ID: 1125734044

View in Genome Browser
Species Human (GRCh38)
Location 15:41911456-41911478
Sequence CCGACAGTGAATGCCTGGCT TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 128
Summary {0: 1, 1: 0, 2: 1, 3: 7, 4: 119}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734039_1125734044 -8 Left 1125734039 15:41911441-41911463 CCAACTCCTTTGCCTCCGACAGT 0: 1
1: 0
2: 0
3: 18
4: 361
Right 1125734044 15:41911456-41911478 CCGACAGTGAATGCCTGGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 119
1125734038_1125734044 19 Left 1125734038 15:41911414-41911436 CCGCTGTGATGAGCAAGTGGTAA 0: 1
1: 0
2: 0
3: 12
4: 131
Right 1125734044 15:41911456-41911478 CCGACAGTGAATGCCTGGCTTGG 0: 1
1: 0
2: 1
3: 7
4: 119

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734044 Original CRISPR CCGACAGTGAATGCCTGGCT TGG Intronic
902082852 1:13833120-13833142 CCCACCTAGAATGCCTGGCTCGG - Intergenic
904056246 1:27672251-27672273 CCGACAGGGATTGGCTGCCTAGG - Intergenic
906681886 1:47732404-47732426 TCCTCAGTGAATTCCTGGCTAGG - Intergenic
910524076 1:88157282-88157304 CCGAAAGTGAATGCCTACCCTGG + Intergenic
913090050 1:115470448-115470470 CCGGATGTGAGTGCCTGGCTCGG + Intergenic
915281852 1:154828170-154828192 TCCATAGTGAATGCCTGGCCTGG + Intronic
915487217 1:156230100-156230122 CCAGCAGTGACTCCCTGGCTAGG + Intronic
916860899 1:168804041-168804063 ACGAAAGGGAATGCCTGCCTAGG + Intergenic
917149365 1:171928508-171928530 CAGACAGGGAACCCCTGGCTTGG - Intronic
921012933 1:211161101-211161123 CAGACAGGGAACCCCTGGCTTGG - Intergenic
921068587 1:211640397-211640419 CCGGGAGATAATGCCTGGCTGGG + Intergenic
921126661 1:212183985-212184007 AAGAAAGTGAATCCCTGGCTGGG - Intergenic
923566188 1:235077607-235077629 CCCAAAGGGAGTGCCTGGCTTGG - Intergenic
924170814 1:241338614-241338636 CCTACAGTGAAAGCCTGGAAAGG - Intronic
1064992171 10:21265749-21265771 GTGACAGAGACTGCCTGGCTTGG - Intergenic
1069825826 10:71254470-71254492 ACGACAGTGTGGGCCTGGCTTGG + Intronic
1075893797 10:125977735-125977757 CAGACAGGGAACCCCTGGCTTGG - Intronic
1078045196 11:7907440-7907462 CCCACAGTGAATCCCTGGCTTGG + Intergenic
1078294861 11:10057484-10057506 CAGACAGGGAACCCCTGGCTTGG + Intronic
1078775436 11:14389459-14389481 TGGACAGTGAGTGACTGGCTGGG - Intergenic
1079668320 11:23135133-23135155 CAGACAGGGAACCCCTGGCTTGG - Intergenic
1083185546 11:61015830-61015852 TCTACAGTGAGTGCCTGGCCGGG + Exonic
1084007358 11:66330469-66330491 CTGAAAGTCAATGTCTGGCTGGG + Intronic
1087399813 11:97651470-97651492 CAGACAGGGAATCCCTGGCTTGG - Intergenic
1094413427 12:30192025-30192047 CCGACAGAGCCTTCCTGGCTTGG - Intergenic
1095824275 12:46515744-46515766 CAGACAGGGAATCTCTGGCTTGG - Intergenic
1096914158 12:55013740-55013762 CAGACACTTAATGCCAGGCTGGG + Intergenic
1102531873 12:113552812-113552834 CCGCCAGCCAATGCCTGGGTGGG + Intergenic
1103414343 12:120733931-120733953 CCCACACTGGATGCCTGACTCGG - Intronic
1104753484 12:131254567-131254589 CCCACAGTGATATCCTGGCTGGG + Intergenic
1106130031 13:26932469-26932491 CCGACAGTGGTTGACTGTCTGGG - Intergenic
1110034998 13:70672440-70672462 CAGACAGGGAACTCCTGGCTTGG - Intergenic
1118957693 14:70497734-70497756 CAGACAGGGAACCCCTGGCTTGG + Intergenic
1120235210 14:81882532-81882554 CTGCCAGAGAATGCCGGGCTGGG - Intergenic
1120855435 14:89207974-89207996 CCTTCAGTGCATGCCTGGTTGGG + Intronic
1121324272 14:93010867-93010889 CTTACTGTGAATGCCTGGCATGG - Intronic
1121324279 14:93010930-93010952 CTTACTGTGAATGCCTGGCATGG - Intronic
1121583092 14:95045221-95045243 ATGACAGTGAATGCCAGGCATGG - Intergenic
1122060387 14:99133228-99133250 CCGACTGTGACTCCCTGCCTTGG - Intergenic
1122437630 14:101710737-101710759 CCTCCAGTGACTGCCTGGTTAGG + Intergenic
1125325564 15:38532963-38532985 CCTACAGTGAAGGCTTGTCTGGG + Intronic
1125734044 15:41911456-41911478 CCGACAGTGAATGCCTGGCTTGG + Intronic
1128264948 15:66257504-66257526 CTGAGAGTGAATGCCTCCCTAGG - Intergenic
1130232400 15:82107083-82107105 AGGTCAGTGAAAGCCTGGCTTGG - Intergenic
1131385722 15:92005306-92005328 CAGGCTGTGACTGCCTGGCTAGG - Intronic
1134836412 16:17365039-17365061 CCGACACTTGATGGCTGGCTGGG - Intronic
1140135616 16:72203034-72203056 CCTACAGTGTGTGGCTGGCTAGG + Intergenic
1141009906 16:80387618-80387640 GCGACCGTGAATTCCTGGCCAGG - Intergenic
1144062252 17:11593576-11593598 TCAACAGTAAATTCCTGGCTGGG + Intergenic
1160466105 18:79078013-79078035 CCTACAATGACTGCCAGGCTTGG + Intronic
1161585865 19:5105112-5105134 CCCACAGTACATGGCTGGCTTGG + Intronic
1163807930 19:19411287-19411309 ACGATACTGAATGCCTGGGTTGG + Intronic
932493713 2:72136496-72136518 GCTATTGTGAATGCCTGGCTGGG - Intronic
944280625 2:197892374-197892396 CCTAAATTGAATGCCTGGTTTGG + Intronic
944679660 2:202065423-202065445 CCCAGAGTGGATGCCTGGATTGG - Intergenic
945016266 2:205520253-205520275 CAGACAAGGAATCCCTGGCTTGG - Intronic
947672624 2:231948021-231948043 CGGACAGTGGATGCCAGGATGGG + Intergenic
1179950759 21:44707674-44707696 CCCAGAGTGACCGCCTGGCTCGG + Intronic
1181286052 22:21753462-21753484 CCGGCAGTGGAGGCCTGGCCAGG + Intergenic
1183562143 22:38583595-38583617 CAGAAAGGGAATGCCTGCCTAGG - Intronic
951197094 3:19836364-19836386 CAGACAGGGAACCCCTGGCTTGG + Intergenic
955530329 3:59866165-59866187 AGGACAGGGAAAGCCTGGCTGGG + Intronic
960164126 3:114382625-114382647 CCCACAGTGAATTCCTCCCTAGG + Intronic
963053057 3:141158670-141158692 CAGACAGGGAATCCCTTGCTTGG + Intergenic
967083307 3:186070812-186070834 CTGAAAGTGATTGCCTGCCTTGG - Intronic
968726763 4:2251434-2251456 CTGACTGTGACCGCCTGGCTGGG - Intronic
968856904 4:3132082-3132104 CTGAGTGTGAATGCCTGGCCTGG - Intronic
969489249 4:7489934-7489956 CGGATGGTGAATGCCAGGCTGGG + Intronic
969872651 4:10114541-10114563 ACGACAGGGAAGGCCTGGTTAGG + Intronic
970938861 4:21607587-21607609 CCCAGAGTGAATGAATGGCTGGG - Intronic
977308121 4:95351034-95351056 CTGACAGTGTCTGCCTGGCCAGG - Intronic
978735151 4:112076820-112076842 CAGACACTGAATGCATGGCATGG - Intergenic
982422375 4:155212099-155212121 CCCACAGATAATGCTTGGCTGGG - Intronic
984890341 4:184486460-184486482 CCAACAGTGAAAGCCTGCCTCGG + Intergenic
989370359 5:40700535-40700557 CAGACAGGGAACCCCTGGCTTGG + Intergenic
991599490 5:68338195-68338217 CCGACAGTGGATGCTTGACAGGG - Intergenic
993351230 5:86853070-86853092 CAGACAGGGAACCCCTGGCTTGG - Intergenic
994473383 5:100238271-100238293 CAGACAGGGAACCCCTGGCTTGG - Intergenic
995428705 5:112050750-112050772 CAGACAGCGAACCCCTGGCTTGG + Intergenic
999302642 5:150500675-150500697 CCCACAGGGAAAGCCTGGCCTGG + Intronic
1001799553 5:174531028-174531050 GGGACAGTGAATGTCTGGATTGG + Intergenic
1007895605 6:45354424-45354446 CCCAAAGTGTATGCCTCGCTTGG + Intronic
1008211485 6:48729771-48729793 CAGACAGGGAACCCCTGGCTTGG + Intergenic
1008973859 6:57401772-57401794 CAGACAGAGAACCCCTGGCTGGG - Intronic
1009162749 6:60303277-60303299 CAGACAGAGAACCCCTGGCTGGG - Intergenic
1010036729 6:71334101-71334123 CCTACTGTGAACACCTGGCTGGG + Intergenic
1012616453 6:101284299-101284321 CAGACAGGGAACACCTGGCTTGG + Intergenic
1017566881 6:155696324-155696346 CCCGCAGTGAATGCCTGCCTCGG - Intergenic
1020702370 7:11499214-11499236 CAGACAGGGAACTCCTGGCTTGG + Intronic
1022038433 7:26556385-26556407 CTGATAGGGAATGCCTGTCTGGG + Intergenic
1024165467 7:46724950-46724972 CAGACAGGGAACCCCTGGCTTGG + Intronic
1028430474 7:90741076-90741098 CCCACATTGAATGCTTGGTTAGG + Intronic
1031627087 7:124004312-124004334 CAGACAGGGAAACCCTGGCTTGG - Intergenic
1031937680 7:127752438-127752460 CCAGCAGTGAAAGGCTGGCTGGG - Intronic
1032279475 7:130489561-130489583 CCCACAGCGAATTCCTGGTTGGG + Intronic
1034275990 7:149824079-149824101 CCCACAGTGAATGCCGGCGTGGG + Intergenic
1034364318 7:150533525-150533547 CAGACAGGGAATCCCTGGCTTGG - Intergenic
1037596754 8:20360792-20360814 CCGACAGTGAATGACAGTCTTGG - Intergenic
1038233533 8:25728951-25728973 CAGACAGGGAACCCCTGGCTTGG - Intergenic
1039311727 8:36323568-36323590 GCAACAGTGGATGCCTGACTTGG + Intergenic
1040104017 8:43529733-43529755 CTGACAGTGAAGGCCAGGTTAGG + Intergenic
1040380594 8:46868300-46868322 CAGACAGTGAATGCCTAAATTGG + Intergenic
1042733665 8:71964084-71964106 CCGATGCTGAGTGCCTGGCTTGG + Intronic
1044162494 8:88936319-88936341 CAGACAGGGAACCCCTGGCTTGG + Intergenic
1048214483 8:132481713-132481735 CAGAGAGGGAATGACTGGCTTGG - Intergenic
1048922596 8:139244859-139244881 CCGACACTGAACACCTGCCTGGG + Intergenic
1049282185 8:141755318-141755340 CCTACTGTGAATGCCTGCTTTGG + Intergenic
1049684170 8:143932662-143932684 CCTACCGTGACTGCCTGGGTCGG - Exonic
1050786528 9:9410566-9410588 CCGACTATGAATTCCTTGCTAGG + Intronic
1051720228 9:20029222-20029244 CCGTGAGTCCATGCCTGGCTGGG + Intergenic
1052103333 9:24478833-24478855 CCTACAGTGAATGTGTGACTTGG + Intergenic
1052311577 9:27074555-27074577 CAGACAGGGAACACCTGGCTTGG - Intergenic
1052378160 9:27741383-27741405 CAGACAGGGAACCCCTGGCTTGG - Intergenic
1055225053 9:73985235-73985257 CAGACTGGGAATCCCTGGCTTGG + Intergenic
1056907430 9:90665782-90665804 CAGACAGGGAACTCCTGGCTTGG + Intergenic
1060920292 9:127415751-127415773 CTCACAGTGAATGCCAGGTTTGG - Intergenic
1062428316 9:136516169-136516191 CCAGCAGTGAGCGCCTGGCTGGG + Intronic
1188003091 X:25000406-25000428 CTGAGAGTGACAGCCTGGCTGGG - Intergenic
1191155276 X:57266675-57266697 TAGACAGGGAATCCCTGGCTGGG + Intergenic
1192891943 X:75399457-75399479 CAGACAGGGAACCCCTGGCTTGG + Intronic
1193739629 X:85202718-85202740 CAGAAAGGGAATGCCTGGCTTGG - Intergenic
1193858969 X:86640424-86640446 CAGACAGTAAACCCCTGGCTTGG + Intronic
1195361139 X:104084853-104084875 CAGACAGGGAACCCCTGGCTTGG - Intergenic
1196227908 X:113188450-113188472 CAGACAGGGAATCCCTTGCTTGG - Intergenic
1196857770 X:119999987-120000009 GCGACGGTCAGTGCCTGGCTGGG - Intergenic
1197122386 X:122907221-122907243 CAGACAGGGAACCCCTGGCTTGG + Intergenic
1199306978 X:146278887-146278909 CTGACAGAGAAGCCCTGGCTTGG - Intergenic
1201973492 Y:19820270-19820292 CAGACAGAGAATCCCTGGCTTGG + Intergenic