ID: 1125727059

View in Genome Browser
Species Human (GRCh38)
Location 15:41873554-41873576
Sequence GGTGGAGGAGAAGCGGCCGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 477
Summary {0: 1, 1: 0, 2: 1, 3: 34, 4: 441}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125727059_1125727069 22 Left 1125727059 15:41873554-41873576 CCAGCGGCCGCTTCTCCTCCACC 0: 1
1: 0
2: 1
3: 34
4: 441
Right 1125727069 15:41873599-41873621 CCAGAAAGTACTGCCAAGAGTGG 0: 1
1: 0
2: 1
3: 17
4: 162
1125727059_1125727070 23 Left 1125727059 15:41873554-41873576 CCAGCGGCCGCTTCTCCTCCACC 0: 1
1: 0
2: 1
3: 34
4: 441
Right 1125727070 15:41873600-41873622 CAGAAAGTACTGCCAAGAGTGGG 0: 1
1: 0
2: 1
3: 15
4: 173
1125727059_1125727071 24 Left 1125727059 15:41873554-41873576 CCAGCGGCCGCTTCTCCTCCACC 0: 1
1: 0
2: 1
3: 34
4: 441
Right 1125727071 15:41873601-41873623 AGAAAGTACTGCCAAGAGTGGGG 0: 1
1: 0
2: 1
3: 25
4: 232

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125727059 Original CRISPR GGTGGAGGAGAAGCGGCCGC TGG (reversed) Exonic
900156102 1:1203861-1203883 GGCAGAGGAGAAGGGGCGGCTGG - Exonic
901632345 1:10654017-10654039 GGTGAAGGTGAAGCCGCAGCCGG + Exonic
902740635 1:18435775-18435797 GGTGGAGGAGAAGCTGAGACTGG - Intergenic
902877586 1:19350067-19350089 GGAGGAGGAGAGGCGCCTGCTGG - Intronic
903189533 1:21649028-21649050 GCTGGAGGTGAAGCAGCAGCAGG + Intronic
903596901 1:24502372-24502394 GCCCGAGGAGAGGCGGCCGCAGG - Intronic
904464865 1:30701757-30701779 GGAGGAGGAGAAGCAGGCACAGG - Intergenic
904642334 1:31939787-31939809 GGTGGGGGAGAAGCACCCACGGG - Intronic
905308624 1:37034894-37034916 GCTGGAGGAGACGCGCCCGCCGG + Intergenic
905651124 1:39657666-39657688 AGTGGTGAAGAAGGGGCCGCAGG + Intergenic
906125173 1:43423125-43423147 GGTGGGGGAAACGCAGCCGCAGG - Exonic
906524919 1:46488379-46488401 GGTGGGGCAGAAGGGGCCACAGG - Intergenic
908089208 1:60668897-60668919 GGTGGAAGAGTAGGGGCTGCCGG - Intergenic
908354918 1:63319713-63319735 GAAGGAGGCGAAGCGGCGGCCGG - Intergenic
913250686 1:116910141-116910163 GGAGGAGGAGGAGAGGCGGCGGG + Exonic
913511193 1:119564134-119564156 GGTGGAGGAGAAGGAGCTGAAGG + Intergenic
913515429 1:119601408-119601430 GGTGGAGGAGAAGGAGCTGAAGG + Intergenic
914125466 1:144813797-144813819 GGCGGCGGAGAGGCGGCCGGCGG - Intergenic
915135549 1:153728698-153728720 GGAGGAGGAGGAGCGGGAGCAGG + Exonic
915495978 1:156282818-156282840 GGCGGAGGAGGAGCTGTCGCGGG - Exonic
915935418 1:160087715-160087737 GGTGGAGGAGGAGGGGGCGGGGG + Exonic
916850039 1:168694572-168694594 GGGGGAGGAGAGGCTGCAGCTGG - Intergenic
918127460 1:181596960-181596982 TGTGGAGGAGAAGGGGCTGAGGG + Intronic
919833841 1:201560378-201560400 GGTGGAGGGGAAGCTGGCGCTGG - Intergenic
921325318 1:213982746-213982768 GGCGGGGGAGGAGAGGCCGCGGG + Intergenic
921384021 1:214551702-214551724 GGTGGGGGAGCCGTGGCCGCCGG - Intronic
922314841 1:224434035-224434057 GGTGGAGGAGGAGGGGGCGGCGG - Exonic
922513139 1:226186450-226186472 GGCGGAGGAGGCGCGGCGGCTGG - Exonic
922766534 1:228159137-228159159 GGCTGAGGAGAAGGGGTCGCAGG - Exonic
922984991 1:229859458-229859480 TGTGGACGAGAAGGTGCCGCAGG - Intergenic
923688390 1:236170089-236170111 GGGGGAGGAGAACAGGCCTCTGG + Intronic
1062833555 10:622214-622236 GGTGGAGGAGAAGAGACTTCTGG - Intronic
1067079030 10:43203315-43203337 CGTGGAGCAGAAGCAGCAGCTGG - Exonic
1069729664 10:70602584-70602606 GGTGGAGGGGAAGAGGCTGATGG - Intronic
1070398904 10:76035816-76035838 GGCGGGGGAGAAGGGGCCGCTGG - Intronic
1071573611 10:86711136-86711158 GTTGGAGGAGAAGCGGCGGGTGG + Intronic
1072614139 10:97038265-97038287 GGAGGAGGAGAAGCGACATCAGG - Intronic
1072716336 10:97755267-97755289 GGTTCAGGAGCAGAGGCCGCAGG - Intronic
1073403576 10:103277727-103277749 GGAGGAGGTGCAGCGGCTGCGGG + Exonic
1073578157 10:104641822-104641844 GGAGGAGGTGAAGGCGCCGCGGG + Exonic
1074364293 10:112845626-112845648 GCTGGAGGAAAAGCCTCCGCGGG + Intergenic
1074865509 10:117542426-117542448 GGAGGAGGAGAAGCCGCAGCGGG + Exonic
1075102753 10:119517783-119517805 GGTGGGGCAGAAGAGGCCGGGGG + Intronic
1075203062 10:120422400-120422422 GGTGGAGGAGCAGCAGGGGCCGG + Intergenic
1076403328 10:130197253-130197275 GGTGGAGGAGCATCGCCCGGTGG + Intergenic
1076669065 10:132109616-132109638 GCTGGAAGAAAAGCGGCCGGAGG - Intronic
1076670320 10:132117442-132117464 GGTGGAGGAGGCGCTGACGCTGG + Exonic
1076698954 10:132260403-132260425 GGTGGAGGCAGAGGGGCCGCAGG - Intronic
1076773414 10:132679490-132679512 GGTGGAGGAGAAGGGCTCGTAGG + Intronic
1076778648 10:132711701-132711723 GGTGGGAGAGAACCGGCCCCGGG - Intronic
1077236482 11:1484338-1484360 GGTGCAGGAGAAAGGCCCGCAGG + Intronic
1077306135 11:1869449-1869471 GGGGGAGCAGAAGCGGGTGCAGG + Intronic
1077467570 11:2740813-2740835 AGAGGAGGAGACGTGGCCGCAGG - Intronic
1077545037 11:3165451-3165473 GGATGAGGAGAAGCGGCAGCCGG - Intronic
1081207630 11:40293457-40293479 GATGGAGGAGAAGGGGACCCGGG - Exonic
1082089744 11:48079634-48079656 GGAAGAGGAGGAGCGGCCCCTGG + Intronic
1083316106 11:61815928-61815950 CGGGGAGGGCAAGCGGCCGCTGG - Intronic
1083331519 11:61900540-61900562 GGTTGAGGAGAGGCTGCGGCAGG + Intronic
1083342521 11:61967750-61967772 TGTGGGGGAGGGGCGGCCGCTGG + Intergenic
1083954652 11:65976742-65976764 GGACGAGGAGAAGCAGCAGCAGG + Exonic
1084085469 11:66853080-66853102 GGTGCAGGACAAGAGGACGCAGG + Intronic
1084189711 11:67493397-67493419 GGTGCAGGAGGTGCGGCGGCTGG - Exonic
1084225398 11:67711929-67711951 GATGGAGCAGAAGCTGCGGCGGG - Intergenic
1084363741 11:68684823-68684845 GGAGGAGCAGAGGCGGCGGCCGG - Intronic
1084499389 11:69525778-69525800 GGTGGAGGAGAAGGGAGTGCTGG - Intergenic
1084613487 11:70219067-70219089 GGTGAAGGAGAAGGGGCTGGGGG + Intergenic
1084810186 11:71607348-71607370 GATGGAGCAGAAGCTGCGGCGGG + Intergenic
1088588265 11:111379052-111379074 GGTGGAGGTGATGGGGCCACGGG - Intronic
1088789375 11:113211014-113211036 GGTGGTGGAGAAGAGGCACCAGG - Intronic
1089533991 11:119149627-119149649 GGCGGGGGAGAAGAGGCAGCCGG - Intronic
1090056644 11:123430209-123430231 GGAGGAGGAGGAGCGGGGGCTGG - Intergenic
1090400486 11:126445451-126445473 GGGAGAGGAGAAGCCACCGCAGG - Intronic
1091390941 12:125750-125772 GGAGGAGGAGGAGCGGCCGGGGG + Exonic
1091404316 12:199481-199503 GTTGGGGGAGCAGCGGCGGCCGG + Intronic
1091741019 12:2960169-2960191 GCTGGAGGCGAAGCGGCTCCAGG + Intronic
1092503829 12:9074563-9074585 GGTGGAGGAGAAACCGCCCTGGG + Exonic
1092899003 12:13041000-13041022 GGAGGAAGGGAGGCGGCCGCTGG + Intergenic
1093950883 12:25164221-25164243 GGTGAAGGAGAAGGGGCTGGGGG - Intronic
1094316268 12:29139733-29139755 GGTGAAGGAGAAGGGGCTGGGGG + Intergenic
1094564979 12:31590999-31591021 GGCGCGGGGGAAGCGGCCGCGGG + Exonic
1096232466 12:49904026-49904048 GGTGGGGGGGAAGCGGCGGGAGG - Intronic
1098443915 12:70546786-70546808 GCTGGAGGAGAAGCAGTCCCAGG + Intronic
1098443922 12:70546812-70546834 GCTGGAGGAGAAGCAGTCCCAGG + Intronic
1101109690 12:101473567-101473589 GGAGGAGGAGAGGAGGCTGCAGG - Intergenic
1101272477 12:103162264-103162286 GGTGGTGGAGAGGCCCCCGCAGG - Intronic
1101278633 12:103227545-103227567 GGTGAAGGAGAAGCGGTTGAGGG + Intergenic
1101605916 12:106247737-106247759 CGTGGCGAAGAAGCCGCCGCCGG - Exonic
1101898020 12:108770286-108770308 CCTGGAGGAGCAGCTGCCGCTGG + Intergenic
1101898070 12:108770435-108770457 CCTGGAGGAGCAGCTGCCGCTGG + Intergenic
1102101508 12:110281733-110281755 GGCGGAGGCGAGGAGGCCGCGGG + Exonic
1102248511 12:111369917-111369939 GGTGGTGGAGAAGAGGCGGCAGG - Intergenic
1102763185 12:115407473-115407495 GGTGGAGGAGAAGAGGCATGAGG + Intergenic
1102970920 12:117165526-117165548 GGAGGAGGAGAAGCTGCACCTGG + Exonic
1103239043 12:119398064-119398086 GGGGGAGAGGAAGGGGCCGCGGG + Intronic
1103379153 12:120480453-120480475 AGTGGAGGAGAAGCTGCTTCAGG - Intronic
1104046949 12:125170043-125170065 GATGGCGGGGAAGCAGCCGCTGG + Intergenic
1104315478 12:127696370-127696392 GGTGGAGGTGATGCTGCTGCTGG + Intergenic
1104589920 12:130075914-130075936 GGTGGAGGAGCAGAGGGAGCAGG + Intergenic
1105512443 13:21061641-21061663 CGCGGAGGAGCAGGGGCCGCAGG - Intergenic
1105927071 13:25018254-25018276 GGAAGAGGAGAAGAGGGCGCGGG - Intergenic
1106099938 13:26685704-26685726 GGTGCAGGAGCAGCGGGAGCAGG + Exonic
1106763405 13:32890449-32890471 GGTGGTGGAGCAGTGGCTGCTGG + Intergenic
1107212129 13:37870052-37870074 GGTGGAGGAGACCCGCGCGCTGG + Exonic
1107851643 13:44577355-44577377 GGAGGAGGAGGGGCGACCGCCGG + Intergenic
1108079262 13:46717181-46717203 GGTGGAGGTGAAGCTGCACCAGG + Intronic
1108144782 13:47464668-47464690 TTTGGAGGAGAAGAGGCCTCTGG - Intergenic
1112441101 13:99425834-99425856 CCTGGAGGAGGGGCGGCCGCGGG + Intergenic
1113373735 13:109744979-109745001 GGTGGAGGAGAAGCAGAGCCAGG + Intergenic
1113447414 13:110379917-110379939 GGTGGAGGAGAGGAGGCAGGTGG - Intronic
1114318053 14:21525234-21525256 GGTGGAGGAGGAGGGGGTGCAGG + Exonic
1116613309 14:47105169-47105191 GGTGAAGGAGAAGGGGCTGAGGG - Intronic
1117495357 14:56296806-56296828 GGTGGAGGAGAAGCAGCCCTGGG + Exonic
1117999635 14:61510985-61511007 GGTGGAGGAGGAGGAGCCTCCGG + Intronic
1118325743 14:64779219-64779241 GGTGGAGGAGAGGCTGCCTCTGG - Exonic
1118763006 14:68892136-68892158 GGTGCAGGAGAAGTGCCAGCTGG - Exonic
1118866560 14:69708897-69708919 GGTGGAGAAGATGAGGCCCCAGG + Exonic
1121636225 14:95455541-95455563 GGAGGAGGAGGAGCGGCTGCGGG - Exonic
1121714141 14:96060714-96060736 GGTGGGAGAGAAGAGGCCTCTGG - Intronic
1122203688 14:100137680-100137702 GGTGGGGCAGAGGCGGGCGCTGG + Intronic
1123024859 14:105419811-105419833 GGAAGAGGAGGAGCGGCCGCGGG - Exonic
1124109511 15:26773101-26773123 GGAGGGGGAGGAGCGGGCGCTGG + Intronic
1124971133 15:34490513-34490535 GGTGGAGGAGGCGGGGCGGCGGG - Intergenic
1125021066 15:34987714-34987736 AGTGGGGCAGAAGCAGCCGCCGG - Intronic
1125405777 15:39351515-39351537 GGTGAAGAAGAAGTGGCCTCTGG + Intergenic
1125608594 15:40956261-40956283 GGTGGAGGAGAAGGGCTGGCCGG - Exonic
1125723597 15:41856915-41856937 GGTGCAGGAGAAGCTGCCTCTGG - Exonic
1125727059 15:41873554-41873576 GGTGGAGGAGAAGCGGCCGCTGG - Exonic
1126419084 15:48452575-48452597 TGTGGAGGTGAAGCGGTAGCCGG + Exonic
1126692764 15:51300651-51300673 GTTGGAGGAGGAGCTGCTGCTGG - Intronic
1126820521 15:52499129-52499151 GATGGAGGAGAAGCTGCTTCAGG - Intronic
1127142696 15:55993619-55993641 GGAGGAGGAGAAGCGGGAGGAGG + Intronic
1128516271 15:68343961-68343983 GGGTGAGCAGAAGGGGCCGCGGG + Intronic
1128604410 15:69026351-69026373 GGAGGAGGAGAAACGGCTGTGGG + Intronic
1129082450 15:73052551-73052573 GCTGGAGCAGCGGCGGCCGCGGG + Exonic
1129413150 15:75360871-75360893 GGTGGGGGAGAAGCTGAAGCTGG - Intronic
1131249500 15:90820959-90820981 GGAGGAGGAGACGGGGCCTCAGG + Intergenic
1131367808 15:91854222-91854244 AGTGGTGCAGAGGCGGCCGCCGG + Intronic
1132549238 16:547530-547552 GGTGGACGAGAAGGGGCTGAAGG - Exonic
1132600462 16:770594-770616 GGTGGAGGAGCTGCGGCACCTGG - Exonic
1132606737 16:796807-796829 GGTGGAGAAGATGCGGCGGGCGG + Exonic
1132666601 16:1083731-1083753 GGTGCAGCAGAGGCGGGCGCTGG + Intergenic
1132677247 16:1125871-1125893 GGTGGAGCAGAAGGGGGCCCTGG + Intergenic
1132764266 16:1526426-1526448 GGTGGAGGCTAGGCGACCGCCGG - Intronic
1132875680 16:2135903-2135925 GGAGGAGGAGGAGCCGCGGCGGG - Intergenic
1132885063 16:2178921-2178943 GGTGGAGGAGAAGATCCGGCAGG - Exonic
1132927602 16:2439352-2439374 GGATGAGGAGAAGCAGCAGCAGG + Exonic
1133118344 16:3590910-3590932 GGTGGAGGAGATGGAGCCGTTGG - Exonic
1133228561 16:4355135-4355157 GGTGGAGGTGACGGGGGCGCAGG + Exonic
1133324254 16:4933924-4933946 TGTGAATGATAAGCGGCCGCAGG - Intronic
1134519305 16:14911450-14911472 GGAGGAGGAGGAGCCGCGGCGGG + Intronic
1134554623 16:15154778-15154800 GGAGGAGGAGGAGCCGCGGCGGG - Intergenic
1134706975 16:16310105-16310127 GGAGGAGGAGGAGCCGCGGCGGG + Intergenic
1134960565 16:18402019-18402041 GGAGGAGGAGGAGCCGCGGCGGG - Intergenic
1135380631 16:21993429-21993451 GGTGGAGAATAAACGGCGGCCGG - Intronic
1135382873 16:22008566-22008588 GATGGAGGAGAGGAAGCCGCCGG + Intronic
1136556460 16:31010397-31010419 GGAGGAGGAGGAGCCGTCGCAGG - Exonic
1137665301 16:50246103-50246125 GGGGAAGGAGGAGCGGCCGCAGG - Intergenic
1137893855 16:52190130-52190152 GGTGGAAGAGAAGGGGAAGCAGG - Intergenic
1138160281 16:54746758-54746780 GGTGGAGGTGAGGAGGACGCTGG + Intergenic
1138514542 16:57528919-57528941 GCTGGAGGAGGCGCGGGCGCGGG - Exonic
1138658667 16:58504750-58504772 GGAGGAGGAGAAGCGAGAGCAGG - Intronic
1139310188 16:66021515-66021537 GGTGGAGGAGTGGCAGGCGCTGG - Intergenic
1140401440 16:74675050-74675072 GGTGGCTGTGAAGCGGCAGCAGG - Exonic
1141516635 16:84549222-84549244 GGTGGAGGAGGAGAGGCAGGAGG + Intronic
1141796515 16:86278834-86278856 GGTGAAGGAGAAGGGGTCGAGGG - Intergenic
1141796555 16:86278962-86278984 GGTGAAGGAGAAGGGGTCGAGGG - Intergenic
1142406447 16:89892921-89892943 GGCGCAGGAGAAGCGGCCGTGGG - Intronic
1143164176 17:4889727-4889749 GCGGGAGGAGGAGCGGCGGCAGG + Exonic
1143263978 17:5621844-5621866 GGAAGAGGAGAGGCAGCCGCTGG - Intergenic
1143361125 17:6372182-6372204 GGAGGAGGAGAAGAAGCAGCAGG + Intergenic
1143681657 17:8480494-8480516 GCTGGATGAGAAGCGGCGTCTGG - Exonic
1143685652 17:8513579-8513601 GGTGAAGGAGAAGCAGACGAAGG - Exonic
1143749973 17:9021218-9021240 CGTGGGGGAGGAGGGGCCGCCGG - Intergenic
1144030787 17:11320703-11320725 GGAGGAGGAGCAGCAGCAGCCGG + Intronic
1144565085 17:16353262-16353284 GGCGGTGGAGAAGCCGCCGTCGG - Exonic
1145017931 17:19411169-19411191 GGGGGAGGAGACACGGCTGCGGG - Intronic
1145761033 17:27425620-27425642 GCTGGAGGAGCAGCGGGGGCTGG + Intergenic
1145936700 17:28718318-28718340 GGTGGAGGGGAAGCGTGCGAAGG + Intronic
1146372714 17:32275428-32275450 GAAGGAGGAGAAGGGGCTGCAGG + Intronic
1147456272 17:40540164-40540186 GGTGGAGGAGAGGTGGCATCTGG + Intergenic
1147948434 17:44093398-44093420 GCTGGAGCAGCAGCGGCAGCGGG - Exonic
1148044589 17:44735241-44735263 GGTTGAGGAGAAGCTGGAGCAGG - Intronic
1148048616 17:44758777-44758799 GGTGGCCGAGGAGAGGCCGCGGG + Intergenic
1148388529 17:47253790-47253812 GCTGCGGGAAAAGCGGCCGCGGG + Intergenic
1148866112 17:50629576-50629598 GGTGGAAAAGCAGCTGCCGCTGG + Intergenic
1150580897 17:66473058-66473080 GGAGGAGGAGAGGTGGCTGCAGG - Intronic
1151358067 17:73571933-73571955 GGGGAAGGAGGAGCGCCCGCGGG + Intronic
1151496957 17:74463631-74463653 GGAGGAGGAGATGAGGCCACAGG - Intergenic
1151660739 17:75516724-75516746 GCTGGGGGAGAAGGGGACGCGGG - Exonic
1152193262 17:78901456-78901478 GGACGGGGAGAAGAGGCCGCAGG + Intronic
1152392375 17:80010440-80010462 GGATGAGGAGAAGCTGGCGCAGG - Exonic
1152556351 17:81055067-81055089 GGTGGAGGAGCCGGGGGCGCCGG - Intronic
1152572797 17:81127931-81127953 GGTGGAGGCGGAGCAGCCGTGGG - Intronic
1152634888 17:81426890-81426912 GGGGGAGGAGCTGGGGCCGCTGG - Exonic
1152685876 17:81693686-81693708 GGAGGAGGAGGAGCTGCAGCTGG + Exonic
1152701459 17:81821884-81821906 GGTGCAGGAGATGCTGGCGCAGG - Intergenic
1153886546 18:9473135-9473157 GGTGGGAGAGAAGCAGCCTCAGG + Intergenic
1154475300 18:14748743-14748765 GGTGGAGGAGTGGCGGGCGATGG + Intronic
1158893577 18:61894260-61894282 GCCGGAGGAGCGGCGGCCGCCGG - Intergenic
1160187786 18:76688843-76688865 GGAGGAGCAGAAGCAGCCGGGGG + Intergenic
1160514855 18:79472620-79472642 GGGGGAGGGGAAGAGGCCACAGG - Intronic
1160818428 19:1046892-1046914 GGAGAAGGAGACGCGGCTGCGGG + Exonic
1161065564 19:2235828-2235850 GCTGGAGGAGACACGGGCGCCGG + Exonic
1161137347 19:2627409-2627431 GTGGGAGGAGAGGCGGCCACAGG - Intronic
1161979627 19:7623811-7623833 TGTTGAGGAGCAGGGGCCGCCGG + Exonic
1162440272 19:10688214-10688236 GGCTGAGGAGAGGCGGCTGCTGG + Intronic
1162493282 19:11007904-11007926 GGAGGAGGAAGAGCAGCCGCAGG + Exonic
1162740228 19:12769880-12769902 GCTGGAGGCGCAGCGGCGGCAGG - Exonic
1162744753 19:12792123-12792145 GGTGGAGGTGCAGGGGGCGCAGG + Exonic
1162973510 19:14195355-14195377 ACAGGAGGAGAAGCGGCTGCTGG + Intronic
1162995722 19:14333763-14333785 GATGGAGGAGGAGCGGCATCCGG - Intergenic
1163690899 19:18737730-18737752 GGAGGAGGAGGAGCAGCAGCAGG - Intronic
1164639361 19:29812632-29812654 CGTGGGGGAGGGGCGGCCGCGGG + Intronic
1164678575 19:30119256-30119278 GGTAGAGGAAAAGCTGCCTCAGG - Intergenic
1165074658 19:33273991-33274013 GGAGGAGGAGAGGCAGCCTCAGG - Intergenic
1165116759 19:33533383-33533405 GGTGGTGGAGAAGCTGCTCCAGG + Intergenic
1165408103 19:35642831-35642853 GGTGAAGGAAAAGGGGGCGCGGG + Intronic
1165694157 19:37887862-37887884 GGTAGAGGAGAAGCTGACACAGG - Exonic
1165828133 19:38717211-38717233 GGTGCAGGAGAAGTGCCAGCTGG + Exonic
1165850865 19:38849716-38849738 GGTGGAGGAGCCGGGGCGGCGGG - Exonic
1166397524 19:42452753-42452775 GGTGCAGGAGGAACTGCCGCTGG - Intergenic
1166731977 19:45064336-45064358 GGAGGAGGAGCGGCGGCTGCAGG - Exonic
1166781729 19:45346705-45346727 GGAGGAGGAGAAGCGCCACCTGG + Exonic
1167494230 19:49808622-49808644 GGTGGAGGAGCAGCAGCCTGTGG + Exonic
1167571903 19:50293573-50293595 TCTGGAGGAGAAGCGTCAGCTGG + Exonic
1167573731 19:50307115-50307137 GGTGGAGGAGGAGCGGAGGGTGG + Exonic
1167607364 19:50488577-50488599 GGTGGGGGAGAGGGGGCCCCGGG + Exonic
1167648021 19:50716316-50716338 GGAGGAGGAGAGGCTGCTGCGGG - Exonic
1168286934 19:55339942-55339964 GGAGGAGGAGAAGCGGGTGAGGG + Exonic
925005439 2:439823-439845 CTTGTGGGAGAAGCGGCCGCTGG + Intergenic
925098580 2:1227384-1227406 GGTGGAGGACAGTCGGCCCCTGG + Intronic
925611317 2:5705612-5705634 GGTGGAGGAGCAGGGGAAGCAGG + Intergenic
925611445 2:5705998-5706020 GGTGGAGGAGGAGGGGAGGCAGG + Intergenic
925829038 2:7877424-7877446 GGTGAAGGAGAAGGGGCTGAGGG + Intergenic
925829141 2:7877808-7877830 GGTGAAGGAGAAGCGGTTGAGGG + Intergenic
925899066 2:8495572-8495594 GGTCGAGGAGCAGCTGCAGCTGG - Intergenic
926154987 2:10448573-10448595 GGGCGGGGAGAGGCGGCCGCAGG - Intergenic
926166482 2:10524432-10524454 GGTGGAGGAGCAGCAGCTGGAGG + Intergenic
926243530 2:11105469-11105491 GGTGTGGGAGAGGCAGCCGCCGG + Intergenic
926407534 2:12570657-12570679 GGTGAAGGAGAAGCGGTTGAGGG - Intergenic
927981947 2:27380053-27380075 GGTTAAGGATTAGCGGCCGCTGG - Intronic
928130105 2:28643000-28643022 GGTGCAGGAGAGGTGGCCGGAGG + Exonic
928215457 2:29357621-29357643 GGTGGGGGAGATGGGGCCTCAGG - Intronic
928278817 2:29926047-29926069 GGAGGAGGAGCAGCAGCAGCAGG + Intergenic
928314103 2:30232540-30232562 GTTAGAGGAGAAGCGGCCGGGGG + Intronic
928904560 2:36356057-36356079 GGAGGAGGGGAAGCTGCCGCCGG + Exonic
930487448 2:52026144-52026166 GGTGGAGGAGCAGAGGCTGGGGG + Intergenic
930725483 2:54677470-54677492 CTTGGAGGAGATGGGGCCGCAGG - Intergenic
931116936 2:59175084-59175106 TCTGGAGGAGCAGCGGCAGCGGG - Intergenic
934921350 2:98347289-98347311 GATGGAGGAGAAGGGGCGGCGGG + Intronic
936010561 2:108922644-108922666 GGTGGAGGAGGAGCTGACCCTGG - Intronic
936285258 2:111176568-111176590 GGTGGAGGTGAGGTGGCCCCGGG + Intergenic
942046157 2:172100593-172100615 GGTGGTGGTGATGCGGCTGCGGG + Exonic
943076039 2:183196280-183196302 GGTGGAGGTGAAGTGTCAGCAGG + Intergenic
943645944 2:190408228-190408250 GGAGGAGGAGGAGCCGCAGCGGG + Intergenic
944131184 2:196349064-196349086 GGTGGAGAAGAGGGTGCCGCAGG - Intronic
944876344 2:203966714-203966736 GGTGAAGGAGAAGTGGTCGGGGG + Intergenic
946037500 2:216755599-216755621 GGTTGAGGAGGAGAGGCCGTGGG + Intergenic
946370651 2:219279509-219279531 GGCGGAGGAGGTGCGGCCGGGGG + Exonic
947724359 2:232387922-232387944 GGGGGTGGAGAAGCGGAGGCTGG + Intergenic
947752370 2:232539759-232539781 GCAGGAGGAGCAGCGGCCCCTGG - Exonic
948163084 2:235841100-235841122 GATGGAGCAGAAGCGGCGGCAGG + Intronic
948656649 2:239480393-239480415 GGTGGTGGAGAAGGGAGCGCCGG + Intergenic
948698698 2:239747386-239747408 GCTGGGGAAGAAGCGGCCACAGG - Intergenic
948850267 2:240702248-240702270 TGTGGAGAGGAAGCGGCCTCTGG - Intergenic
948941286 2:241198114-241198136 GGTGGAGGGGAGTCGGACGCAGG - Intronic
949001516 2:241616952-241616974 GGTGCAGGGGGAGCGGCCCCAGG - Intronic
949037270 2:241821623-241821645 GGTGGAAGAGAAGGGGGAGCAGG - Intergenic
1169487012 20:6042189-6042211 GGAGGCTGAGAAGGGGCCGCTGG + Exonic
1172955501 20:38755117-38755139 GCGGGAGGAGAAGCTGCAGCTGG + Exonic
1174507036 20:51023438-51023460 CGTGCAGGCGAAGGGGCCGCAGG - Intergenic
1174578549 20:51554865-51554887 GGTGGAGGAGGAGCTGACGAGGG + Intronic
1175343095 20:58247462-58247484 GGTGGAAGTGAAGGGGCCGAGGG + Intergenic
1175466141 20:59192213-59192235 GCTGGAGAAGAAGCGGCTGGAGG + Exonic
1175913725 20:62416171-62416193 GGAGGAGGTGAAGCGGCTTCGGG - Exonic
1176100917 20:63364110-63364132 GGTGCAGGGGAAGAGGCCGTGGG + Intronic
1176109545 20:63405158-63405180 GGTGGAGGAGAAACGGGCCCAGG + Intergenic
1176549265 21:8214446-8214468 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176557158 21:8258669-8258691 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176568197 21:8397484-8397506 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1176576100 21:8441704-8441726 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1178331384 21:31696584-31696606 GGAGGAGGAGAGGCAGCAGCGGG + Exonic
1178439157 21:32584406-32584428 GGGGGAGAAGGAGCGGCTGCGGG - Intronic
1179831293 21:43998304-43998326 GGTGGAGGAGATGGAGCTGCAGG + Intergenic
1180702790 22:17790800-17790822 GCTGGAGGAGCAGCGGCTCCGGG - Exonic
1180782628 22:18529476-18529498 GCAGGAGGAGAAGCTGCAGCAGG + Exonic
1180951271 22:19721678-19721700 GGTGGAGGCCAAGGGGCAGCGGG + Exonic
1181126185 22:20703503-20703525 GCAGGAGGAGAAGCTGCAGCAGG + Intergenic
1181239518 22:21468814-21468836 GCAGGAGGAGAAGCTGCAGCAGG + Intergenic
1182346993 22:29673403-29673425 GGAGGAGGAGAAGCGCCTGATGG + Exonic
1182476399 22:30578947-30578969 GCTGGAGGATAAGCAGCGGCTGG - Exonic
1183184799 22:36285750-36285772 GTTAGAGGAGAAGCGGCGTCTGG - Exonic
1183301408 22:37060837-37060859 GCTGGAGGAGCAGCAGCAGCAGG + Exonic
1183498069 22:38161778-38161800 CGTGGAGGGGAAGGGGCTGCAGG + Intronic
1183830328 22:40415499-40415521 GGAGGAGGAGGAGCGGCTGAGGG - Intronic
1184325017 22:43776234-43776256 GGAAGAGGAGAAGGGGCCGTGGG + Intronic
1184520451 22:44990978-44991000 TGTGGAGGAGCCGCGGCAGCAGG - Intronic
1184620306 22:45671826-45671848 GGAGGAGGAGACGGCGCCGCGGG - Exonic
1184709385 22:46239599-46239621 GGCTTAGGAGAAGCGGCCGATGG + Exonic
1184782212 22:46655094-46655116 GGTGGAAGAGAAGCTTCCTCGGG + Intronic
1185171844 22:49298906-49298928 GGTGGTGGAGAAGCTGCTGTGGG - Intergenic
1185171855 22:49298966-49298988 GGCGGTGGAGAAGCTGCTGCGGG - Intergenic
1185171866 22:49299026-49299048 GGTGGTGGAGAAGCTGCTGCGGG - Intergenic
1185171870 22:49299047-49299069 GGCGGTGGAGAAGCTGCTGCGGG - Intergenic
1203254150 22_KI270733v1_random:130762-130784 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203262206 22_KI270733v1_random:175841-175863 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
952143236 3:30502460-30502482 TGTGAAGGAGAAGAGGCTGCTGG - Intergenic
954404329 3:50337126-50337148 GCGGGAGGGGAAGCGGTCGCTGG - Intronic
954459255 3:50617185-50617207 GGGGCAGGAGAGGCGGTCGCGGG - Intronic
956290424 3:67654668-67654690 GTCAGAGGAGAAGCGGGCGCGGG + Intergenic
957078656 3:75619721-75619743 GATGGAGCAGAAGCTGCGGCGGG - Intergenic
957175539 3:76803342-76803364 GGAGGAGGAGAAGCGGGAGGAGG + Intronic
958933493 3:100232446-100232468 GTTGGAGGAGAAGAGGGTGCCGG + Intergenic
961714620 3:128849909-128849931 GGTGGAGGGGAAGTGTCCTCTGG - Intergenic
961740950 3:129032877-129032899 GGTGGAGGAGGAGAGGTGGCAGG + Exonic
963882712 3:150546363-150546385 GGAGGAAGAGAACTGGCCGCCGG + Exonic
964983451 3:162713450-162713472 GGTGAAGGAGAAGGGGTCGGGGG - Intergenic
965439380 3:168694002-168694024 GGAGGAGGAGAAGTAGCAGCAGG + Intergenic
966787619 3:183635649-183635671 GCTGGAGGAGACGCCGGCGCTGG + Exonic
967055396 3:185825261-185825283 GGAGGAGGAGCAGCGGCGGGCGG + Intergenic
967628453 3:191713817-191713839 GGTGGAAGAGAAGAGCCTGCAGG - Intergenic
967869343 3:194217201-194217223 TTTGGAGGAGAAGCGGGGGCAGG + Intergenic
968054186 3:195678579-195678601 TGTGGAGGAGAGGGAGCCGCAGG + Intergenic
968101705 3:195970563-195970585 CGTGGAGGAGAGGGAGCCGCAGG - Intergenic
968483714 4:848887-848909 GGTGGAGGACCAGGGGCCCCTGG - Intergenic
968618432 4:1592786-1592808 CAGGGAGGAGAGGCGGCCGCGGG + Intergenic
968660082 4:1795238-1795260 GGTGCCGGAGGGGCGGCCGCGGG + Intronic
968758416 4:2428476-2428498 GATGGAGGAAGAGCTGCCGCTGG - Intronic
969021737 4:4143689-4143711 GATGGAGCAGAAGCTGCGGCGGG - Intergenic
969131833 4:4995730-4995752 GGTGGAGGAGAGGTGGGTGCAGG + Intergenic
969367836 4:6709617-6709639 GCAGGAGGAGATGCGGCCCCTGG - Exonic
969732132 4:8963726-8963748 GATGGAGCAGAAGCTGCGGCGGG + Intergenic
970715460 4:18916781-18916803 GGTGGAGGTGAAGGGGGAGCAGG - Intergenic
971757541 4:30721875-30721897 GGTGGAGGAGAATCGGCCGGTGG + Exonic
972533073 4:39977618-39977640 CGAGGAGGAGCAGCCGCCGCGGG + Exonic
973981869 4:56314486-56314508 AGCGGAGGAGAGGCGGCGGCTGG + Exonic
973982008 4:56315056-56315078 GGTGGAGGAGCTGCGGTGGCAGG + Exonic
975072840 4:70163635-70163657 GGTGGAGGAAAAGTGGAAGCAGG - Exonic
976561927 4:86511707-86511729 GGAGGAGGAGGAGCGGGAGCAGG + Intronic
977607335 4:98995978-98996000 GGAGGAGGAAACGCGGCCGGGGG - Intronic
981044537 4:140253080-140253102 GGAGGAGGGGAAGAGGCCGAGGG + Intergenic
981084573 4:140669769-140669791 GCTGGAGGAGACGAGGCTGCTGG + Exonic
982435150 4:155376708-155376730 GGTCGCGGAGAACTGGCCGCGGG - Intronic
982462268 4:155685536-155685558 GGTGGAGGAGCTGCGGAAGCTGG - Intronic
985129627 4:186726659-186726681 AGTTGAGGAGTTGCGGCCGCCGG + Intronic
985565091 5:611758-611780 GGTGGAGAAGGACCGGCCGTGGG + Intergenic
985628956 5:1005035-1005057 GGAGGAGGAGGTGCGGCCGCAGG - Intergenic
986132175 5:4942106-4942128 GGAGAAGAAGAAACGGCCGCAGG - Intergenic
986321187 5:6633594-6633616 GGTGGCGGAGGAGCGCCTGCTGG + Exonic
990210545 5:53478918-53478940 GGTGCAGGTGCGGCGGCCGCGGG + Intergenic
990825417 5:59893329-59893351 GCTCGAGGCGTAGCGGCCGCGGG + Exonic
995388308 5:111612244-111612266 GGTGGAGGAGGGGCGGGGGCGGG + Intergenic
997485290 5:134226016-134226038 GGAGGAGGCGCAGCGGCCGACGG - Exonic
997952418 5:138252935-138252957 GGTGGAGGGGAAGAGGGCCCTGG + Exonic
999174419 5:149621846-149621868 GGTGGAAGAGAAGCTGCTGGAGG + Exonic
999768106 5:154755829-154755851 GGTGAGGAAGAAGCCGCCGCCGG + Intronic
1002029390 5:176416619-176416641 GGTCGCCGAGCAGCGGCCGCAGG + Intergenic
1004308608 6:14523637-14523659 GGAGAGGGAGAAGGGGCCGCTGG - Intergenic
1005307815 6:24530700-24530722 GGTTGGGGAGAAGAGGCTGCTGG + Intronic
1005935553 6:30518097-30518119 GGTGGGGGAGGAGCGCCCTCTGG + Intergenic
1006341160 6:33447852-33447874 GGTGGAGGAGGAGCTGCGCCGGG + Exonic
1007369397 6:41416505-41416527 GGTGGAGGGAACGGGGCCGCAGG - Intergenic
1007415938 6:41691237-41691259 TGTGGATGAGAAGGGGCAGCAGG + Intronic
1007423883 6:41734941-41734963 GGTGGAGGGGGAGTGGGCGCGGG + Intronic
1007423922 6:41735081-41735103 GGTCGCGGAGAAGCCGCCCCCGG + Intronic
1007700037 6:43761091-43761113 GGGGGAGGAGATGCCACCGCAGG + Intergenic
1008109642 6:47478198-47478220 GGAGGAGGAGGAGCGGACGTCGG + Exonic
1009685832 6:66955690-66955712 GGTGGAGGTGAAGGGGAAGCAGG + Intergenic
1011318793 6:86066243-86066265 AGTGGAGGAGAAGGGGTGGCTGG - Intergenic
1012980986 6:105830839-105830861 GGAGGAGGGGAAGGGGCCGCAGG + Intergenic
1012981003 6:105830884-105830906 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981011 6:105830905-105830927 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981019 6:105830926-105830948 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981035 6:105830967-105830989 GGAGGAGGGGAAGGGGCAGCGGG + Intergenic
1012981041 6:105830988-105831010 GGAGGAGGAGAAGGGGCAGCTGG + Intergenic
1012981049 6:105831009-105831031 GGAGGAGGGGAAGGGGCAGCCGG + Intergenic
1012981057 6:105831030-105831052 GGAGGAGGAGAAGGGGCAGGTGG + Intergenic
1012981118 6:105831184-105831206 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1012981132 6:105831227-105831249 GGAGGAGGAGAAGGGACAGCTGG + Intergenic
1012981140 6:105831248-105831270 GGAGGAGGGGAAGGGGCAGCTGG + Intergenic
1015890022 6:137961046-137961068 GGTGGAGGTGAAGGGGAAGCAGG - Intergenic
1015936098 6:138407239-138407261 GATGGAGGGGAATCGGCCGCAGG - Intronic
1016461654 6:144285278-144285300 GGAGGAGGAGGAGCCGCCGAAGG + Intergenic
1018471318 6:164101038-164101060 GGTGGAGGAGAGGAGCCTGCAGG - Intergenic
1018471514 6:164101601-164101623 GGTGGAGGAGAGGAGCCTGCAGG - Intergenic
1018471519 6:164101622-164101644 GGTGGAGGAGAGGAGCCTGCAGG - Intergenic
1018471524 6:164101643-164101665 GGTGGAGGAGAAGAGCCTGCAGG - Intergenic
1018471528 6:164101664-164101686 GGTGGAGGAGAGGAGCCTGCAGG - Intergenic
1018471533 6:164101685-164101707 GGTGGAGGAGAGGAGCCTGCAGG - Intergenic
1018471538 6:164101706-164101728 GGTGGAGAAGAAGAGCCTGCAGG - Intergenic
1018471548 6:164101748-164101770 GGTGGAGGAGAAGAGCCTGCAGG - Intergenic
1018471566 6:164101811-164101833 TGTGGAGGAGAAGAGCCTGCAGG - Intergenic
1019053418 6:169201943-169201965 GGCAGAGGAGAAGCAGCCGCGGG - Intergenic
1019421746 7:954128-954150 GGGGGAGGGGAGGCGGCGGCAGG + Intronic
1019478669 7:1256111-1256133 GGTGGAGGTGAAGTGGGGGCAGG - Intergenic
1019555176 7:1625696-1625718 GCTGGAGGAGAAGGGGCCCAAGG - Intergenic
1019597345 7:1864260-1864282 GGAGGAGGGGAGGCGGCTGCAGG + Intronic
1019599564 7:1874460-1874482 GGTGGAGGAGAGGAGGCGGAGGG + Intronic
1020046732 7:5046115-5046137 GGCGGAGGCGAAGGGGCGGCGGG + Exonic
1020288793 7:6706692-6706714 GGCGGAGGCGAAGGGGCGGCGGG - Exonic
1020292102 7:6730042-6730064 GGCGGAGGCGAAGGGGCGGCGGG + Intergenic
1020309154 7:6855719-6855741 GATGGAGCAGAAGCTGCGGCGGG - Intergenic
1022517243 7:30983896-30983918 GCTGGTGGAGAAGGGGCTGCTGG + Intronic
1022607611 7:31831700-31831722 GGAGGAGGAGAAGGGGCAGACGG + Intronic
1023834029 7:44058131-44058153 GGAGGAGGAGAACCGTCGGCTGG + Exonic
1025940866 7:66075646-66075668 GCTGGAGGCTAAGCGGCCCCGGG - Intergenic
1026010055 7:66629249-66629271 CGCGGGGGAGAAGCGGGCGCGGG + Intronic
1026799475 7:73390390-73390412 AGTGGAGGAGAAGTAGCCTCAGG + Intergenic
1027121867 7:75527827-75527849 GGCGGAGGCGAAGGGGCGGCGGG - Intergenic
1027596555 7:80181484-80181506 GGTGGAGGACCAGAGGCCACAGG - Intronic
1028525669 7:91783188-91783210 GGGTGAGGAGAAGGGGCTGCAGG - Intronic
1028796513 7:94908643-94908665 GGCGGGGGAGATGGGGCCGCCGG - Intronic
1029458637 7:100683333-100683355 GGAGGAGCAGAAGCGGCGGCAGG - Exonic
1029514413 7:101016814-101016836 GATGGGGGAGAAGCAGCCGGTGG + Intronic
1029958700 7:104667450-104667472 AGGAGAGTAGAAGCGGCCGCTGG - Intronic
1031117220 7:117681490-117681512 CGTGGAGGAGAAGAGGCTGTTGG + Intronic
1031915975 7:127563576-127563598 GTTGGAGGAGGAGAGGCCGGAGG + Intergenic
1032035260 7:128516958-128516980 GGTGGAGGGGAGGCAGCCACGGG + Intergenic
1032239522 7:130149927-130149949 GGTGCAGAAGAGGCAGCCGCAGG + Intergenic
1032949983 7:136896774-136896796 GGTGGTGGAGATGTGGCTGCAGG + Intronic
1033602753 7:142900083-142900105 GGTGGAGGAGAAGGGGCAGGAGG - Intergenic
1034310703 7:150085091-150085113 GGTGGAGGAGCAATGGCCGTGGG + Intergenic
1034324775 7:150220501-150220523 GGAGAAGGAGAAGCAGCTGCTGG + Intergenic
1034508939 7:151519256-151519278 GGTGGAGGAGCCGCGGTAGCTGG - Intronic
1034674707 7:152884105-152884127 GGTGCAGGAGAGGCACCCGCAGG + Intergenic
1034768416 7:153748730-153748752 GGAGAAGGAGAAGCAGCTGCTGG - Intergenic
1034977847 7:155458419-155458441 GGTGGAGGGACAGCGGCAGCCGG + Exonic
1035268177 7:157703738-157703760 GGCAGAGGACAAGCGGCCGCGGG - Intronic
1035654626 8:1296142-1296164 GGTGGATGAAATGCGGCCCCCGG + Intergenic
1035747566 8:1973546-1973568 GGAGGGGGAGAAGCGCCCGGCGG + Intergenic
1035818055 8:2562101-2562123 GGTGGAGGAGGAGCCGTCGCAGG - Intergenic
1036700093 8:11007739-11007761 GGTGGAGGAACAGAGGCAGCAGG + Intronic
1038422120 8:27440114-27440136 GGAGGAGGAGGAGGGACCGCAGG + Intronic
1039971105 8:42322443-42322465 GCTGCAGGAGAAGCGGCAGAAGG + Exonic
1041377104 8:57216014-57216036 GGTGGAGGGGCGGGGGCCGCAGG + Intergenic
1042183832 8:66117707-66117729 GGTGGAGGAGAAGTGGGGGTGGG + Intergenic
1043388198 8:79768139-79768161 CGGGGAGGAGCCGCGGCCGCCGG - Intergenic
1043389652 8:79780026-79780048 GGAGGAGGAGATGCTGCTGCTGG + Intergenic
1043837489 8:85063789-85063811 GGTGAAGGAGAAGCGGTTGAGGG - Intergenic
1045679170 8:104640473-104640495 GGAGGAGGAGAGGCGGACCCAGG + Intronic
1047371751 8:124261682-124261704 GGTGAAGGAGCAGCTGCCCCTGG + Intergenic
1048214156 8:132480544-132480566 GGAGAAGGCGAAGCGGCCGGCGG - Exonic
1048553968 8:135457600-135457622 GGCCGAGGAGGAGCGGGCGCGGG - Exonic
1049316147 8:141969414-141969436 GATGGAGGAGAACCGGGAGCTGG - Intergenic
1049502753 8:142976249-142976271 GCTGGAGGAGAATCCGCCTCGGG + Intergenic
1049682290 8:143924828-143924850 GCTGGAGAAGCAGCGGCAGCTGG - Exonic
1049682478 8:143925803-143925825 GCTGGAGAAGCAGCGGCAGCTGG - Exonic
1050284223 9:4084460-4084482 GGTGGAGAAGAAACAGCCACGGG + Intronic
1050494918 9:6230556-6230578 AGTGGAGGAGAAGCGGGGGATGG - Intronic
1052192867 9:25678411-25678433 GGAGGAGGAGAGGAGGTCGCGGG + Exonic
1053427159 9:38017664-38017686 AGTGGTGGAGTAGCGGCAGCGGG - Intronic
1057311503 9:93946055-93946077 GGTGGAAGCGGAGCTGCCGCGGG + Intergenic
1057813850 9:98279494-98279516 GAGGGAGGAGAAGCAGCTGCAGG - Intergenic
1058893952 9:109383913-109383935 GGTGCAGGAGGAGGGGCCGTTGG - Intronic
1060625872 9:125110840-125110862 GGTGGAGGCAAAGCGGGAGCAGG - Intronic
1060700692 9:125747216-125747238 GGCTGAGGAGAAGCGGCGGGCGG - Intergenic
1060818080 9:126645873-126645895 GGTGGGGGAGAAGCCGCTGAGGG + Intronic
1060893485 9:127202886-127202908 GGAGGTGGGGAGGCGGCCGCAGG + Intronic
1061262634 9:129488542-129488564 GGGCGTGGAGAGGCGGCCGCGGG - Intergenic
1061297856 9:129686783-129686805 GGTGGAGGAGGGGCGGCCGGTGG - Intronic
1061490149 9:130939934-130939956 GGCGGAGGAGGGGCGGCCGGCGG - Intergenic
1061592038 9:131603876-131603898 GGTGCGGGGGAAGCGGCCTCGGG + Intronic
1062167362 9:135114610-135114632 GGTGGAGGGGCAGCTCCCGCAGG + Intronic
1062215936 9:135389887-135389909 TGTGGGGGAGAAGAGGCCCCCGG - Intergenic
1062235087 9:135504019-135504041 GGCCAAGGAGAAGCGGCAGCAGG + Exonic
1062405003 9:136391998-136392020 GGAGGAGGAGGAGCGGCTGCAGG - Exonic
1203470551 Un_GL000220v1:113906-113928 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1203478372 Un_GL000220v1:157878-157900 GGAGGAGGAGGAGGGGCGGCGGG - Intergenic
1185643115 X:1599318-1599340 GGAGGAGCAGAAGCAGCTGCAGG + Exonic
1187265228 X:17726054-17726076 AGTGGAGGAGAAGCTGCAGGAGG - Exonic
1190084217 X:47381189-47381211 GGAGGAGGAGAAGCAGCAGGAGG + Intronic
1195841252 X:109179324-109179346 GGTGAAGGAGAAGGGGCTGGGGG - Intergenic
1198705797 X:139446914-139446936 GGTGGTGGAGGAGCGCCTGCTGG + Intergenic
1199846049 X:151693990-151694012 GTTGGAGGGGAGGCGGCCGGTGG + Intergenic
1200093813 X:153648004-153648026 GGAGCAGGAGCCGCGGCCGCGGG - Exonic
1200111600 X:153743573-153743595 GACGGAGGAGAAGCAGCGGCTGG + Exonic
1200231991 X:154448689-154448711 GGAGGAGGAGAATCGGCTTCGGG + Exonic