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725846 15:41867756-41867778 GAGCTTGGCATGGAGCTGTGAGG 0: 1
1: 0
2: 2
3: 27
4: 429
1125725837_1125725848 26 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725848 15:41867762-41867784 GGCATGGAGCTGTGAGGAGTGGG 0: 1
1: 0
2: 1
3: 30
4: 403
1125725837_1125725843 10 Left 1125725837 15:41867713-41867735 CCATGGGCACTCTGGGTATGGCA 0: 1
1: 0
2: 4
3: 10
4: 159
Right 1125725843 15:41867746-41867768 AGTGCCCACTGAGCTTGGCATGG 0: 1
1: 0
2: 1
3: 25
4: 180

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125725837 Original CRISPR TGCCATACCCAGAGTGCCCA TGG (reversed) Intronic
900791382 1:4683262-4683284 GGGCCTGCCCAGAGTGCCCAGGG + Intronic
902228044 1:15009098-15009120 AGCCCTACCCAGGGGGCCCAAGG + Intronic
902458548 1:16553964-16553986 TGCCATCCACAGAGACCCCAAGG - Intergenic
902586280 1:17440348-17440370 TGCAAGACCCACAGTGCCCGGGG + Intergenic
902807453 1:18869880-18869902 GGCAATACCCAGAGTGCCCCAGG - Intronic
902843231 1:19088759-19088781 CGTCATGCCCAGGGTGCCCAGGG + Exonic
902858973 1:19230966-19230988 TGAAAAACCCAGAGAGCCCAAGG + Intronic
904603293 1:31685253-31685275 TGCCATTTCCCCAGTGCCCATGG + Intronic
907304683 1:53506981-53507003 TGGCACACCCAGGGGGCCCAGGG + Intronic
907678981 1:56545948-56545970 TGGCATACCTGGAGTGCCCTTGG - Intronic
908763843 1:67536699-67536721 TTCCATGCCCAGAGTGTCAAAGG + Intergenic
911663089 1:100525470-100525492 TGCCAAACCCAGAGTGAGAAAGG - Intergenic
915526304 1:156478388-156478410 TGCCATTCCCAGAGTGGTCCGGG - Intronic
916042304 1:160971656-160971678 TGTCATACTCACAGTTCCCAAGG + Intergenic
918405083 1:184204262-184204284 TACCATACCCACAGGTCCCAGGG - Intergenic
920686321 1:208111545-208111567 AGGCATAACCGGAGTGCCCATGG - Intronic
921118761 1:212118730-212118752 TGCCGTTTCCAGGGTGCCCATGG - Intergenic
923497408 1:234537525-234537547 TGCCAAACCCTGGGTGCCCATGG - Intergenic
924257191 1:242194082-242194104 TGCCATACCTAGAATGCCCATGG - Intronic
1066166568 10:32794887-32794909 TGCCATACCTAGAGAGAACAGGG - Intronic
1067391658 10:45868820-45868842 TGCTATACTTAGAGTGCCCAAGG - Intergenic
1067403024 10:45994845-45994867 TGCTATACTTAGAGTGCCTAAGG + Intronic
1067449940 10:46376039-46376061 TCCCAGGCCTAGAGTGCCCACGG + Intronic
1067587304 10:47483724-47483746 TCCCAGGCCTAGAGTGCCCACGG - Intronic
1067871632 10:49967322-49967344 TGCTATACTTAGAGTGCCTAAGG + Intronic
1075628661 10:123985752-123985774 TGCCAAGCCCATTGTGCCCATGG + Intergenic
1076418212 10:130307657-130307679 TGCCCTCCCCTGAGTGTCCAGGG + Intergenic
1076496904 10:130903579-130903601 TGCTATACCCCCAGTGCTCATGG + Intergenic
1076705125 10:132297259-132297281 GGCCATCCCCAGCGTGTCCAGGG + Intronic
1077154411 11:1084993-1085015 TCCCATCCCCAGGGTGGCCAGGG - Intergenic
1077375134 11:2202203-2202225 TGCCATGCCCCAGGTGCCCAGGG - Intergenic
1078567985 11:12433736-12433758 TGCCAAACCCAGAGAGGCCGGGG - Intronic
1081013612 11:37847578-37847600 TGAAATACCCAGAATGCCAAAGG + Intergenic
1082926315 11:58551103-58551125 TGGCATTGCCACAGTGCCCAAGG - Exonic
1083417601 11:62535768-62535790 TGACAGACACAGAGTGGCCAAGG + Intronic
1084971044 11:72772213-72772235 TGCCATAGCCATAGTGGGCATGG + Intronic
1084971072 11:72772326-72772348 TGCCATAGCCACAGTGGGCACGG + Intronic
1085405618 11:76260098-76260120 TGACATTCTCAGGGTGCCCAGGG - Intergenic
1086841666 11:91693056-91693078 TTCCAGACCCAGATTTCCCAGGG + Intergenic
1087871017 11:103293217-103293239 TGACATATCCAGAGTGCTAAAGG - Intronic
1089519703 11:119055766-119055788 TGTCAAACCTGGAGTGCCCATGG - Exonic
1089603464 11:119628530-119628552 GGCCCTGCCCAGAGGGCCCAGGG - Intronic
1090205619 11:124882449-124882471 TGCCAATCCCAGAGAGTCCAGGG - Intergenic
1090289414 11:125528768-125528790 TGCCATACCCAGAGAGGGCATGG + Intergenic
1094853370 12:34392230-34392252 AGCCATACCCAGGGTCCCCTGGG - Intergenic
1095491798 12:42742849-42742871 TGCCCAACCCAGACTTCCCAGGG - Intergenic
1095983066 12:47983625-47983647 TGCCATACCCAGGGCTCCCTGGG - Intronic
1096220065 12:49823481-49823503 TGGCCTACCCAGAGTGTCTAAGG + Intronic
1102504405 12:113374580-113374602 TGCCACCCCCAGAGTGAACAGGG + Intronic
1103590705 12:121990243-121990265 TGCCATGCACACAGTGGCCAGGG - Intronic
1105655068 13:22427913-22427935 AGCCATAGCCAGAGAGCTCATGG + Intergenic
1106483491 13:30154184-30154206 TGCCACACAGAGAGTCCCCAAGG - Intergenic
1106901774 13:34361133-34361155 GGCCATAAACACAGTGCCCAAGG + Intergenic
1109205412 13:59477791-59477813 TGACATGCCCAGAGTGGGCATGG + Intergenic
1115331359 14:32201796-32201818 TCCCTTACCCAGGGTGCCCCGGG + Intergenic
1119160561 14:72448993-72449015 TGACATTTCCTGAGTGCCCATGG - Intronic
1120628175 14:86855418-86855440 TGCCATACGCACAGAGCCAATGG - Intergenic
1120860991 14:89254812-89254834 TTTCAGACCCAGAGTGCTCAAGG + Intronic
1121122221 14:91383228-91383250 TGCCAGGCCTGGAGTGCCCAGGG + Intronic
1122113312 14:99515973-99515995 TGCCCTTCCCAGAGGGCCCCTGG - Intronic
1122829594 14:104389323-104389345 TGCCATCCCCAGCCTGCCCAGGG + Intergenic
1125329028 15:38564608-38564630 CGCCTTGCCCAGGGTGCCCATGG + Exonic
1125725837 15:41867713-41867735 TGCCATACCCAGAGTGCCCATGG - Intronic
1125759655 15:42088040-42088062 AGCCATTCCCAGAGCTCCCAGGG + Intronic
1127258001 15:57307375-57307397 TGCCAGGCCCACAGTGCCCTGGG + Intergenic
1128633901 15:69290846-69290868 TGACATACCCAGTCTGCTCAGGG - Intergenic
1130565248 15:84988587-84988609 TGCCCTACCAAGAGTTCCCCAGG + Intronic
1132312202 15:100865393-100865415 TGCCAGTCCTAGACTGCCCAAGG + Intergenic
1137553295 16:49454962-49454984 AGCCAGACCCGGAGGGCCCAAGG + Intergenic
1137774085 16:51041158-51041180 TGCCATACCCAGAGATCCTGGGG - Intergenic
1138488686 16:57363534-57363556 TGCCGATCCCAGAGTGCCCTGGG + Exonic
1141955248 16:87366512-87366534 TGCCACACCTGGAGTGCTCAGGG - Intronic
1142102744 16:88284198-88284220 TGGTAGACCCTGAGTGCCCAAGG + Intergenic
1142303637 16:89273848-89273870 TGCACTGCTCAGAGTGCCCAGGG + Intronic
1142993982 17:3750363-3750385 CGCCTGGCCCAGAGTGCCCACGG + Exonic
1143998359 17:11029063-11029085 TGCCATATCCAGTGTGACAATGG - Intergenic
1144658231 17:17051675-17051697 TGCCCTACCCAGAGCTCTCAAGG + Intronic
1144786551 17:17835516-17835538 TGCCAACCCCAGGGTGGCCACGG + Intronic
1148699207 17:49577839-49577861 TGCCACACCCAGGATGGCCATGG - Intronic
1152485492 17:80589058-80589080 TGCCAGTCCCTGTGTGCCCAGGG + Intronic
1153784111 18:8518956-8518978 TGCCACTTCCAGAGTGGCCATGG - Intergenic
1156465894 18:37347708-37347730 TGCCAAATCCAGGGTACCCAAGG + Intronic
1156523066 18:37738188-37738210 TCCAATATCCACAGTGCCCAAGG - Intergenic
1157802511 18:50632262-50632284 TGCAATCCACAGAATGCCCACGG - Intronic
1162854780 19:13459918-13459940 TGCCATACCCAGAGAGCCCTGGG - Intronic
1163019531 19:14474979-14475001 TGCCTCACCCTGGGTGCCCACGG + Intronic
1164614130 19:29656000-29656022 TGCCTTTTCCAGAGTGCCCCTGG - Intergenic
1166069955 19:40381220-40381242 TGCCACAGCAGGAGTGCCCAGGG - Intronic
926207861 2:10846877-10846899 TGCCATGCACGGAGTGCCAAGGG - Intergenic
927072033 2:19540804-19540826 TGCCATAGACAGAGTTCACAGGG + Intergenic
930053575 2:47235429-47235451 GGCCAGAGCCAGAGAGCCCATGG - Intergenic
930066381 2:47330970-47330992 ACCCATACCCAGAGCCCCCAAGG + Intergenic
932345538 2:70993050-70993072 AGCCATGCCCAGAGTGCACATGG + Intronic
932577204 2:72969247-72969269 TCCCATACTCAGTGTGCACAGGG + Intronic
941525676 2:166603769-166603791 ATCCATATCCAGAGTGTCCATGG + Intergenic
943099865 2:183474819-183474841 AGCCATACCCAGAGGTCACACGG - Intergenic
948176835 2:235950215-235950237 TCTCATGGCCAGAGTGCCCAGGG + Intronic
1169035898 20:2451885-2451907 TACTATCCCTAGAGTGCCCAAGG + Intergenic
1169197744 20:3692559-3692581 TGCCAGGCCCAGGATGCCCAGGG - Exonic
1169735365 20:8832041-8832063 TCCCATAGGCAGGGTGCCCAGGG + Intronic
1170588053 20:17750397-17750419 TTCCAGACCCTGACTGCCCATGG + Intergenic
1176039377 20:63056297-63056319 TGCGATGCCCAGGGTGCCCGGGG + Intergenic
1181067900 22:20315293-20315315 TGCCCTAGCCCGAGTGCCCCGGG - Intronic
1181085387 22:20437332-20437354 TGTCATCCCCTGGGTGCCCACGG + Intronic
1181931183 22:26402905-26402927 CGCCGTCCCCAGAGTTCCCAGGG + Intergenic
1184238817 22:43200834-43200856 GACCATGCCCAGTGTGCCCAGGG - Exonic
950793197 3:15489688-15489710 TGTCACACCCACCGTGCCCAGGG + Intronic
953692929 3:45134808-45134830 TTCCTCACCCAGAGGGCCCAGGG + Intronic
958445970 3:94215561-94215583 TGGCATACCCAGAGAGCACATGG + Intergenic
961663029 3:128480471-128480493 AGCCAAAGCCAGAGTGGCCACGG - Exonic
965597376 3:170422061-170422083 TGCCTCACCCACAGTGCCCTGGG - Intronic
966752131 3:183332306-183332328 TGCCCTACTCAATGTGCCCAGGG + Intronic
967748281 3:193084031-193084053 GGCCTTACACAGAGTCCCCAGGG + Intergenic
968448929 4:666080-666102 TGTCAGACCCCGAGTGCCCTGGG - Intronic
968483031 4:845241-845263 TGCCATGCCCCCTGTGCCCAGGG + Intergenic
975946736 4:79715381-79715403 TCCCATGCCCAGAGTCCCCTCGG - Intergenic
991751857 5:69815285-69815307 TGACAGACCTAGAGTGGCCATGG - Intergenic
992379687 5:76225009-76225031 TGCCATACCCAGTGTCCCCTTGG - Intronic
994879520 5:105470416-105470438 TGACATACCTAGTGTGACCATGG - Intergenic
995831828 5:116362241-116362263 AGTCACACCCAGACTGCCCAAGG - Intronic
999552398 5:152703689-152703711 TCCCATCCCCAGAGTGTCTATGG - Intergenic
999941063 5:156543667-156543689 TGCCAGACACAAAGTGCTCAGGG + Intronic
1000758046 5:165184870-165184892 TGCAATCCCCAGAGGACCCACGG - Intergenic
1002405643 5:179027962-179027984 GTCCAGCCCCAGAGTGCCCAGGG - Intronic
1011262504 6:85483983-85484005 TGTCATAGACAGAGTACCCACGG - Intronic
1012914717 6:105157135-105157157 GGCCTTACCCAGTCTGCCCACGG + Intergenic
1015613562 6:135051571-135051593 TGCTTTACCCAGAGTGGTCAGGG - Intronic
1019202390 6:170328978-170329000 GGCTATCACCAGAGTGCCCAAGG + Intronic
1019592804 7:1844231-1844253 TGCCATCCCCGGTGTGCCCTTGG + Intronic
1020684950 7:11283355-11283377 TCCCATGTCCACAGTGCCCAAGG + Intergenic
1021803874 7:24335844-24335866 TGCAATACACAGAGTGCCCAAGG - Intergenic
1022416237 7:30179432-30179454 TGCCTTCCCCAAAGTGCCAATGG - Intergenic
1022469084 7:30670932-30670954 TTCCATGCCCAGAGTGGCCCAGG + Intronic
1023511706 7:40959941-40959963 TGCCTCACCCAGAGAGCACAAGG - Intergenic
1023829907 7:44033142-44033164 TGCCATCCCTCTAGTGCCCAAGG + Intergenic
1023844822 7:44114656-44114678 TCCCATAGCCAGAGTGCCCAGGG + Intergenic
1025071320 7:55901655-55901677 TGCCATGCCCAGAGAGGGCATGG + Intronic
1029740221 7:102487414-102487436 TGCCATCCCTCTAGTGCCCAAGG + Intronic
1029758217 7:102586588-102586610 TGCCATCCCTCTAGTGCCCAAGG + Intronic
1029776155 7:102685666-102685688 TGCCATCCCTCTAGTGCCCAAGG + Intergenic
1031145363 7:117991786-117991808 TTACATTCCAAGAGTGCCCAGGG - Intergenic
1031544945 7:123039761-123039783 TGCCATACAGAGAGTGCAAATGG + Intergenic
1031987097 7:128170219-128170241 TGACATTCTCAGAGTGTCCACGG + Intergenic
1034461522 7:151200281-151200303 TTCCAGCCCCACAGTGCCCACGG - Intronic
1037762205 8:21748985-21749007 TGCCATATCCTGGGTGTCCAGGG - Intronic
1039322866 8:36452246-36452268 CCCCAAACCCAGACTGCCCATGG + Intergenic
1039324876 8:36474381-36474403 AAGCATACCCAGAGGGCCCATGG + Intergenic
1039427773 8:37500923-37500945 TACCACATCCAGAGAGCCCAAGG + Intergenic
1048350687 8:133613566-133613588 TGCCAAACCCTGACTCCCCAGGG + Intergenic
1050179969 9:2911344-2911366 TGCTATACCCAGATTTGCCAAGG - Intergenic
1052100919 9:24445521-24445543 GGCCATAGCCAGATTGGCCATGG + Intergenic
1052774954 9:32723954-32723976 TGCCCTAACCACAGAGCCCAAGG + Intergenic
1053164080 9:35832492-35832514 AGCCATCCCCACAGTGGCCAGGG - Intronic
1053802845 9:41775101-41775123 GGCCTGACCCAGAGAGCCCATGG + Intergenic
1054142402 9:61539969-61539991 GGCCCGACCCAGAGAGCCCATGG - Intergenic
1054191150 9:61986447-61986469 GGCCTGACCCAGAGAGCCCATGG + Intergenic
1054462146 9:65471119-65471141 GGCCCGACCCAGAGAGCCCATGG - Intergenic
1054647219 9:67601270-67601292 GGCCTGACCCAGAGAGCCCATGG - Intergenic
1057182901 9:93039467-93039489 TTCCAGACCCAAAGTGCTCAGGG - Intergenic
1057730657 9:97605448-97605470 TGCCATGCCCACAGTGCCCCGGG + Intronic
1059290794 9:113221840-113221862 TGGCATAGCCAGAGTGACCTTGG + Intronic
1059433592 9:114263950-114263972 TGCCATTCCCAGAGCACACACGG - Intronic
1186692386 X:11992455-11992477 TGGCTTACCCAGAGTCCCCAGGG + Intergenic
1190194579 X:48306147-48306169 TTCCATACTCAGAGTACGCACGG - Intergenic
1190661081 X:52654752-52654774 TTCCATACTCAGAGTACGCACGG - Exonic
1190667309 X:52707146-52707168 TTCCATACTCAGAGTACGCACGG - Exonic
1190672109 X:52751262-52751284 TTCCATACTCAGAGTACGCACGG + Exonic
1194838845 X:98714547-98714569 TGGCATTCCCAGGCTGCCCACGG + Intergenic
1198491680 X:137147432-137147454 TGCCTTTCCCAGCCTGCCCATGG - Intergenic
1200935807 Y:8737264-8737286 TGCCTTTCCCAGAGAGCCAATGG - Intergenic
1200937307 Y:8749435-8749457 TGCCTTTCCCAAAGTGCCCCTGG - Intergenic
1200937604 Y:8751888-8751910 TGCCCTTCCCAGAGAGTCCATGG - Intergenic
1202182062 Y:22148011-22148033 TGCCTTTCCCAGAGAGCCCCTGG - Intergenic
1202209298 Y:22438391-22438413 TGCCTTTCCCAGAGAGCCCCTGG + Intergenic