ID: 1125728879

View in Genome Browser
Species Human (GRCh38)
Location 15:41882022-41882044
Sequence GCTGAGGCGCCACGTGCGGC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 148
Summary {0: 1, 1: 0, 2: 0, 3: 7, 4: 140}

Found 4 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125728879_1125728887 11 Left 1125728879 15:41882022-41882044 CCAGCCGCACGTGGCGCCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1125728887 15:41882056-41882078 GGCCGCCTGGTCCTGACCGCAGG 0: 1
1: 0
2: 0
3: 8
4: 171
1125728879_1125728892 29 Left 1125728879 15:41882022-41882044 CCAGCCGCACGTGGCGCCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1125728892 15:41882074-41882096 GCAGGACGCTCTCTCCAGCGAGG 0: 1
1: 0
2: 1
3: 8
4: 118
1125728879_1125728886 -2 Left 1125728879 15:41882022-41882044 CCAGCCGCACGTGGCGCCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1125728886 15:41882043-41882065 GCAGGGTCTCGGCGGCCGCCTGG 0: 1
1: 0
2: 1
3: 15
4: 213
1125728879_1125728884 -10 Left 1125728879 15:41882022-41882044 CCAGCCGCACGTGGCGCCTCAGC 0: 1
1: 0
2: 0
3: 7
4: 140
Right 1125728884 15:41882035-41882057 GCGCCTCAGCAGGGTCTCGGCGG 0: 1
1: 0
2: 0
3: 8
4: 124

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125728879 Original CRISPR GCTGAGGCGCCACGTGCGGC TGG (reversed) Exonic