ID: 1125731643

View in Genome Browser
Species Human (GRCh38)
Location 15:41895536-41895558
Sequence GTCTCCCTGGGGTAAGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 1 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125731643_1125731651 17 Left 1125731643 15:41895536-41895558 CCACCCGCTTACCCCAGGGAGAC No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125731643 Original CRISPR GTCTCCCTGGGGTAAGCGGG TGG (reversed) Intergenic
No off target data available for this crispr