ID: 1125734223

View in Genome Browser
Species Human (GRCh38)
Location 15:41912299-41912321
Sequence ACATGCAGAGGCAGCGTAAC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 98
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 88}

Found 3 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734223_1125734226 1 Left 1125734223 15:41912299-41912321 CCTGTTACGCTGCCTCTGCATGT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1125734226 15:41912323-41912345 CACCCGCGTCCTGCCCTTCCTGG 0: 1
1: 1
2: 0
3: 27
4: 242
1125734223_1125734233 24 Left 1125734223 15:41912299-41912321 CCTGTTACGCTGCCTCTGCATGT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1125734233 15:41912346-41912368 TGCGCCCTAAACAATAACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1125734223_1125734234 25 Left 1125734223 15:41912299-41912321 CCTGTTACGCTGCCTCTGCATGT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734223 Original CRISPR ACATGCAGAGGCAGCGTAAC AGG (reversed) Intronic
901142191 1:7042414-7042436 ACAGGGAGAGGCAGGGAAACTGG - Intronic
903190885 1:21655392-21655414 ACACACAGAGGCAGTGTGACAGG + Intronic
905431657 1:37928917-37928939 ACATCCAGAGGCAGCCCAAAGGG + Intronic
915097801 1:153475960-153475982 CAAGGCTGAGGCAGCGTAACAGG + Intergenic
915445140 1:155970290-155970312 ACTTGCAGAGGCAGGGGCACTGG - Intronic
918086961 1:181253810-181253832 ACATGCAAATGCAGTGTGACTGG + Intergenic
919207683 1:194437808-194437830 AGTGGCAGAGGCAGCATAACTGG - Intergenic
923607140 1:235454231-235454253 ACATGCAAAGGCAGGGTAAGCGG + Exonic
1071858516 10:89649403-89649425 TCATGCAGAGCCAGCTGAACAGG + Intergenic
1072961609 10:99934329-99934351 AGATGGAGAGACAGTGTAACTGG + Intronic
1072964717 10:99962027-99962049 AGATGGAGAGACAGTGTAACTGG - Intronic
1076127786 10:127989443-127989465 ACATGCAGAGGCAGCAGTCCAGG + Intronic
1078223688 11:9373059-9373081 ATATGCAGAGCCAGCACAACAGG - Intergenic
1078409980 11:11106591-11106613 ACATGTAGAGCCAGCTAAACAGG - Intergenic
1080635906 11:34122856-34122878 ACATGCAGAGGCAAAGAAATGGG + Intronic
1080684935 11:34507412-34507434 ACATGCAAAGCCAGCGAAGCTGG + Intronic
1088817209 11:113429632-113429654 ACAAGCAGGGGCAGCCTAGCTGG + Intronic
1089985082 11:122804979-122805001 ACATGCAGGGGCACCGGGACAGG + Intronic
1090621990 11:128568421-128568443 GCTTGCAGAGGCAGCATAACAGG + Intronic
1092651736 12:10642123-10642145 ACAAGGAGAGGTAGCATAACTGG - Intronic
1103958083 12:124590275-124590297 ACATGGAGATGCTGCGTAACGGG - Intergenic
1105013634 12:132772770-132772792 ACAGGGAGAGGCTGCGTAACTGG - Exonic
1110790648 13:79583044-79583066 AGATGCAGAGGCATCATTACAGG - Intergenic
1112798737 13:103087179-103087201 ACATGCAGAAGCTGCTTAGCTGG - Intergenic
1119765483 14:77185017-77185039 ACATGCAGAGGCAGAGTGGGCGG + Intronic
1125734223 15:41912299-41912321 ACATGCAGAGGCAGCGTAACAGG - Intronic
1131665418 15:94566446-94566468 TCATGCAGAGTCAGCTGAACAGG + Intergenic
1131695701 15:94875768-94875790 ACAGGAAGAGGCAGCGGAGCAGG - Intergenic
1136924414 16:34358658-34358680 TCATGCAGAGGCAGCTGTACGGG - Intergenic
1136980159 16:35053148-35053170 TCATGCAGAGGCAGCTGTACGGG + Intergenic
1138599049 16:58044465-58044487 ACATACAGAAGCTGTGTAACTGG - Intronic
1140629054 16:76829993-76830015 ATATGCAGAAGCAGCATAGCTGG - Intergenic
1142535753 17:616786-616808 ACAAGCTGAGGCAGCTGAACAGG - Intronic
1147266403 17:39237361-39237383 ACAGGCAGACACAGCGTCACAGG - Intergenic
1150156543 17:62858452-62858474 AGATGCAGAGGAAGGTTAACAGG + Intergenic
1151948545 17:77332917-77332939 ACAAGAAGAACCAGCGTAACAGG - Intronic
1152651132 17:81493608-81493630 AGATGCAGAGCCAGCCTACCTGG - Intergenic
1153642249 18:7167205-7167227 ACATGCAGGGGCTGCAGAACTGG - Intergenic
1158319445 18:56247275-56247297 ACATACAGAGGCAAAGCAACTGG + Intergenic
1168011672 19:53538258-53538280 AGATGCAGCGGCTGCGTCACTGG - Intronic
927083653 2:19654079-19654101 ACAGGCTGAGGCAGCGTGGCTGG + Intergenic
932125865 2:69145182-69145204 ACAGCCAGAGGCAGAGTTACGGG + Intronic
936384940 2:112020800-112020822 ACATGGAGACGCAGCATAGCAGG - Intronic
938139196 2:128782616-128782638 ACATGCAGTGGGAGGGTGACGGG + Intergenic
940725243 2:157329430-157329452 ACATATAGAGGCAGCTTCACTGG - Intergenic
948570446 2:238914144-238914166 ACATGCAGAGGAAGAGTACGGGG + Intergenic
1171132819 20:22669860-22669882 CCAAGCAGAGGCAGCGTGAGAGG + Intergenic
1176415474 21:6472106-6472128 CCATGGACAGGCAGCGTCACTGG + Intergenic
1179690974 21:43080439-43080461 CCATGGACAGGCAGCGTCACTGG + Intergenic
1184876233 22:47277427-47277449 ACATGGAGAGACAGTGTAACCGG - Intergenic
949458450 3:4264216-4264238 AGATGCTGACTCAGCGTAACTGG - Intronic
950744639 3:15077390-15077412 ACATGCAGAGCCAGCTTCACAGG + Intronic
956778514 3:72586517-72586539 AGATCCAGAGGCTGCGTGACAGG + Intergenic
957242946 3:77682313-77682335 TCATGCAGAGCCAGCTGAACAGG - Intergenic
958448902 3:94249145-94249167 ACAGGCAGAGGCTGGGCAACTGG - Intergenic
963612053 3:147482023-147482045 ACATGCATAGACAGCCAAACAGG + Intronic
971389449 4:26172349-26172371 ACATTCAGAGGCAGAGGAAGGGG + Intronic
974157827 4:58097019-58097041 ACTGGCAGAGGAAGCCTAACTGG + Intergenic
974283939 4:59839077-59839099 TGATGCAGCGGCAGCTTAACTGG - Intergenic
978339766 4:107709871-107709893 TCATGCAGAGCCAGCTGAACAGG - Intronic
983501739 4:168507251-168507273 TGATGCAGAGGCAGGGTTACAGG - Intronic
986871574 5:12053477-12053499 ACATGCAGAGGCCAGGGAACTGG + Intergenic
1000527892 5:162381063-162381085 ACATGCAGAAGCTGAGTATCCGG - Intergenic
1002942807 6:1733087-1733109 CCATCCAGAGGCAGGGTGACAGG - Intronic
1003556424 6:7143338-7143360 GCATGGAGAGGCAGTGTCACAGG + Intronic
1004144366 6:13051240-13051262 ACATGCAGAGGTAGGGTGAAGGG - Intronic
1004363919 6:14996237-14996259 ACCTGCAGAGGCAGCGCAAGGGG + Intergenic
1008909506 6:56717888-56717910 ACATGTAGAGCCAGCAAAACAGG - Intronic
1013122434 6:107152394-107152416 TCATGCAGAGGCAGCTTGGCAGG + Intergenic
1017338699 6:153293323-153293345 ATATGCAGAGTCATCGTAAGTGG + Intergenic
1018474848 6:164130197-164130219 AGATGCAGTGGCACCTTAACTGG + Intergenic
1018834427 6:167472393-167472415 ACATGCAGATGAAGCTTCACTGG + Intergenic
1023890820 7:44390808-44390830 ACAGGCAAATGCAGCATAACTGG + Intronic
1024023282 7:45390257-45390279 CCATGCAGAGGAACCATAACCGG - Intergenic
1024616634 7:51120234-51120256 ACATGGAGAGGGAGGGTAAATGG + Intronic
1026241239 7:68577235-68577257 ACATGCAGAGGAAGCGAAAAAGG + Intergenic
1030463445 7:109869772-109869794 ACATGCAGAGGAAATCTAACTGG + Intergenic
1034308116 7:150062885-150062907 CCATCCAGAGGAAGCTTAACAGG + Intergenic
1035727294 8:1832484-1832506 ACAGGCAGAGGCAGAGACACAGG + Intronic
1036194114 8:6699226-6699248 TCATGCAGAGCCAGCGGAATGGG - Intergenic
1043263294 8:78228684-78228706 ATATGCAAAGGCAGTGAAACAGG - Intergenic
1044106743 8:88217631-88217653 GCATGCAGAGGCAGGGGAATTGG - Intronic
1045033494 8:98159724-98159746 ACATTCAGAGGCATGGTAAGAGG - Exonic
1048461690 8:134626525-134626547 AGAAGAAGAGGCAGCGTCACTGG + Intronic
1049453172 8:142673552-142673574 TCATGCAGAGCCAGCTGAACGGG + Intronic
1051292831 9:15562679-15562701 ATATGCAGAGGTAGCACAACAGG - Intronic
1052173387 9:25428100-25428122 AGCTGCAGAGGCAGCATAGCTGG - Intergenic
1052173391 9:25428133-25428155 AGCTGCAGAGGCAGCATAGCTGG - Intergenic
1053147305 9:35720277-35720299 ACCTGCAAAGGTAGTGTAACCGG - Intronic
1054856626 9:69907145-69907167 ACATGAAGAGGAAGCGAAAGAGG - Intergenic
1056465299 9:86848040-86848062 ACATGCAATGGCAGCCTCACCGG - Intergenic
1057606846 9:96504714-96504736 ACACCCAGAGGCAACGGAACAGG + Intronic
1058424348 9:104863538-104863560 ACATGCAGAGATAAAGTAACAGG + Intronic
1060883936 9:127137412-127137434 ACATGGAGAGGCTGAGTGACTGG + Intronic
1190752991 X:53378760-53378782 TCATGCAGAGGCAGCAAAGCCGG - Exonic
1195325963 X:103758705-103758727 ACATGCAGAGCCAGCTAAACAGG - Intergenic
1197244113 X:124150686-124150708 ACATGTAGAGTCAGCTAAACAGG + Intronic
1199890607 X:152075550-152075572 ACATGCAGAGATAGTGCAACTGG + Intergenic