ID: 1125731651

View in Genome Browser
Species Human (GRCh38)
Location 15:41895576-41895598
Sequence CTAGTAAGACCCTCAGCCCA TGG
Strand +
Crispr in exon? No
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total No data
Summary No data

Found 9 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125731648_1125731651 4 Left 1125731648 15:41895549-41895571 CCAGGGAGACTGAGCTTGTTCCT No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731646_1125731651 6 Left 1125731646 15:41895547-41895569 CCCCAGGGAGACTGAGCTTGTTC No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731642_1125731651 18 Left 1125731642 15:41895535-41895557 CCCACCCGCTTACCCCAGGGAGA No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731639_1125731651 24 Left 1125731639 15:41895529-41895551 CCTCATCCCACCCGCTTACCCCA No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731643_1125731651 17 Left 1125731643 15:41895536-41895558 CCACCCGCTTACCCCAGGGAGAC No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731638_1125731651 25 Left 1125731638 15:41895528-41895550 CCCTCATCCCACCCGCTTACCCC No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731644_1125731651 14 Left 1125731644 15:41895539-41895561 CCCGCTTACCCCAGGGAGACTGA No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731645_1125731651 13 Left 1125731645 15:41895540-41895562 CCGCTTACCCCAGGGAGACTGAG No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data
1125731647_1125731651 5 Left 1125731647 15:41895548-41895570 CCCAGGGAGACTGAGCTTGTTCC No data
Right 1125731651 15:41895576-41895598 CTAGTAAGACCCTCAGCCCATGG No data

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125731651 Original CRISPR CTAGTAAGACCCTCAGCCCA TGG Intergenic
No off target data available for this crispr