ID: 1125734224

View in Genome Browser
Species Human (GRCh38)
Location 15:41912311-41912333
Sequence GGACGCGGGTGGACATGCAG AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 141
Summary {0: 1, 1: 0, 2: 0, 3: 15, 4: 125}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734224_1125734233 12 Left 1125734224 15:41912311-41912333 CCTCTGCATGTCCACCCGCGTCC 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1125734233 15:41912346-41912368 TGCGCCCTAAACAATAACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1125734224_1125734234 13 Left 1125734224 15:41912311-41912333 CCTCTGCATGTCCACCCGCGTCC 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734224 Original CRISPR GGACGCGGGTGGACATGCAG AGG (reversed) Intronic
900694475 1:4001287-4001309 GGACGGGGGTGGGAATGCAGGGG + Intergenic
901052608 1:6432801-6432823 GGCTGCGGGTGGACATGGACGGG - Intronic
901672375 1:10863387-10863409 GGACCCGGGTGGACAGTGAGGGG - Intergenic
902464581 1:16608099-16608121 GGATGCAGGTGGACAGGGAGGGG + Intronic
902481638 1:16715245-16715267 GGCTGCGGGTGGACATGGACGGG + Intergenic
903156226 1:21445606-21445628 GGATGCAGGTGGACAGGGAGGGG - Intronic
904207195 1:28863015-28863037 GGACGCTGGTGGACATCGACCGG + Exonic
905278581 1:36834751-36834773 GCACCCTTGTGGACATGCAGGGG - Intronic
913600874 1:120420508-120420530 GGATGCGGGTGGACAGGGAGGGG - Intergenic
913993339 1:143635100-143635122 GGATGCGGGTGGACAGGGAGGGG + Intergenic
914086181 1:144456125-144456147 GGATGCGGGTGGACAGGGAGGGG + Intronic
914192075 1:145420076-145420098 GGATGCGGGTGGACAGGGAGGGG + Intergenic
914362010 1:146943950-146943972 GGATGCGGGTGGACAGGGAGGGG - Intronic
914489615 1:148143005-148143027 GGATGCGGGTGGACAGGGAGGGG + Intronic
914589982 1:149098026-149098048 GGATGCAGGTGGACAGGGAGGGG + Intronic
915934802 1:160084179-160084201 CCACGCTGGTGGACCTGCAGTGG + Exonic
921890978 1:220353313-220353335 AGAAGTGGGTGGACATGGAGAGG + Intergenic
922749457 1:228063767-228063789 GGAGGCGGCTGGGCAGGCAGAGG + Intergenic
923048113 1:230370121-230370143 GGACGGGGATGGAGCTGCAGGGG + Intronic
1062989237 10:1800083-1800105 GAAAGCGGGAGGACCTGCAGGGG + Intergenic
1064288694 10:14014069-14014091 GGAGGTGGGTGGGGATGCAGGGG + Intronic
1065020273 10:21496750-21496772 CGACGCGGGTGGCGCTGCAGAGG - Exonic
1067190764 10:44065984-44066006 GGACACAGGAGGACATGCAGTGG - Intergenic
1067479842 10:46587536-46587558 TGCCGCGGGTGTACATGTAGGGG - Exonic
1067614895 10:47754261-47754283 TGCCGCGGGTGTACATGTAGGGG + Intergenic
1071350367 10:84734628-84734650 GGATGCTTATGGACATGCAGTGG - Intergenic
1072808894 10:98444842-98444864 AGAGGCGGGTGGACCTGAAGAGG + Intronic
1073826752 10:107332749-107332771 GGATGCTGGTGAAGATGCAGAGG - Intergenic
1082777825 11:57261094-57261116 TGACCTGGGTGGAGATGCAGAGG + Intergenic
1083609842 11:63999533-63999555 ACACGCCGGTGGAGATGCAGGGG + Exonic
1087268083 11:96082820-96082842 AGACGTGGATGGTCATGCAGTGG + Intronic
1089329956 11:117682265-117682287 GGACAGGGCTGGACAGGCAGCGG - Intronic
1096203813 12:49705697-49705719 GGAGGCTGGGGGAAATGCAGAGG + Intronic
1096534506 12:52262613-52262635 GGAGGTGGGTGGGCAGGCAGAGG + Intronic
1103948668 12:124540520-124540542 GGATGGGGGTGGAGATGGAGGGG + Intronic
1103949098 12:124541764-124541786 GGATGGGGGTGGATATGGAGGGG + Intronic
1103949108 12:124541786-124541808 GGATGGGGGTGGATATGGAGGGG + Intronic
1104388358 12:128370558-128370580 GGACGGAGGTAGAGATGCAGAGG + Intronic
1104799028 12:131540851-131540873 GGACACAGGGGGAGATGCAGGGG - Intergenic
1105498735 13:20953158-20953180 GGACGCAGCTGGGCCTGCAGTGG + Intergenic
1106407608 13:29487593-29487615 GCAAGCGCGTGGACAAGCAGTGG + Intronic
1106880074 13:34119665-34119687 AGACGATGGTGGACATGGAGTGG - Intergenic
1113957827 13:114108556-114108578 GGACGCGGGGTGACAGACAGGGG - Intronic
1114866150 14:26597780-26597802 GGACCGGGGAGGACAGGCAGAGG + Intergenic
1121211422 14:92210518-92210540 GGTGGGGGGTGGACATGGAGAGG + Intergenic
1121850790 14:97219532-97219554 GGACGCGGGTGGGGACGCGGCGG + Intergenic
1125734224 15:41912311-41912333 GGACGCGGGTGGACATGCAGAGG - Intronic
1126345549 15:47690015-47690037 GGAGGCGGATGGCCATGGAGGGG - Intronic
1130164242 15:81436541-81436563 GGAAGAGGGTGAACAAGCAGGGG + Intergenic
1132386489 15:101404367-101404389 GGGGTCGGGTGGACATGAAGTGG + Intronic
1132667587 16:1089256-1089278 GGTCCCGGCTGGCCATGCAGAGG - Intergenic
1133256318 16:4518551-4518573 GGACGCATGTGGATATGGAGGGG - Intronic
1136362525 16:29790239-29790261 GGACGCGAGGGGACCTACAGTGG + Intergenic
1137354706 16:47749700-47749722 GGAAGGGGGTGGAGGTGCAGGGG + Intergenic
1141479090 16:84294547-84294569 GCTCGGGGCTGGACATGCAGGGG - Intergenic
1142325027 16:89409216-89409238 GGAGGCGGGTGGAATTGCTGAGG - Intronic
1142711305 17:1725264-1725286 GGACGCGCGTGGAGGTGCATGGG + Exonic
1147561610 17:41512851-41512873 GGACTCTGGTGGAGATGCTGGGG + Intergenic
1148707279 17:49646556-49646578 GGATGGGGGTGGAAATGCACAGG - Intronic
1151316211 17:73324186-73324208 GGACGAGGCTGGACAAGCATAGG + Intergenic
1152269202 17:79313854-79313876 GGAGGTGGGAGGACAAGCAGGGG - Intronic
1160348079 18:78151435-78151457 GGATGTGGGTAGACAAGCAGGGG + Intergenic
1161805430 19:6440668-6440690 GGGAGGGGGTGGCCATGCAGAGG + Exonic
1162105409 19:8366972-8366994 GGACACACGTGGACATGCTGTGG - Intronic
1162480021 19:10922452-10922474 GGGCGGGGGGGGACCTGCAGGGG - Exonic
1162779857 19:13001304-13001326 GGACGCTGGGAGACATGGAGAGG - Intronic
1162866394 19:13551106-13551128 GCACCCTGATGGACATGCAGAGG - Intronic
1166099049 19:40560200-40560222 GTATGCGGGTGAACATGCCGAGG + Exonic
1202715677 1_KI270714v1_random:41157-41179 GGCTGCGGGTGGACATGGACGGG + Intergenic
926646239 2:15292587-15292609 GGAAGGGTGTGGACGTGCAGCGG - Exonic
927737343 2:25535297-25535319 AGACGGGGGTGGCCAGGCAGAGG + Intronic
927737466 2:25535758-25535780 AGACGGGGGTGGCCAGGCAGAGG + Intronic
929652320 2:43692995-43693017 GGTTGTGGGTGGACTTGCAGAGG - Intronic
937207733 2:120247168-120247190 GGACACGAGAGGACATGCAGTGG + Intronic
937364810 2:121253870-121253892 GCACGGGGGTAGGCATGCAGAGG - Intronic
941645324 2:168034153-168034175 GGCCGCTTGAGGACATGCAGGGG - Intronic
943821405 2:192327225-192327247 GGGGGCAGGTGCACATGCAGTGG + Intergenic
944912319 2:204322736-204322758 AGTCTCGGGTGGACATGCAGCGG + Intergenic
946309191 2:218873342-218873364 GGACGCATGTGGACAGGTAGGGG - Intronic
947229585 2:227871604-227871626 GGACGCGGGTGCGCATGCGCAGG - Exonic
948233677 2:236370762-236370784 GGAGCAGGGTGGCCATGCAGGGG + Intronic
1170578722 20:17682376-17682398 GGACGCGGGTGGCCGAGCCGCGG + Intergenic
1173961277 20:47074262-47074284 GGACGTAGGTGGACGTGGAGAGG - Exonic
1174115799 20:48225630-48225652 GGAAGCGTGTGGACATGCACTGG - Intergenic
1174910227 20:54600208-54600230 TGACACAGGTGGAGATGCAGCGG + Intronic
1182754499 22:32667870-32667892 GAACCCGGGCGGACTTGCAGTGG - Intronic
1183326889 22:37199237-37199259 GGAAGCGGGTGGAGAGGGAGGGG - Intronic
1183667550 22:39254302-39254324 GGACGTGGGTGAGGATGCAGGGG - Intergenic
1184112662 22:42404340-42404362 GGACCCGGGAGCACCTGCAGTGG - Intronic
1185218999 22:49619549-49619571 GGAAGCGGGTGCAGATGCAGGGG - Intronic
952416807 3:33097077-33097099 GGAGGCTGGTGGTCATGCCGGGG - Exonic
952746458 3:36786445-36786467 GGACGGGTGTGGACTGGCAGGGG + Intergenic
958803830 3:98785786-98785808 GGACAAGGGTGGAAATGAAGAGG + Intronic
959866463 3:111276198-111276220 GGACCCTGGTGGATATCCAGGGG - Intergenic
960373025 3:116864197-116864219 GCACGCAGCTGGACCTGCAGGGG - Intronic
960994624 3:123332671-123332693 GGATGCTGGGGGACAGGCAGAGG + Exonic
969347800 4:6580261-6580283 GGATGCAGGGGGACAAGCAGGGG - Intronic
972484270 4:39527358-39527380 GGGCGCGGGTGGAGAAGCTGCGG - Exonic
985885067 5:2671146-2671168 GGCCCAGGGTGGAGATGCAGAGG + Intergenic
986299626 5:6467757-6467779 GGGCGCGGGTGGAGAGGCTGGGG - Intronic
988560280 5:32274670-32274692 GAACGAGGGTGGTCATGCTGTGG - Intronic
999692150 5:154157579-154157601 GGAGGCAGCTGGCCATGCAGGGG + Intronic
1002193999 5:177492503-177492525 GTATGCGGGTGGACATGGATGGG - Intronic
1002295340 5:178227611-178227633 GGAAGTGGGGAGACATGCAGGGG + Intronic
1002368366 5:178730363-178730385 GGACGCGGGTGCACCAGCAACGG + Intronic
1004274910 6:14227465-14227487 GGAAGCCGGTGTGCATGCAGTGG - Intergenic
1004368845 6:15034931-15034953 GGACGGGGGTGGAGAGGTAGGGG - Intergenic
1007340894 6:41191037-41191059 GGACCCTGGTGGACAGCCAGAGG - Exonic
1007742821 6:44023175-44023197 GGACGCAGGTGGGCATCCAGTGG - Intergenic
1007967328 6:46015237-46015259 GGACGGGGGTGGACAAACTGCGG + Intronic
1018718534 6:166554598-166554620 GCACGCGGGTGGCCATGGGGGGG + Intronic
1018774279 6:166999142-166999164 GGGCGCGGGTGGGCACGCAAGGG - Intergenic
1018907982 6:168086255-168086277 GGACGCGGGTGTCCATGCTGGGG - Intergenic
1019190932 6:170250247-170250269 GCAGGAGGGTGGACATGCGGGGG - Intergenic
1019310300 7:357199-357221 GGAAGCCGGTGGGGATGCAGTGG + Intergenic
1022936749 7:35186256-35186278 GCACGTGGGGGGACACGCAGGGG - Intergenic
1024816252 7:53275334-53275356 GGACCTGGATGGAGATGCAGGGG + Intergenic
1030884624 7:114922485-114922507 GGAGGCGGGAGGACGCGCAGGGG + Exonic
1034529652 7:151687896-151687918 GGAGGAGGGTGGACACGGAGAGG - Intronic
1036682570 8:10886215-10886237 GGAAGCAGGTGCTCATGCAGCGG - Intergenic
1036694905 8:10968017-10968039 GGCCACCTGTGGACATGCAGAGG + Intronic
1037986135 8:23291772-23291794 GCAGGCGTGTGGCCATGCAGGGG - Intronic
1038185534 8:25270874-25270896 GTACACGGGAGGAAATGCAGAGG - Intronic
1039955308 8:42202750-42202772 GGACGGGGGTGGGCTTGGAGTGG + Intronic
1040873427 8:52124741-52124763 GGAGGGGAGTGTACATGCAGAGG - Intronic
1043442235 8:80286422-80286444 GGACGCAGGAGGAGAGGCAGAGG - Intergenic
1043514190 8:80981120-80981142 GGCCGGGGGTGGACATGGAGAGG - Intronic
1057555660 9:96085686-96085708 GGACGCAGCTGGACGTGGAGGGG - Intergenic
1059760110 9:117329610-117329632 AAAGGGGGGTGGACATGCAGTGG + Intronic
1061576942 9:131513302-131513324 GGGAGCGGGTGGTCATGCCGTGG - Exonic
1203444645 Un_GL000219v1:44249-44271 GGAGGCGGGTGGACAGTCGGGGG + Intergenic
1186408806 X:9327576-9327598 GGACACATGGGGACATGCAGGGG + Intergenic
1187189571 X:17020861-17020883 GGAGGCGGGTGGACCTCCTGAGG - Intronic
1190115922 X:47626405-47626427 TCACGCGGGAGGACCTGCAGGGG - Exonic
1193239029 X:79144160-79144182 GGAAGTGGGTGGACAGGAAGTGG + Intergenic
1199594214 X:149493890-149493912 GGAAGCTGGTGGACAGCCAGAGG - Intronic
1200181267 X:154151963-154151985 AGACGTGGGCGGAGATGCAGGGG - Intronic
1200186913 X:154189077-154189099 AGACGTGGGCGGAGATGCAGGGG - Intergenic
1200192563 X:154226215-154226237 AGACGTGGGCGGAGATGCAGGGG - Intronic
1200198318 X:154264019-154264041 AGACGTGGGCGGAGATGCAGGGG - Intronic
1201337665 Y:12897700-12897722 GGACTGGGGAGGACATGCACAGG + Intergenic