ID: 1125734225

View in Genome Browser
Species Human (GRCh38)
Location 15:41912322-41912344
Sequence CAGGAAGGGCAGGACGCGGG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 520
Summary {0: 1, 1: 0, 2: 2, 3: 37, 4: 480}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734225_1125734234 2 Left 1125734225 15:41912322-41912344 CCACCCGCGTCCTGCCCTTCCTG 0: 1
1: 0
2: 2
3: 37
4: 480
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734225_1125734233 1 Left 1125734225 15:41912322-41912344 CCACCCGCGTCCTGCCCTTCCTG 0: 1
1: 0
2: 2
3: 37
4: 480
Right 1125734233 15:41912346-41912368 TGCGCCCTAAACAATAACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734225 Original CRISPR CAGGAAGGGCAGGACGCGGG TGG (reversed) Intronic
900418518 1:2545858-2545880 CAGGAAGTGCAGGAGGAGGGTGG + Intergenic
901068144 1:6504354-6504376 CAGGGAGGGCAGGACATGAGAGG - Intronic
901216510 1:7558310-7558332 CAGGCATGGCAGGAAGAGGGGGG + Intronic
901800046 1:11703335-11703357 AAGGATGGGCAGGACGTGGACGG + Intronic
901876291 1:12168678-12168700 CAGGAAGGGAAGGAAGTGGGAGG - Intronic
901879916 1:12187789-12187811 CAGGCAGGGCAGGTCAGGGGAGG + Intronic
902227789 1:15007629-15007651 CAGGAAGGGAAGGAAGGGGAGGG - Intronic
902332751 1:15738527-15738549 CCGGGAGGGCACGACGTGGGTGG + Intronic
902490849 1:16779403-16779425 GAGGAAGGGGAGGAGGAGGGGGG + Intronic
902542942 1:17167207-17167229 CAGGAAGGGAGGGAGGGGGGAGG - Intergenic
903518478 1:23929035-23929057 GAGGAAGAGCAGGAAGTGGGAGG - Intergenic
903652095 1:24928835-24928857 CAGGAAGGGCCGGCGGCTGGGGG - Intronic
903797737 1:25942646-25942668 CAGGAGGGAGAGGACGCTGGAGG + Intergenic
903875424 1:26470557-26470579 CAGAAAGGGGAAGAGGCGGGTGG - Exonic
904265762 1:29317848-29317870 GAGGAAGGGCAGGCAGCGGTCGG - Exonic
904400609 1:30254158-30254180 CAGGAAGGGCAAGATGAGGCCGG - Intergenic
904866956 1:33587020-33587042 AAGGAAGGGAAGGTGGCGGGGGG - Intronic
905399771 1:37692699-37692721 TAGGAAGGGCAGTAGTCGGGTGG + Exonic
907045102 1:51295931-51295953 CAGGGGGGGCAGTCCGCGGGTGG + Intronic
908255252 1:62297996-62298018 TAGGCAGGGCAGGAGGAGGGTGG + Intronic
908682573 1:66678715-66678737 CGGGAAGGGGAGGAGGAGGGAGG + Intronic
912496440 1:110094943-110094965 CAGGAGGGGCAGGACGAGGATGG + Intergenic
912651501 1:111443553-111443575 CAGAAAGGGCAGGAGGCTGCTGG - Intronic
913250652 1:116909993-116910015 GAGGGAGGGAAGGAGGCGGGAGG + Intergenic
914826693 1:151142589-151142611 CAGCAAGGGCATGAAGTGGGGGG + Exonic
915880036 1:159660088-159660110 CAGGAAGAGTAGGAGGCAGGAGG - Intergenic
915912709 1:159924526-159924548 CAGGAGGCACAGGGCGCGGGGGG + Intronic
916877293 1:168982993-168983015 CAGAAAGGGCAGGACTCATGAGG + Intergenic
917501061 1:175585748-175585770 AAGGAAGGGAAGGAAGTGGGAGG - Intronic
919464249 1:197911622-197911644 CAGGAAGGCGGGGACGCGGTGGG + Intergenic
919925165 1:202188415-202188437 CAGGAAGGGCAGCAGGGTGGTGG - Intergenic
920086442 1:203421225-203421247 AAGGAAGGGCAGGGAGGGGGAGG + Intergenic
920693176 1:208162208-208162230 CAGGAAGGGCAGAAGGCTGAGGG + Intronic
922937639 1:229433984-229434006 CAGGTAGGGCAGGAGTTGGGAGG - Exonic
923529595 1:234803132-234803154 GAGGAAGGGGAGGAGGAGGGGGG - Intergenic
923737627 1:236626232-236626254 AAGGAAGGCCAGGACATGGGAGG - Intergenic
924812643 1:247416672-247416694 CAGGATGGGCAGGAGCTGGGAGG + Intronic
1062908812 10:1199216-1199238 CAGGAACAGCGGGAAGCGGGGGG - Intronic
1063088409 10:2839930-2839952 CAGGCTGGGCAGGAAGCTGGGGG - Intergenic
1063892480 10:10644752-10644774 AAGGAAGCCCAGGACGTGGGGGG - Intergenic
1063928882 10:11009190-11009212 AAGGAGGGACAGGACGTGGGAGG + Intronic
1066049039 10:31618485-31618507 AAGGCAGGGGAGGAAGCGGGAGG + Intergenic
1066076902 10:31887945-31887967 TAGGAAGGGCAGGCCGGGCGCGG - Intronic
1066615459 10:37289020-37289042 CAGGAAGTGCAAGAAGTGGGGGG - Intronic
1067060767 10:43076971-43076993 CAGGCGGGGCCGGAGGCGGGTGG - Intergenic
1069422822 10:68261728-68261750 AAGGTGGGGCAGGACGCCGGAGG + Intergenic
1069556580 10:69402344-69402366 GATGAAGGGCAGGATCCGGGTGG - Intergenic
1070279448 10:75038013-75038035 CAGGTAGGCCAGGACCAGGGTGG + Exonic
1070591617 10:77805909-77805931 CAGGAAGGGCAGGAAGGGCAGGG - Intronic
1070774464 10:79101691-79101713 CAGGGAGGGAGGGAGGCGGGTGG + Intronic
1071152628 10:82652619-82652641 CAGGTAGGGCAGGCCATGGGTGG + Intronic
1072574818 10:96689933-96689955 CAGGCAGGGCTGGAGGCTGGAGG - Intronic
1073558794 10:104479781-104479803 CGGGAAGGGGAGGGGGCGGGGGG + Intergenic
1074867618 10:117553982-117554004 GAGGAAGGGCGGGACGTGAGCGG - Intergenic
1075129445 10:119725914-119725936 AGGAAAGGGCAGGAAGCGGGAGG + Intergenic
1075483328 10:122800235-122800257 CAGGAAGGGCTGGGGGCAGGAGG + Intergenic
1075673500 10:124280413-124280435 CAGGAAGGGCAGGGCTGGGCTGG + Intergenic
1075993807 10:126860222-126860244 CAGAAAGTGCAGGACTCTGGTGG - Intergenic
1076371600 10:129959289-129959311 CGGGGAGGGCAGGGCGAGGGAGG + Intronic
1076379025 10:130012429-130012451 CAGGAAGTGCAGGAAGCCAGAGG + Intergenic
1076538297 10:131197039-131197061 GAGGAAGGGCAGGGTGAGGGGGG - Intronic
1076652775 10:132001370-132001392 CAGGAAGAGGAGCCCGCGGGAGG + Intergenic
1076886739 10:133266578-133266600 CAGAGAGGGCAGGACGGTGGCGG - Intronic
1077554769 11:3220685-3220707 AAGGCAGGGCGGGATGCGGGTGG - Intergenic
1077897366 11:6463591-6463613 CAGGGAGGCCAGGACGCAGCTGG + Intronic
1079969318 11:27017165-27017187 CAGGAAGGGCAGGCACAGGGTGG - Intergenic
1083271850 11:61576734-61576756 CAGGAGGGGCAGGAGGGGGAGGG + Intronic
1083479461 11:62934247-62934269 CAGGAAGGGCAGGGAGGGGTTGG + Intergenic
1083945116 11:65919200-65919222 CGGGAGGGGCGGGCCGCGGGGGG + Intergenic
1084144036 11:67254452-67254474 CAGGGAGGGCTGGAGGCAGGGGG - Intronic
1084191412 11:67500612-67500634 CAGGAAAGGCAGTGGGCGGGGGG - Intronic
1084411738 11:69009755-69009777 CAGGAAGGGGGGGATGGGGGAGG + Intronic
1084450641 11:69234727-69234749 CACGAAGGGCAGGAGGAAGGGGG + Intergenic
1084517415 11:69644342-69644364 CAAGAAGGGCTGGAGGTGGGTGG - Intronic
1084726440 11:70945473-70945495 CAGGAAGGGCTGGAAGCCGTCGG - Intronic
1084890686 11:72235496-72235518 CAAGGAGGGCAGGGTGCGGGGGG + Intronic
1085308085 11:75499773-75499795 TAGGAAGGTCAGGACGTGGATGG - Intronic
1085544166 11:77301680-77301702 CTGGAAGGGCAGCCCGAGGGAGG + Intronic
1085640330 11:78189090-78189112 CAGGCCGGGCAGGACGAGGCTGG - Exonic
1088366320 11:109043893-109043915 CAGGAAAGGCAGGAGGTGGAAGG + Intergenic
1088772109 11:113045266-113045288 CAGGAAGGCCATGACGGTGGAGG - Intronic
1088891636 11:114049330-114049352 CAGGAAGGGCAGGTGGTGGGAGG - Intergenic
1089528490 11:119112091-119112113 CAGGAAGAGCAGGACCAGGGAGG + Intronic
1091026002 11:132141865-132141887 CAGGAGGGGAAGGCCGCAGGAGG + Intronic
1091754213 12:3041141-3041163 CGGGGAGGGCAGGAGGCGGCAGG + Intergenic
1092125980 12:6075300-6075322 CCGGCAGGGCAGGACGGGGCAGG + Intronic
1092141432 12:6186324-6186346 CAGAATGTGCAGGACGGGGGAGG + Intergenic
1092290504 12:7157295-7157317 CAGGAAGGGCAGGAGACGAAAGG - Intronic
1092487464 12:8914695-8914717 CAGGAAGGGGAGGAGGCGAGGGG + Exonic
1093435396 12:19129924-19129946 GCGGGAGGGCAGGAGGCGGGCGG + Intronic
1093844525 12:23952197-23952219 CAGGAAGAGGAGGAGGCGGGAGG + Intergenic
1094041064 12:26122414-26122436 CAGGAAGGGCTGCACGTAGGCGG + Exonic
1095909489 12:47411587-47411609 CTGGCAGGGGAGGACGGGGGAGG + Intergenic
1095930862 12:47624037-47624059 CAGGAAGTGCAAGAAGCAGGGGG + Intergenic
1096599862 12:52721649-52721671 CAGGAAGGGCTGGTGGTGGGTGG - Intergenic
1096652182 12:53067265-53067287 CAGGGAGGGCAGGCAGGGGGAGG + Intronic
1096867810 12:54575650-54575672 CAGGAAGGGGAGGACTGGGAGGG + Intronic
1096946708 12:55414946-55414968 CAGGAAGGGGAGGAGGCGAGGGG - Intergenic
1097279435 12:57835492-57835514 CAGGGAGGGCAGGACTCCAGCGG + Intronic
1099989584 12:89708630-89708652 AAGGAAAGGCAGGCTGCGGGAGG + Exonic
1100992530 12:100266783-100266805 CTGGTAGGGCAGGAAGGGGGCGG + Intronic
1101962169 12:109258602-109258624 GAGGCAGGGCAGGAGGTGGGAGG - Intronic
1102230269 12:111257318-111257340 GAGGAAGGGGAGGAAGAGGGAGG - Intronic
1102579786 12:113879084-113879106 CAGGAGGGGCAGAACGCTGGCGG - Intronic
1102933389 12:116879019-116879041 CTGGAAGGGGAGGCTGCGGGCGG - Intronic
1103195784 12:119042670-119042692 AAAGAAGGGCAGGAAGAGGGAGG + Intronic
1103339858 12:120215561-120215583 CCCGGAGGGCAGGACGAGGGAGG - Intronic
1103351628 12:120287667-120287689 CAGGGAGGGGAAGAAGCGGGAGG - Intergenic
1103582107 12:121923124-121923146 CAGGAAGGGGAGGAGAGGGGAGG - Intronic
1104739910 12:131164741-131164763 GAGGAGGCGCAGGACGAGGGGGG - Intergenic
1104746212 12:131211974-131211996 CAGGAAGGGCAGGGCATGGATGG + Intergenic
1104792569 12:131493224-131493246 GAGGAGGCGCAGGACGAGGGGGG + Intergenic
1105426974 13:20302340-20302362 CAGGACAGGAAGGACCCGGGAGG + Intergenic
1106229669 13:27812156-27812178 CACGTAGGGCATGACGAGGGTGG + Intergenic
1106406304 13:29477563-29477585 GAGGAAGGGGAGGACCCTGGGGG + Intronic
1107733400 13:43370905-43370927 GAGGAAGGGCAGGAGGGGGTGGG - Intronic
1108274017 13:48789760-48789782 CAGGGAGGGCAGGAAGAAGGAGG + Intergenic
1112566186 13:100552965-100552987 CAGGCAGGCCAGGTGGCGGGTGG + Intronic
1113473313 13:110561833-110561855 CAGCAGGGGCGGGACGGGGGCGG - Intergenic
1113938590 13:114007271-114007293 CCGGCAGGGCAGGAGGGGGGCGG - Intronic
1114524502 14:23359544-23359566 CAGGCAGGGCAGGCAGAGGGCGG + Exonic
1114567450 14:23643217-23643239 CAGGTATGGCAGGGCGGGGGTGG + Exonic
1114646604 14:24259622-24259644 CAGAAAGGGCAGGAGGAGGGTGG + Intronic
1115167462 14:30464876-30464898 AAGGAGGGGCAGGAGGCAGGAGG + Intergenic
1115190027 14:30738089-30738111 GAGGAAGGGAAGGGGGCGGGAGG + Intergenic
1115963605 14:38863205-38863227 CAGGAAGGGCAGGATGGGTCAGG + Intergenic
1116808810 14:49519884-49519906 CAGGAAGGCCAGAAGGAGGGAGG + Intergenic
1117771024 14:59134773-59134795 TAGGAAGGGCAGGAGGCTGCTGG + Intergenic
1118244115 14:64091811-64091833 CAGGAAAGGCAGCATGCAGGAGG - Intronic
1119738806 14:77000573-77000595 CAGGAAGGGAGGGAGGCGGCAGG - Intergenic
1120882725 14:89426886-89426908 CATGAAGGACAGGACCCGTGGGG + Intronic
1121017959 14:90559921-90559943 CAGGAAGGGTAGCACGGTGGGGG - Intronic
1121100440 14:91246428-91246450 CTGGCAGGGCTGGAGGCGGGAGG - Intronic
1121739096 14:96238870-96238892 CAGGCAGGGCAGGGGCCGGGTGG + Intronic
1122832194 14:104403909-104403931 CAGGAAGGGCAGGACAGGTGGGG + Intergenic
1122862491 14:104588788-104588810 CAGGACGGGCAGGACGGGCAGGG + Exonic
1122900744 14:104781409-104781431 CAGGGAGGGCTGGACGCGTCTGG - Intronic
1123036763 14:105474786-105474808 CAGGCGGGGCTGGGCGCGGGCGG + Intronic
1123857251 15:24426578-24426600 CAGGAAGGGCAGACCACGGAGGG + Intergenic
1123861880 15:24477106-24477128 CAGGAAGGGCAGACCACGGAGGG + Intergenic
1123871734 15:24581715-24581737 CAGGAAGGGCAGATCACGGAGGG + Intergenic
1124025201 15:25959471-25959493 CAGGCAGGGCAGGATGCTTGGGG - Intergenic
1124533078 15:30523066-30523088 CAGGAAGGGCAGGAGGCAGCAGG - Intergenic
1124765578 15:32484578-32484600 CAGGAAGGGCAGGAGGCAGCAGG + Intergenic
1125734225 15:41912322-41912344 CAGGAAGGGCAGGACGCGGGTGG - Intronic
1126487833 15:49202324-49202346 CAGGAAGGGCAGGTAGGGAGAGG - Intronic
1126583090 15:50258868-50258890 AAGGAAGGGCAGGCCGGGTGCGG + Intronic
1126806956 15:52360619-52360641 CAGGATGGACAGTACACGGGAGG + Intronic
1128315058 15:66654967-66654989 CGGGAGGGGCGGGCCGCGGGAGG - Intronic
1128708520 15:69855063-69855085 CAGGCAGGTCAGGAAGCCGGTGG - Intergenic
1129232253 15:74203315-74203337 CAGGAGGAGCAGGAGGCAGGCGG - Intronic
1130393394 15:83479539-83479561 CAGCAAAGGCAGGAAGCTGGGGG + Intronic
1131073009 15:89477645-89477667 CAGGAATGGCTGGAGACGGGAGG + Exonic
1131435423 15:92417989-92418011 GGTGAAGGGCAGGACGCAGGGGG + Intronic
1132144968 15:99424326-99424348 GAGGAAGGGCAGGGCAGGGGTGG + Intergenic
1132513822 16:356886-356908 CAGGCAGGGGAGGCCGCTGGAGG + Intergenic
1132555834 16:572279-572301 CAGAGAGGGCAGGCGGCGGGTGG - Intronic
1132658826 16:1052660-1052682 CAGGGAGGGCAGGGCAGGGGAGG + Intergenic
1132725572 16:1336907-1336929 CAGCAAGGCCAGGACCCCGGGGG + Intronic
1132868241 16:2104253-2104275 AAGGACGGGGAGGACGGGGGGGG + Intronic
1133047377 16:3096310-3096332 CAGGAAGGGCAGAAAGCAGAGGG - Intronic
1133171902 16:3986977-3986999 CAGGAGTGGCAGGACGTGGCAGG - Intronic
1133985368 16:10664267-10664289 CAGGGAGGGAAGGAAGAGGGAGG + Intronic
1134042847 16:11081396-11081418 CAAGAAGGGCAGGATGTGGCTGG - Intronic
1134623196 16:15705388-15705410 CAGGAAGGGCTGGTCACGTGAGG + Intronic
1134788191 16:16963903-16963925 CAGTAAAGGCAGGTCGCTGGGGG + Intergenic
1136394820 16:29987157-29987179 CAGGAGGGGCAGGAGGCCAGAGG - Exonic
1136544853 16:30949168-30949190 CAGGACGAGCAGGATGCAGGCGG - Exonic
1136627766 16:31472357-31472379 CAGGAAAGGCAGGAAGGGAGAGG - Intronic
1137299407 16:47133285-47133307 CATGGAGGGCAGGGCGCTGGTGG + Intronic
1137668901 16:50267847-50267869 CAGGAAGTGCAGGAGGCTGAGGG + Intronic
1137763609 16:50960615-50960637 CGGGAAGGGCTGGAAGTGGGGGG + Intergenic
1138105228 16:54284413-54284435 CGGGAGGGGCAGGGCCCGGGGGG - Intronic
1139558584 16:67727940-67727962 AGGGAAGGGCAGGACTAGGGTGG + Intronic
1140035931 16:71371283-71371305 CAGGTAGGGCAGGGGGTGGGAGG + Intronic
1140041932 16:71413861-71413883 CAGGCAGTGCAGGAGGAGGGTGG + Intergenic
1140406828 16:74716852-74716874 CAGGATGGGCAGGATGGGTGGGG + Intronic
1140626924 16:76805032-76805054 CAGGTGGGGCAGGATGGGGGAGG + Intergenic
1140859840 16:79009101-79009123 CTGGAAGGGCAGGAGGCCTGCGG - Intronic
1141032793 16:80604168-80604190 CAGGAAGGGCAGGGAGGTGGGGG + Exonic
1141947461 16:87320415-87320437 CAAGAAGGTCAGGACACAGGCGG - Intronic
1142141460 16:88474529-88474551 CAGGGATGGGAGGAGGCGGGTGG - Intronic
1142253743 16:89003909-89003931 CAGGAAGGGCTGGAAGCAGACGG + Intergenic
1142297314 16:89233986-89234008 CAGGAAAGGCAGGACAGGGCAGG - Exonic
1142847860 17:2690829-2690851 CAGGAAAGCCGGGAGGCGGGTGG - Intronic
1142855883 17:2730019-2730041 CAGGATGGGAAGGACTGGGGAGG + Intergenic
1142883183 17:2896729-2896751 GAAAAAGGGCAGGAGGCGGGAGG - Intronic
1143500744 17:7337101-7337123 CAGGAAGGGTAGAAGGAGGGTGG - Intronic
1143953770 17:10653477-10653499 CAGAAAGGGCAGGAAAGGGGTGG - Intronic
1144851408 17:18245918-18245940 CAAGCAGGTCAGGAGGCGGGCGG - Exonic
1144968623 17:19093398-19093420 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1144979292 17:19158665-19158687 CAGGAAGAGGAGGAGGAGGGTGG - Exonic
1144988930 17:19219567-19219589 CAGGAAGAGGAGGAGGAGGGTGG + Intronic
1145736961 17:27239903-27239925 AAGGAAGGGCAGGGGGCGGGAGG - Intergenic
1146874124 17:36394456-36394478 CAGGAAGGTCAAGACGGGGAAGG - Intronic
1146881477 17:36445367-36445389 CAGGAAGGTCAAGACGGGGAAGG - Intergenic
1147065263 17:37918417-37918439 CAGGAAGGTCAAGACGGGGAAGG + Intergenic
1147996406 17:44362559-44362581 GAGGGAGAGCAGGACCCGGGAGG + Intronic
1148457676 17:47819796-47819818 CAGGAGTGACAGGACCCGGGAGG + Intronic
1148645944 17:49219764-49219786 CAGGAAGGGCAGGTGGCCGAGGG - Intronic
1149267926 17:54947967-54947989 CAGGAAGGGCAGGTTGAGAGTGG - Intronic
1149461836 17:56834706-56834728 CCGGAAAGGCAGGAAGGGGGCGG + Intronic
1149597351 17:57872250-57872272 CATGAAGGCCAGGGCGGGGGAGG - Intronic
1149993949 17:61397289-61397311 CTGGAGGGGGAGGGCGCGGGCGG - Intergenic
1150227308 17:63531038-63531060 CAGGCAGGGCAGGATGAGGCTGG + Intronic
1150610373 17:66728420-66728442 CAGGCAGAGCAGGAAGCGTGTGG + Intronic
1151247052 17:72803177-72803199 CAACAAGGGCAGGAGGCGAGGGG - Intronic
1151416900 17:73972511-73972533 AAGGAAGGGCAGGACAGGGGAGG + Intergenic
1151681177 17:75623749-75623771 CAGGAAGGGCAGGTGGGGTGAGG - Intergenic
1151715185 17:75827605-75827627 CAGGAAGGCCAGGAGGCAGATGG + Exonic
1151877749 17:76876925-76876947 CTGGAAGGGCAGGAAACAGGAGG - Intronic
1152289241 17:79429460-79429482 CAGGCTGGGCAGGAGGAGGGAGG + Intronic
1152356633 17:79810630-79810652 CGGGAAGGCCCGGATGCGGGAGG + Intergenic
1152630420 17:81408454-81408476 CAGGAGGGGCAGGGCACGGTGGG - Intronic
1152799051 17:82322662-82322684 CAGGAAGGGCAGGGCGGGTCTGG + Intronic
1152863798 17:82710493-82710515 CAGAAGGAGCAGGACGCTGGAGG + Intergenic
1152924338 17:83080372-83080394 CGGGAAGGGACGGCCGCGGGAGG + Intronic
1153836593 18:8969490-8969512 AAGGAAGGGCAGGAGGCAGCTGG + Intergenic
1154162669 18:11991562-11991584 CAGGACCGGCAGGAGGTGGGTGG + Intronic
1157131656 18:45013170-45013192 CAGGAATGGCAGGAGGCTGCAGG - Intronic
1157317119 18:46601522-46601544 CAGGAAGGGGAGGAGGGGGTGGG - Intronic
1157402132 18:47397461-47397483 CAGCAAGGCCAGGACCCAGGAGG - Intergenic
1157622287 18:49023608-49023630 CAGGGTGGGCAGGAAGCAGGTGG - Intergenic
1158500404 18:57995744-57995766 GAGGAAGGACAGGAGGAGGGAGG + Intergenic
1159966188 18:74598089-74598111 CAGGGAGGGGCGGAGGCGGGGGG - Intronic
1160006114 18:75070279-75070301 CAGGAGGGGCCCGACGCCGGCGG - Intergenic
1160585479 18:79911310-79911332 CAGGCAGGCCAGGAGGCAGGCGG + Intronic
1160726730 19:620838-620860 CAGGACGGGCAGGGGGCGCGGGG + Intronic
1160731511 19:643573-643595 CAGGACGGGCAGGAAGTGGGCGG - Exonic
1160830971 19:1104710-1104732 CAGGAGGGGCGGGAGACGGGCGG + Intronic
1160965727 19:1746173-1746195 GAGGAGGGGCAGGAAGGGGGAGG + Intergenic
1161393104 19:4031537-4031559 CAGGCAGGGAAGGTCGGGGGCGG - Intronic
1162320493 19:9968512-9968534 CAGACAGGGGAGGACGTGGGAGG + Intronic
1162410655 19:10503174-10503196 CCGGAAGCGCAGTGCGCGGGTGG - Intronic
1163304033 19:16466218-16466240 CAGGAAGGGCAGATCACTGGAGG - Intronic
1163435875 19:17294704-17294726 CAAGCAGTGCAGGACGCAGGTGG + Exonic
1163807188 19:19406278-19406300 CAGGAAGCGCAGGACGGAAGCGG - Intronic
1164563390 19:29309304-29309326 CATTCAGGGCAGGACGCTGGGGG - Intergenic
1165373740 19:35426849-35426871 CAGGATGGGCAGGAGGGGGTGGG - Intergenic
1165699913 19:37929666-37929688 AAGGAAGGGTAGGAGGAGGGGGG - Intronic
1165796721 19:38524031-38524053 CTGGGAGGGGAGGACGGGGGTGG - Intronic
1165924925 19:39320897-39320919 GAGGGAGGGCGGGAGGCGGGAGG - Intergenic
1166198269 19:41220372-41220394 CAGGCAGTGCAGGGCGTGGGAGG + Intronic
1166442098 19:42823897-42823919 CAGGAGAGGCAGGGCCCGGGAGG + Intronic
1166461522 19:42992180-42992202 CAGGAGAGGCAGGGCCCGGGAGG + Intronic
1166478815 19:43152165-43152187 CAGGAGAGGCAGGGCCCGGGAGG + Intronic
1166501488 19:43344496-43344518 CAGGAGAGGCAGGGCCCGGGAGG + Intergenic
1166508628 19:43388962-43388984 CAGGAGAGGCAGGGCCCGGGAGG - Intergenic
1166528413 19:43527250-43527272 CGGGAAGGGCGGGGCGGGGGCGG + Intronic
1166997629 19:46727350-46727372 CAGGATGAGCAGGGCACGGGCGG + Intronic
1167104029 19:47419961-47419983 CAGGATGGGCAGTGCGCTGGGGG + Intergenic
1167272241 19:48511922-48511944 CAGGAAGGGTGGGAGGAGGGAGG + Intronic
1167576716 19:50321138-50321160 CAGGAAGGGTAGGACTGGGGTGG + Intronic
1167706471 19:51084081-51084103 GAGGACGGGCAGGAGGTGGGCGG + Intronic
1168336480 19:55600225-55600247 CGGGAAGGGCAGGAAGGGAGGGG + Intronic
1168715214 19:58523028-58523050 TAGGAAGGAGAGGACACGGGTGG + Intronic
927178219 2:20424976-20424998 CAGGAAGAGCAGGAGGCCTGCGG + Intergenic
927503252 2:23596162-23596184 CCGGACGGGCAGGCCGGGGGCGG + Intronic
927772753 2:25878180-25878202 GAAGAAGGGCAGGACCTGGGCGG - Intronic
927900612 2:26815744-26815766 CAGGCAGAGCGGGAGGCGGGGGG + Intergenic
929769757 2:44881656-44881678 CAGGAAAGGCAGGGAGTGGGGGG + Intergenic
930874920 2:56204532-56204554 GAGGAAGGGCAAGAAGCTGGAGG - Intronic
932281657 2:70498327-70498349 CAGGAAAGGCAGGGCCCTGGGGG - Intronic
932330850 2:70897561-70897583 TAGGAAGGGGAGGACGCCGGTGG + Intergenic
932362336 2:71119075-71119097 CAGGAAGGGAAGGAATGGGGAGG + Intronic
932534772 2:72581675-72581697 CAGCAGGGGCAGGGTGCGGGAGG - Intronic
933684681 2:85133620-85133642 CGGGCCGGGCAGGGCGCGGGCGG + Exonic
934655986 2:96116962-96116984 CAGGGAGGGCAGGGCGGGCGTGG + Intergenic
935984500 2:108659807-108659829 AAAGAAGGGCAGGAAGCGGGAGG - Intronic
936060859 2:109294903-109294925 CAGGGAGGGAAGGAAGTGGGTGG + Intronic
936073675 2:109387887-109387909 CAGGAAGGGCCGTGTGCGGGTGG - Intronic
936136937 2:109903455-109903477 AAAGAAGGGCAGGAAGCGGGAGG - Intergenic
936152664 2:110030177-110030199 CAGGGAGGGGAGCAGGCGGGAGG + Intergenic
936192016 2:110341235-110341257 CAGGGAGGGGAGCAGGCGGGAGG - Intergenic
936207760 2:110468030-110468052 AAAGAAGGGCAGGAAGCGGGAGG + Intronic
937847507 2:126597779-126597801 CAGGAAGGGAGGGAGGAGGGGGG - Intergenic
938397945 2:130964316-130964338 AAGGAAAGGCAGGAGGGGGGCGG - Intronic
939065878 2:137482840-137482862 GAGGAAAGGCAGGAAGTGGGTGG + Intronic
940203784 2:151180145-151180167 CAGGAAGGGCAGGAGGAGTGTGG - Intergenic
941670061 2:168283558-168283580 CAGGAAGGGCTGGAGGCAAGAGG - Intergenic
947399223 2:229714892-229714914 CGGGCAGGGCAGGGCGCGGGAGG + Intergenic
947661802 2:231875040-231875062 CAGGAATGGCAGGCTGTGGGTGG + Intergenic
948463839 2:238142941-238142963 CAGGTGGGTCTGGACGCGGGAGG - Intronic
948686967 2:239675879-239675901 CTGGAGGGGCAGGAGGCGGGGGG - Intergenic
948759877 2:240183872-240183894 CAGGAAGGGCGGGGCAGGGGGGG + Intergenic
948800172 2:240429916-240429938 CAGGGAGGGAAGGAGGAGGGGGG - Intergenic
948901801 2:240960057-240960079 CAGGAAGGGCCTGACTCTGGAGG + Intronic
948926540 2:241102318-241102340 CCGGAAGTGAAGGACGGGGGAGG - Intronic
949014615 2:241702265-241702287 AAGGGAGGGGAGGGCGCGGGGGG + Intronic
1170723409 20:18903937-18903959 GAGAAAGGGCATGACTCGGGAGG + Intergenic
1171234398 20:23512592-23512614 CAGGAAGGGCTGGAAGAGGCGGG + Intergenic
1171249814 20:23638579-23638601 GAGGAGGGGCGGGACGAGGGAGG - Intergenic
1171424814 20:25042778-25042800 GAAGAAGGGCAGGACATGGGTGG - Intronic
1172033454 20:31996649-31996671 CGCGAAGGCCAGGCCGCGGGCGG - Exonic
1172293704 20:33793306-33793328 CAGGAAGGGTGTGACGCGGCAGG + Intergenic
1172617780 20:36300474-36300496 CAGGAGGGGCTGGACCTGGGTGG + Intergenic
1172988134 20:39009665-39009687 CAGGAAGGGCAGAAAGGGAGGGG - Intronic
1173851077 20:46218735-46218757 CAGGGAGGGCAGCAGGCGTGGGG + Intronic
1174308360 20:49631389-49631411 CAGGAAGCGCGGGAAGCTGGGGG - Intergenic
1174370298 20:50082359-50082381 CAGGGAGGGTGGGAGGCGGGAGG + Exonic
1175605905 20:60312007-60312029 CAGGAAGGGGAGGCAGCAGGAGG + Intergenic
1176043729 20:63081758-63081780 CAGGAAGGTCAGGCCGTGGATGG - Intergenic
1176299831 21:5094418-5094440 CAGGAAGTGCAGGGCGGGCGTGG - Intergenic
1177128551 21:17228034-17228056 TAGGAAGGGCAGGAGGGGAGTGG + Intergenic
1178631961 21:34269257-34269279 CAGGAAGGCCAGGTCAGGGGTGG + Intergenic
1179444825 21:41423926-41423948 CAGCCAGGGCAGGACTCGGAAGG - Intronic
1179857191 21:44167493-44167515 CAGGAAGTGCAGGGCGGGCGTGG + Intergenic
1180098872 21:45574998-45575020 CAGGGCTGGCAGGAAGCGGGTGG + Intergenic
1180143621 21:45907838-45907860 CTGGAAGGGAAGGACGGGGCGGG + Intronic
1180754028 22:18147897-18147919 CAGGGAGGGCAGGGTGCTGGTGG - Intergenic
1180763110 22:18223715-18223737 CAGGCTGGGCAGGCCCCGGGCGG - Intergenic
1180772535 22:18400832-18400854 CAGGCTGGGCAGGCCCCGGGCGG + Intergenic
1180803915 22:18650448-18650470 CAGGCTGGGCAGGCCCCGGGCGG + Intergenic
1180806848 22:18719001-18719023 CAGGCTGGGCAGGCCCCGGGCGG - Intergenic
1181217803 22:21344811-21344833 CAGGCTGGGCAGGCCCCGGGTGG - Intergenic
1181232831 22:21432222-21432244 CAGGTAGGGCAGGAGCCGGCTGG - Intronic
1181245820 22:21502635-21502657 CAGGTAGGGCAGGAGCCGGCTGG + Intergenic
1181309610 22:21937536-21937558 AAGGACTGGCAGGACGAGGGGGG - Intronic
1181540144 22:23568651-23568673 GAGGACTGGCAGGACGCGGTGGG + Intergenic
1181850136 22:25743901-25743923 CATGTGGGGCAGGAGGCGGGGGG + Intronic
1182097884 22:27638263-27638285 CAGGAAGGCCAGGGCGGGGCTGG - Intergenic
1182278645 22:29205890-29205912 GAGGGCGGGCAGGAGGCGGGCGG - Exonic
1182301964 22:29341993-29342015 CAGGAAGGGCAGGCCACAGAGGG - Intronic
1182575658 22:31271227-31271249 CAGGAAGGATAGGACCCTGGAGG - Intronic
1182586470 22:31346628-31346650 GAGGGGGGGCAGGAAGCGGGGGG - Intergenic
1183077387 22:35435678-35435700 CAGGAGGGGCAGGCAGAGGGAGG + Intergenic
1183281667 22:36935751-36935773 CAGGAAGGGAAGGAGGAGGTGGG - Intronic
1183427790 22:37748751-37748773 ATGGGAGGGCAGGACGGGGGCGG + Intronic
1183432508 22:37774300-37774322 GAGGTAGGGCAGGAAGAGGGTGG - Exonic
1183585097 22:38748793-38748815 GCGGGAGGGCAGGACGGGGGAGG + Intronic
1183828425 22:40405653-40405675 CAGGAACAGCAGGAGGCAGGCGG - Exonic
1184018015 22:41800471-41800493 CAGGAGGGACAGGACGAGGATGG + Intergenic
1184258759 22:43302482-43302504 CAGGCAGGGCAGGGGGCGGCTGG + Intronic
1184263122 22:43330962-43330984 CAGGAAAGGCAGTAGGCGGTGGG - Intronic
1184276547 22:43412156-43412178 CAGGTAGGACCGGAGGCGGGCGG + Intronic
1184362011 22:44024429-44024451 CAGGAAGCGGAGGGCGCGCGAGG + Intronic
1184595211 22:45509704-45509726 CAGGAGGGGCAGGGTGCAGGTGG + Intronic
1184769462 22:46589073-46589095 CAGGGACGGCAGGGGGCGGGGGG + Intronic
1185086223 22:48742424-48742446 CAGGTGGGGCAGGAGACGGGTGG + Intronic
1185221909 22:49633265-49633287 CAGGGAGGCCAGGACTGGGGAGG - Intronic
1185243621 22:49761011-49761033 CAGCATGGGCAGGACGCTGCAGG - Intergenic
1203234373 22_KI270731v1_random:141820-141842 CAGGCTGGGCAGGCCCCGGGCGG + Intergenic
950182874 3:10927390-10927412 CAGCAAGGGCAGCACGCATGGGG - Intronic
950472231 3:13193447-13193469 CAGGAAGGGGAGCACGCTGGGGG + Intergenic
950486770 3:13278498-13278520 CATGAAGGGCAGGTGGTGGGTGG + Intergenic
950664958 3:14489790-14489812 CCAGAAGGGCAGAAAGCGGGTGG + Exonic
951078709 3:18425828-18425850 CAGGACGGGCAGGACGGGCACGG + Intronic
951613982 3:24521904-24521926 GAGGAAGGGCGGGCCGCAGGCGG + Intergenic
953143232 3:40248863-40248885 CAGGAAGGGAAGGACTCAAGTGG + Intronic
953406684 3:42663314-42663336 AAGGAAGGGCAGGATGGGAGTGG - Intronic
953826146 3:46252603-46252625 AAGGAAGGGAAGGAAGTGGGAGG + Intronic
953839398 3:46377014-46377036 AAGGAAGGGCAGGAGGGGGCTGG + Intergenic
953879567 3:46684609-46684631 CAGAATGGGGAGGACGTGGGAGG + Intronic
954004587 3:47580628-47580650 CAGGAAGGGAAGGAGGAGGTAGG - Exonic
954389209 3:50260157-50260179 CAGGCAGGGCAGAGCACGGGCGG - Intergenic
954405066 3:50341007-50341029 AAGGAAGGGCAAGGCGGGGGGGG - Intergenic
954628204 3:52034460-52034482 CAGCAAGGGCTGGAGGCAGGGGG + Intergenic
957594199 3:82240234-82240256 CAAAAAGGGCAGGACTCGGCTGG + Intergenic
957948050 3:87089388-87089410 CAGGAGGGGCTGGCCGAGGGTGG - Intergenic
959063126 3:101633708-101633730 CAGAAAAGGCAGGATGCGGAAGG - Intergenic
960670117 3:120147580-120147602 CAGGAAGAGCAGGAATAGGGTGG + Intergenic
960960548 3:123067509-123067531 CCGGTCGGGCAGGACGCCGGCGG + Intronic
961044044 3:123696606-123696628 TTGGAAGGGCAGGATGGGGGTGG - Intronic
961368605 3:126416254-126416276 CGGGGAGGCCTGGACGCGGGTGG + Intronic
961658945 3:128458188-128458210 TAGGAAGGGGAGGAGGCCGGGGG + Intergenic
961703813 3:128768071-128768093 AAGGAAGGGCAGTAGGCAGGAGG - Intronic
963793141 3:149604710-149604732 CAGGAAGGGCAGCACACGGAAGG - Intronic
964006267 3:151832970-151832992 CAAGAAGAGCAGGAGGAGGGAGG + Intergenic
965749472 3:171961085-171961107 CAGGCAGGCCAGGATGTGGGAGG - Intergenic
965942458 3:174201306-174201328 GAGGAAGGGAGGGAGGCGGGAGG + Intronic
967694541 3:192515307-192515329 CAGGGAGGGCTGGACCCCGGAGG + Intronic
968516593 4:1018119-1018141 GGGGAAGGGCAGGCCGCAGGGGG + Intronic
968565554 4:1310802-1310824 AAGCAGGGGCAGGAGGCGGGTGG - Intronic
968889174 4:3358922-3358944 GAGGAAGGGGAGGAGGAGGGGGG - Intronic
968891725 4:3372963-3372985 GAGGAAGGGCAGGAGGGAGGAGG + Intronic
969394204 4:6909991-6910013 GAGGGAGGGCAGGGCGCGCGGGG + Intronic
969405607 4:6989518-6989540 GAGGAAGGGCAGGATGCCTGAGG - Intronic
970001193 4:11367760-11367782 CAGGAAGGGGAAGAGGAGGGAGG - Intergenic
970081564 4:12292549-12292571 CAGGAAGGGGAGCACGCAGATGG - Intergenic
970891226 4:21046832-21046854 TTGGAAGGCCAGGAGGCGGGTGG - Intronic
971145615 4:23973164-23973186 CAGGAAGGGCAGGAAGAAGAAGG + Intergenic
971375084 4:26049948-26049970 GAGGATGGGCAAGAAGCGGGAGG + Intergenic
972362904 4:38345401-38345423 CATGGAGGGCAGGACAGGGGTGG - Intergenic
973317896 4:48780316-48780338 CAGGAAGGCCAGGGGGCGGGCGG - Intronic
975139176 4:70902628-70902650 CAGGAGGGTCGGGACGAGGGCGG - Intronic
981184588 4:141785970-141785992 CAGGAAGAGGAGGAGGAGGGGGG - Intergenic
981429969 4:144646640-144646662 CAGCAGGGGCTGGGCGCGGGAGG - Exonic
981475208 4:145180492-145180514 CCGGAGGGGCAGGGAGCGGGTGG + Intergenic
982134261 4:152258718-152258740 AAGGAAGGGCAGGCGGGGGGCGG - Intergenic
983026708 4:162746800-162746822 CAGGAAGGGGAGGAGAGGGGAGG + Intergenic
985068255 4:186144330-186144352 CCGGTAGGGCAGGACGGGCGTGG + Intronic
986134001 5:4957709-4957731 CAGGAAGGGCAGGGCTCCGCGGG + Intergenic
986718284 5:10539598-10539620 CAGGAAGGGAAGGACTGGGCTGG + Intergenic
986736588 5:10672958-10672980 CAGGGATGGCAGGAAGCTGGAGG - Intergenic
987012741 5:13783559-13783581 CAGGCAGAGCATGACTCGGGAGG + Intronic
989146914 5:38258473-38258495 AGGGAAGGGCTGGCCGCGGGAGG - Exonic
989178993 5:38557161-38557183 CAGGAGGACCAGGACGCGAGCGG - Intronic
990533350 5:56695626-56695648 CAAGAAGAGCAGGAAGAGGGTGG + Intergenic
991478885 5:67055241-67055263 GAGGAAGGTCAGGAAGTGGGAGG + Intronic
993526840 5:88975580-88975602 CAGGGAGGCCAAGAGGCGGGAGG + Intergenic
993901683 5:93588319-93588341 CATGAAGGCCACGACGCGGTCGG - Exonic
996903053 5:128565885-128565907 AAGGAAGGCCAGGAAGCTGGAGG - Intronic
996937595 5:128966076-128966098 CTGGAAGAGAAGGACGCTGGTGG + Exonic
997143211 5:131405479-131405501 CAGGAAGGACAGGACGGGGAAGG + Intergenic
997791443 5:136766006-136766028 AAGGAAGGGGAGGAAGCAGGAGG - Intergenic
998141380 5:139701454-139701476 CAGGAAGGGGCGGAAGGGGGAGG - Intergenic
1001615159 5:173037283-173037305 CTGGAAGGGCAGGAAGGGTGTGG - Intergenic
1002055726 5:176597065-176597087 CGAGAAGGGCATGACGTGGGAGG - Exonic
1002698894 5:181108889-181108911 CAGGCAGGGTAGGAAGTGGGAGG + Intergenic
1002783420 6:383859-383881 TAGGCAGGGCAGGATGTGGGGGG - Intergenic
1002898530 6:1392818-1392840 CAGGGAAGGCCGGCCGCGGGAGG - Intronic
1003125952 6:3356074-3356096 CGGGAGGGGGAGGAGGCGGGAGG + Intronic
1003414819 6:5898383-5898405 GAGGGAGGGCAGGAGGAGGGAGG - Intergenic
1004412032 6:15390084-15390106 AGGGAAGGGCAGGAGGCAGGGGG - Intronic
1005106191 6:22227005-22227027 CAGAAAGGGCAAGAAGAGGGTGG - Intergenic
1005825294 6:29628352-29628374 TAGGAAGGGAAGGATGCGAGTGG + Intronic
1005862697 6:29913687-29913709 CAGGAAAGTCAGGACCCTGGTGG + Intergenic
1005993242 6:30916255-30916277 TATGATGGGCAGGACTCGGGGGG + Intronic
1006474256 6:34244740-34244762 CAGGGAGTGCAGGGAGCGGGTGG + Intronic
1007359112 6:41342623-41342645 CTGGAAGGGCAGGTAGTGGGAGG - Intronic
1010378453 6:75201954-75201976 GAGCAAGGGCAGGACACTGGAGG + Intronic
1015207438 6:130655789-130655811 GAGGAAGGGCAGGACAAGAGAGG + Intergenic
1015921544 6:138270924-138270946 CAGGAAGGGCAGGAGGCATTGGG + Intronic
1018613275 6:165662828-165662850 GCGGAGGGGCAGGCCGCGGGCGG + Intronic
1019168745 6:170116846-170116868 GAGGAAGAGCAGGAGGCTGGGGG + Intergenic
1019807034 7:3135431-3135453 CTGGGAGGGCAGGACCCTGGGGG - Intergenic
1019923079 7:4175039-4175061 CAGGGATGGCAGAAAGCGGGAGG - Intronic
1020073068 7:5240220-5240242 CAGGAAAGGCAGGGCGGGGGCGG - Intergenic
1020122606 7:5513524-5513546 CAGGATGGGAAGGACGGGGCGGG + Intronic
1020262094 7:6536413-6536435 CGGGTCGGGCAGGGCGCGGGAGG - Intronic
1021726809 7:23555243-23555265 CAGGAAGGGTAGGAGGAAGGGGG - Intergenic
1022815130 7:33905744-33905766 CAGGTAGGGGAGGGGGCGGGAGG + Exonic
1023064792 7:36366885-36366907 CGGGAAGGGCTGGCCGCGGCGGG - Intronic
1023215391 7:37857001-37857023 AAAGAAGGGCAGGACCAGGGAGG + Intronic
1023791130 7:43754725-43754747 CTGGAAGGGCAGGAAGCTGGCGG - Intergenic
1024217201 7:47257395-47257417 CAGGAAGGGGAGGATTCAGGAGG + Intergenic
1024835257 7:53510839-53510861 CAGGAAGAGCAGGACCAGGAAGG + Intergenic
1026843496 7:73683905-73683927 CGGGAAGGGAAGGACCCGGGTGG + Intronic
1026866633 7:73828087-73828109 CCGGGGGGGCAGGAGGCGGGCGG + Intronic
1028464688 7:91137334-91137356 CAGGAAGGTCAGGCCGCTGGGGG + Intronic
1029619110 7:101678990-101679012 AAGGAAGGACAGGGCGCTGGTGG + Intergenic
1029641951 7:101826602-101826624 CAGGACTGGCAGGACGAGGCTGG + Intronic
1031887174 7:127254134-127254156 CAGGGAGAGCGGGGCGCGGGGGG + Intergenic
1032441672 7:131946817-131946839 GGGGATGGGCAGGAAGCGGGGGG + Intergenic
1032720848 7:134549932-134549954 CAGGAAAGGCAGGACTGGGATGG - Intronic
1032996130 7:137448595-137448617 GAGGAAGGGAAGGAGGAGGGAGG + Intronic
1032996144 7:137448631-137448653 GAGGAAGGGAAGGAGGAGGGAGG + Intronic
1032996158 7:137448667-137448689 GAGGAAGGGAAGGAGGAGGGAGG + Intronic
1033020796 7:137722283-137722305 CAAGAACGGCAGTACCCGGGTGG + Intronic
1034990391 7:155544335-155544357 CTGGAAGGGGAGGAGCCGGGTGG - Intergenic
1035318988 7:158016205-158016227 GAGGATGGGCAGGGCTCGGGAGG + Intronic
1035381379 7:158443538-158443560 CAGGGAGGGGAGGAAGCAGGAGG + Intronic
1036671137 8:10788975-10788997 CAGGAAAAGCAGGATGAGGGTGG + Intronic
1037572607 8:20171421-20171443 CAGGAAGGCCAGGATGAGGAAGG + Exonic
1038425358 8:27461006-27461028 CTGGAAGGGGAGGAAGCGGGAGG - Exonic
1038642091 8:29337059-29337081 CAGGTAGGGCAGGCTGCTGGGGG + Exonic
1038700131 8:29842187-29842209 CTGGAAGTCCAGGACGCAGGAGG - Intergenic
1039307762 8:36281797-36281819 CAGGAAGGGCAGGGTTGGGGAGG - Intergenic
1039452719 8:37688531-37688553 AGGGAAGGGCAGGATGCTGGGGG + Intergenic
1042120612 8:65484042-65484064 CAGGAAGGGAAGGAAGGAGGTGG + Intergenic
1042576039 8:70219667-70219689 CAGGAAGGGCAGGAGGAGGGTGG + Intronic
1044330452 8:90913984-90914006 CAGCAAGGGCTGGATGCAGGGGG + Intronic
1045641830 8:104259884-104259906 CAGGCAGGGCAGGGCGGGGAGGG + Intergenic
1046530468 8:115438722-115438744 CAGGAGGGGCAGGGAGAGGGAGG - Intronic
1046710609 8:117506921-117506943 CAGGAGGGGCAGGCGGCAGGAGG - Intergenic
1048394289 8:133999021-133999043 CAGGAAGGGTAGGAGGGAGGAGG + Intergenic
1048408082 8:134143133-134143155 AAGGAAGGGTAGGAGGAGGGAGG - Intergenic
1049226241 8:141451858-141451880 CAGGAGGGGCAGGTTGGGGGAGG + Intergenic
1049429016 8:142550669-142550691 CAGGAAGGGGAGGTGGGGGGAGG + Intergenic
1049438500 8:142598633-142598655 CAGGCAGGGCAGGCTGGGGGTGG - Intergenic
1049554748 8:143276189-143276211 CCGGCAGGGCAGCGCGCGGGGGG + Exonic
1049570419 8:143367798-143367820 CAGGAAGGCCAGGGCACAGGCGG - Intergenic
1049674805 8:143884709-143884731 CAGGAGGTGCAGGGAGCGGGGGG - Intergenic
1049683381 8:143929735-143929757 CGGGACAGCCAGGACGCGGGCGG - Exonic
1049762298 8:144336953-144336975 CAGGGAGGGCGGGCCGAGGGAGG + Intergenic
1049799668 8:144511951-144511973 GAGGAAGGGCAGGAGCCGGGAGG - Exonic
1052623107 9:30939762-30939784 CAGCAAGGGCAGGACAAGGAAGG - Intergenic
1056277893 9:85011192-85011214 CAGGAAGGGAAGGGAGCGGTAGG + Intronic
1056943491 9:90974982-90975004 CAGGAATGAGAGAACGCGGGAGG + Intergenic
1057075796 9:92137597-92137619 CAGGAAGGGCAGCAGGGTGGTGG - Intergenic
1057305513 9:93910033-93910055 CAGGAAGGGCAGGAAGCAGGAGG - Intergenic
1057308423 9:93925955-93925977 CAGAAAGGGCAGGGCTGGGGCGG - Intergenic
1057447137 9:95124531-95124553 GAGGAAGGGCAGTGAGCGGGAGG - Intronic
1057696749 9:97328610-97328632 GAGGAAGGGCAGCAGGCAGGAGG - Intronic
1057814693 9:98285875-98285897 CTGGAAGGGCAGGCCTCGGCTGG + Intergenic
1059323361 9:113486444-113486466 CAGGCAGTGCAGGACACAGGAGG + Intronic
1059412116 9:114139103-114139125 AAGGAAGGACAGGACACAGGAGG + Intergenic
1060147903 9:121268104-121268126 CGGGGTGGGCAGGGCGCGGGCGG - Intronic
1060221536 9:121766589-121766611 GAGGAAGCGCAGGAAGAGGGAGG - Exonic
1060389936 9:123268712-123268734 CAGGTGCGGCAGGACGCGCGTGG - Intergenic
1060549857 9:124479782-124479804 CAGGAGGGGCGGGACGCTGAAGG + Intergenic
1060670682 9:125466723-125466745 CAGGAATGGCAGGAAGGGAGTGG + Intronic
1061372232 9:130203869-130203891 TGGGAAGGGGAGGACGCCGGGGG - Intronic
1061498406 9:130989001-130989023 CAGGAAGGGCAGGAGGTGGCTGG - Intergenic
1061802472 9:133120090-133120112 CAGGCAGAGCAGGGCGAGGGGGG + Intronic
1062195782 9:135273217-135273239 CAGGAAGTGCAGGGCTGGGGAGG + Intergenic
1062232173 9:135487707-135487729 CAGGCTGGGCAGGCCCCGGGCGG - Exonic
1062285481 9:135770784-135770806 CAGGAAGGGCAGGCAGGGAGCGG + Intronic
1062472589 9:136712882-136712904 CCGGAAGGACGGGACGCTGGGGG + Intronic
1062538658 9:137031907-137031929 CTGGGAGGGGAGGACGGGGGTGG - Intronic
1062542395 9:137047411-137047433 CAGGAAGGTGAGGAGGCGAGTGG + Intergenic
1062615925 9:137395639-137395661 CAGGGAGGGCAGGGGGTGGGAGG + Intronic
1186508128 X:10110270-10110292 CAGGAAGGGTGGGGCGTGGGCGG - Intronic
1189274967 X:39778850-39778872 CAGGAAGAGCAGGATGAGAGAGG + Intergenic
1189288097 X:39866409-39866431 CAGGAGAGGCAGGAGGTGGGAGG + Intergenic
1190339155 X:49282693-49282715 CAGCAGGGGCAGAACGAGGGAGG + Intronic
1190773792 X:53536626-53536648 GAAGAAGGGCAGGATGCTGGTGG - Exonic
1191861091 X:65667391-65667413 CTGGAAGGCCAGGACGTGGAAGG + Intronic
1191928758 X:66344908-66344930 CAGGAAGGGCAAGAAGCTGGGGG - Intergenic
1195223597 X:102769406-102769428 CTGTAAAGGCGGGACGCGGGAGG + Intergenic
1195363698 X:104107774-104107796 CAGAAAGGCCAGGAAGCAGGTGG + Intronic
1195704533 X:107729397-107729419 GCAGAAGGGCAGGACGCTGGAGG + Intronic
1195751862 X:108167900-108167922 GAGGAAGGGAAGGAAGAGGGTGG - Intronic
1197018878 X:121661589-121661611 CAGGAAGGGGAGGATGGAGGAGG + Intergenic
1197634785 X:128902747-128902769 AAGAAAAGGCAGGAAGCGGGAGG + Intergenic
1197782585 X:130172341-130172363 CAGGAAGGGTGGGACCCGGGAGG + Intronic
1197804200 X:130383716-130383738 CAGTAAGGGCAGGAGGAGGAGGG + Intergenic
1198267463 X:135022531-135022553 CGGGAAGTGCATGTCGCGGGAGG + Intergenic
1200117810 X:153776812-153776834 GAGGCAGGGCAGGATGTGGGCGG + Intronic
1201416166 Y:13751450-13751472 TAGGAGGGGCAGGAAGCGGTTGG + Intergenic