ID: 1125728860

View in Genome Browser
Species Human (GRCh38)
Location 15:41881939-41881961
Sequence GAATAACGACGCCCGGGCCG AGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 21
Summary {0: 1, 1: 0, 2: 0, 3: 1, 4: 19}

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125728851_1125728860 -2 Left 1125728851 15:41881918-41881940 CCCTGTCCCCGTCCTCACCGTGA 0: 1
1: 0
2: 25
3: 26
4: 164
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728848_1125728860 10 Left 1125728848 15:41881906-41881928 CCAGGCGCCCTTCCCTGTCCCCG 0: 1
1: 0
2: 4
3: 49
4: 490
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728850_1125728860 2 Left 1125728850 15:41881914-41881936 CCTTCCCTGTCCCCGTCCTCACC 0: 1
1: 1
2: 14
3: 135
4: 1209
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728853_1125728860 -8 Left 1125728853 15:41881924-41881946 CCCCGTCCTCACCGTGAATAACG 0: 1
1: 0
2: 0
3: 1
4: 33
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728846_1125728860 30 Left 1125728846 15:41881886-41881908 CCGCGGTGGAGCAAGGGAGACCA 0: 1
1: 0
2: 0
3: 12
4: 144
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728855_1125728860 -10 Left 1125728855 15:41881926-41881948 CCGTCCTCACCGTGAATAACGAC 0: 1
1: 0
2: 0
3: 1
4: 40
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728849_1125728860 3 Left 1125728849 15:41881913-41881935 CCCTTCCCTGTCCCCGTCCTCAC 0: 1
1: 0
2: 6
3: 97
4: 880
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728852_1125728860 -3 Left 1125728852 15:41881919-41881941 CCTGTCCCCGTCCTCACCGTGAA 0: 1
1: 0
2: 1
3: 7
4: 142
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19
1125728854_1125728860 -9 Left 1125728854 15:41881925-41881947 CCCGTCCTCACCGTGAATAACGA 0: 1
1: 0
2: 0
3: 1
4: 25
Right 1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG 0: 1
1: 0
2: 0
3: 1
4: 19

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125728860 Original CRISPR GAATAACGACGCCCGGGCCG AGG Exonic
900198924 1:1393684-1393706 GAAGAACGAGGCCTGTGCCGTGG - Intronic
901701299 1:11045995-11046017 CAAAAACGACGCAGGGGCCGAGG - Intronic
919261925 1:195207825-195207847 GAATAATGACGTCCAGGCTGAGG + Intergenic
1072195536 10:93114733-93114755 GAACAACGACAGCCGGGCAGAGG + Intergenic
1072591470 10:96832202-96832224 GAGGCGCGACGCCCGGGCCGCGG + Intergenic
1104600866 12:130152482-130152504 GAAGAACCACTCCCGGGCCCAGG + Intergenic
1125728860 15:41881939-41881961 GAATAACGACGCCCGGGCCGAGG + Exonic
1129260821 15:74366155-74366177 GAATAGCGCGGCCCGGGCGGCGG + Intronic
1141777109 16:86131464-86131486 GAATAAGGAGGCCCGAGCAGAGG + Intergenic
1143053076 17:4142772-4142794 GAGCCGCGACGCCCGGGCCGGGG + Exonic
1160007952 18:75082128-75082150 GGATAAAGACGCCCAGGCCTGGG - Intergenic
1160947918 19:1652142-1652164 GAACAATGACTCCCGGGCCGCGG + Intronic
1162439730 19:10685768-10685790 GAATGAAGACGCAAGGGCCGAGG - Intronic
933810477 2:86029882-86029904 GAACCACCACGCCCGGCCCGAGG + Intronic
1173724888 20:45290531-45290553 GAACAAAGACCCCCGGGCCCGGG - Intergenic
960024336 3:112990998-112991020 GAATGGCGGCGCCCGGGCTGCGG + Exonic
967121081 3:186383491-186383513 GAATGACGCTGCCCGGGCAGTGG - Intergenic
976952325 4:90849247-90849269 GGATAACGAAGTCTGGGCCGAGG + Intronic
978529946 4:109703094-109703116 GAGTAGCGACGCCGGCGCCGGGG - Intronic
992475714 5:77099892-77099914 GAACCACAACGCCCGGCCCGGGG + Intergenic
1036676015 8:10833765-10833787 GAAAAACGACGACTGGGCTGCGG + Intronic