ID: 1125734227

View in Genome Browser
Species Human (GRCh38)
Location 15:41912325-41912347
Sequence CACCAGGAAGGGCAGGACGC GGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 415
Summary {0: 1, 1: 0, 2: 3, 3: 36, 4: 375}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734227_1125734233 -2 Left 1125734227 15:41912325-41912347 CCCGCGTCCTGCCCTTCCTGGTG 0: 1
1: 0
2: 3
3: 36
4: 375
Right 1125734233 15:41912346-41912368 TGCGCCCTAAACAATAACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1125734227_1125734234 -1 Left 1125734227 15:41912325-41912347 CCCGCGTCCTGCCCTTCCTGGTG 0: 1
1: 0
2: 3
3: 36
4: 375
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734227 Original CRISPR CACCAGGAAGGGCAGGACGC GGG (reversed) Intronic
900001944 1:19333-19355 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
900021664 1:189856-189878 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
900087166 1:904211-904233 GACCAGGAAGACCAGGACCCCGG - Intergenic
900625096 1:3604331-3604353 CACAAGGCAGGGCACGAGGCAGG + Intronic
901060590 1:6470191-6470213 CCCTAGGAAGGGCAGGGCACAGG + Intronic
901977339 1:13005544-13005566 CCACAGCAAGGGCAGGACACCGG - Intronic
902004747 1:13223390-13223412 CCACAGCAAGGGCAGGACACCGG + Intergenic
902621310 1:17652567-17652589 CCCCAGGAAGGTGAGGACACCGG + Intronic
902627771 1:17686692-17686714 CACAAGGAAGGGCAGGAGTGGGG + Intronic
903911720 1:26731615-26731637 CACAGGGAAGGGCAGGAGGCAGG - Intronic
903952176 1:27002245-27002267 CACCAGGACAGGCAGGAATCAGG - Intergenic
904821567 1:33248270-33248292 GACCAGGCAGGGCAGGACATGGG - Intergenic
905313533 1:37066635-37066657 GACCAGGAAGGGCAGGGTGGGGG + Intergenic
905387649 1:37615252-37615274 CACCAGGGAGGGAAGGAAGGAGG - Intronic
905807443 1:40887095-40887117 CACTAGTAAGGGTAGGAAGCAGG + Intergenic
905828614 1:41046522-41046544 CTCCAGGAAGCGGAGGACGTAGG + Exonic
906240612 1:44240016-44240038 CACCAGGCAGGGCTGGGAGCTGG - Intronic
907159281 1:52359233-52359255 CCCCAGGTAGGGCAGGATGGTGG - Exonic
907804302 1:57802977-57802999 GACCAGGAAGAGCAGGACCCAGG + Intronic
912554848 1:110508482-110508504 CACCAGGAAGAGCAGCCTGCAGG + Intergenic
914456578 1:147842305-147842327 CCACAGGAAGGGCAGGGGGCAGG - Intergenic
914462879 1:147900986-147901008 CACCAGAAAGGACAGGAAGGGGG + Intergenic
915076211 1:153309786-153309808 CACCTGGCAGGGCAGGAACCAGG + Intronic
915076653 1:153313170-153313192 CACCAGCAGGGGCAGGAGGAAGG + Intergenic
915309253 1:154999266-154999288 CACCAGGAGGCGCAGGTCCCCGG - Intergenic
915318553 1:155043346-155043368 CACCAGGAAGAGAAGCAGGCTGG + Exonic
915555314 1:156657857-156657879 CACGAGAAAGGGAAGGAGGCCGG - Intronic
917144000 1:171868281-171868303 CATCAGGGAGGGTAGGACCCAGG - Intronic
918177877 1:182061146-182061168 CACCAGGAAGACCTGGAGGCAGG + Intronic
919003210 1:191860912-191860934 CACCTTGAAGGGAAGGACACAGG + Intergenic
919727107 1:200891572-200891594 CTCCGGGGAGGGCAGGCCGCAGG + Intronic
921238678 1:213154321-213154343 CACCAGGAAGGGAAGGACACAGG - Intronic
922730410 1:227946451-227946473 CACCCGGGAGGGCAGGAGGGAGG - Intronic
1062854339 10:772273-772295 CGCCGGGAGGGGCAGGAAGCTGG - Intergenic
1062919342 10:1267454-1267476 CCACTGGAAGAGCAGGACGCCGG + Intronic
1063928088 10:11000496-11000518 TACCAGGAGGAGCAGGGCGCAGG - Intergenic
1066399390 10:35060344-35060366 CACCAGGAAAGGCAGGAAGATGG + Intronic
1067108962 10:43385058-43385080 CACCAGGAATGGCAGGGTACAGG - Intergenic
1067291466 10:44946534-44946556 CTCCAGGAGGGGCAAGATGCTGG - Intergenic
1067752991 10:48984166-48984188 CCCCAGGAAGGCCAAGAAGCAGG + Intergenic
1068919132 10:62464930-62464952 CACCAGCAGGGGCCGGAAGCAGG + Intronic
1069053785 10:63822432-63822454 CCACAGGAAGGACAGGAGGCAGG - Intergenic
1070156603 10:73839466-73839488 CACCAGGAGGGCCAGCATGCCGG - Intronic
1070722338 10:78765296-78765318 CACCAGGGAGGACAGGCGGCTGG + Intergenic
1070922448 10:80196634-80196656 GACCAGCAAGGGCAGGACATTGG - Intronic
1070979850 10:80635319-80635341 GACCTGGAAGGGCAGGACGAAGG + Intronic
1071435566 10:85645984-85646006 GACCATGAAGGGCAGGGCGGTGG + Intronic
1072618024 10:97062669-97062691 CACCAGGAAGGGGCAGAGGCAGG + Intronic
1073100815 10:101005724-101005746 GACCAGGAGGGGCAGGGAGCAGG + Intronic
1073963489 10:108961166-108961188 CACCAGGAAGGGCAAGAATTTGG - Intergenic
1074186465 10:111103034-111103056 CAGCAAGCAGGGCAGGACACTGG - Intergenic
1074777557 10:116777445-116777467 CACCAGGTGGGGCAGGAAGGAGG - Intergenic
1075106348 10:119542514-119542536 CAAGAGGGAGGGCAGGAGGCCGG + Intronic
1075424043 10:122327852-122327874 CACCAGGAAGCTCCAGACGCCGG - Intronic
1075716008 10:124555631-124555653 CACCAGGCAGCGCAGGACTGTGG - Intronic
1076284016 10:129275855-129275877 CACTGGGAAAGTCAGGACGCGGG - Intergenic
1076509197 10:131000036-131000058 CACCAGGAAAGGCAAGGTGCAGG + Intergenic
1076634333 10:131872720-131872742 TCCCAGGCAGGGCAGGACCCGGG - Intergenic
1076672723 10:132131910-132131932 CAGCAGGCAGGGCAGGATTCGGG - Intronic
1077118050 11:894268-894290 CACCGGGCAGGGCAGGAGACAGG + Intronic
1077304539 11:1863199-1863221 CACCGCGGAGGGCAGCACGCCGG - Intronic
1077332753 11:1990566-1990588 CCCCAGGCAGGGCCGGACCCCGG + Intergenic
1077467454 11:2740198-2740220 CTCCAGGAATGGCAGGAGGGAGG + Intronic
1077496042 11:2886804-2886826 TACCAGGAAGGGCTGCAGGCGGG - Intergenic
1079183589 11:18215580-18215602 CACCCTGAAGGGAAGGACACAGG + Intronic
1079571945 11:21953602-21953624 CACCCTGAAGGGAAGGACACAGG + Intergenic
1080643296 11:34170751-34170773 GACCAGGCAGGGCAGGATTCAGG + Intronic
1080687099 11:34524793-34524815 CACCAGGCTGGGCTGGACTCGGG + Intergenic
1081872950 11:46391560-46391582 CGCCGGGAAGAGCAGGAAGCAGG - Intergenic
1082683702 11:56211722-56211744 CACCAGGAAGACCAGGAAGAGGG + Intergenic
1083318647 11:61831792-61831814 CAACAGGAAGGGAAGGAAGCTGG - Intronic
1083490451 11:63011616-63011638 TACCAGGAAGGCCAGGAAGTTGG - Intronic
1083681537 11:64353998-64354020 CCCCAGGAAGGGCAGCTGGCTGG + Exonic
1083776776 11:64897920-64897942 CCCCTGGAAGGGCAGGCCGAAGG - Exonic
1083877402 11:65531556-65531578 CACCTGAAAGGGCAGGAAGATGG - Exonic
1085501613 11:77029883-77029905 GACCAGGAAGGGGAGAAGGCCGG - Intergenic
1086347759 11:85914834-85914856 CACCAGGCTGGGGAGGACTCAGG + Intronic
1088210853 11:107454086-107454108 CACCCTGAAGGGAAAGACGCAGG + Intronic
1089626752 11:119755779-119755801 CACCAGGCAGGGCAGGGAACAGG - Intergenic
1089661969 11:119991757-119991779 CAGCAGGAAGGGCAGACCTCAGG - Intergenic
1091268571 11:134289788-134289810 CACCAGGAAGGACAGCAGGCAGG - Intronic
1091300423 11:134503818-134503840 CTCCAGGGAGGGGAGGATGCAGG - Intergenic
1202815736 11_KI270721v1_random:45742-45764 CCCCAGGCAGGGCCGGACCCCGG + Intergenic
1091795629 12:3296001-3296023 CACCAGGAAGAACAAGACCCTGG + Intergenic
1091865633 12:3833892-3833914 CCCCGGGAAGGGCAGGCTGCTGG + Intronic
1091930484 12:4391884-4391906 CACCAGGATGGGCACGTGGCGGG + Intergenic
1092088002 12:5780771-5780793 TACAAGGAAGGGCAGGCCGTGGG + Intronic
1093545131 12:20336891-20336913 CACCAGGAAGTGCAAGAGGTTGG - Intergenic
1093991067 12:25590799-25590821 CTCCAGGAAAGGGAGGACCCTGG + Intronic
1093991201 12:25591590-25591612 CACCCTGAAGGGAAGGACACAGG + Intronic
1095227618 12:39695681-39695703 CACCCTGAAGGGAAGGACACAGG + Intronic
1096243833 12:49973593-49973615 CACCTGGAGGGCCAGGAGGCGGG + Intronic
1096446596 12:51698447-51698469 CACCAGGATGAGCAAGAGGCAGG - Intronic
1097473161 12:60021214-60021236 CACCCTGAAGGGAAGGACACAGG - Intergenic
1098190006 12:67938042-67938064 CACCAGGGGGTGCAGGAAGCAGG - Intergenic
1098207833 12:68132166-68132188 CACCCTGAAGGGAAGGACACAGG - Intergenic
1101226751 12:102694964-102694986 CACCCTGAAGGGAAGGACACAGG + Intergenic
1101363701 12:104051726-104051748 CACTGGGAAGGGCAGGAGGAAGG - Intronic
1102570695 12:113825377-113825399 CACAAGGAAGGAGAGGAAGCCGG - Intronic
1102579788 12:113879087-113879109 GGCCAGGAGGGGCAGAACGCTGG - Intronic
1104717571 12:131026229-131026251 CACCGGGAAAGGCTGGAAGCAGG - Intronic
1106050003 13:26180926-26180948 CTACAGGAAGTGCAGGAAGCAGG - Intronic
1107658741 13:42617480-42617502 AACAATGAAGGGCAGCACGCTGG - Intergenic
1108274015 13:48789757-48789779 CACCAGGGAGGGCAGGAAGAAGG + Intergenic
1108922618 13:55694052-55694074 CACCATGAAGGGAAGGACACAGG + Intergenic
1111428779 13:88124993-88125015 GCCCAGGAAGGACAGGAAGCAGG - Intergenic
1113769369 13:112898582-112898604 CACCGGGGAGGGAAGGGCGCTGG - Intronic
1114186092 14:20403662-20403684 CTCCAGGAAGGGCAGGACAAGGG - Intronic
1116725089 14:48553423-48553445 CACCATGAAGGGAAAGACTCAGG - Intergenic
1117159295 14:52973228-52973250 CACCATAAAGGGAAGGACACAGG - Intergenic
1119539613 14:75429255-75429277 CAACAGGGAGGGCAGCACCCTGG - Intronic
1119848399 14:77847676-77847698 GGCCAGGAAGGGCAGCACACTGG - Intronic
1119900998 14:78259705-78259727 CAGAAGGAAGGGCAGCAAGCAGG - Intronic
1120862508 14:89267418-89267440 CACCAGGTAGACCAGGAAGCAGG + Intronic
1121098583 14:91234313-91234335 CACGTGGTAGGGCAGGAAGCAGG + Exonic
1122740789 14:103870531-103870553 CAGCAGGGAGGGCAGGCCTCAGG - Intergenic
1123122175 14:105921784-105921806 CACCAAGAAGGGTAGGACCCTGG - Intronic
1123404840 15:20013349-20013371 CATCAGGAAGGGTAGGACCCTGG - Intergenic
1123480117 15:20623259-20623281 CATGAGGAAGGGCAGGGTGCAGG + Intergenic
1123514171 15:21019997-21020019 CATCAGGAAGGGTAGGACCCTGG - Intergenic
1123587537 15:21772924-21772946 CACGTGGAAGGCCAGGACCCTGG + Intergenic
1123624175 15:22215489-22215511 CACGTGGAAGGCCAGGACCCTGG + Intergenic
1123637890 15:22377105-22377127 CATGAGGAAGGGCAGGGTGCAGG - Intergenic
1124177320 15:27438634-27438656 CACCCGGAGGAGCAGGAGGCGGG - Intronic
1124619322 15:31265019-31265041 CACAGGGAAAGGCAGGAGGCAGG - Intergenic
1125333317 15:38603409-38603431 CTCCAGGAGAGGCAGGAGGCAGG - Intergenic
1125734227 15:41912325-41912347 CACCAGGAAGGGCAGGACGCGGG - Intronic
1126517542 15:49553494-49553516 CACCCTGAAGGGAAGGACACAGG - Intronic
1128669781 15:69566421-69566443 TTCAAGGAAGGGCAGGACGGGGG + Intergenic
1128793316 15:70448679-70448701 CACCAGGGTGGGCAGGACTTGGG - Intergenic
1129228290 15:74182402-74182424 CACCAGGAAGGCCAGGGCCGTGG + Exonic
1129232255 15:74203318-74203340 CTCCAGGAGGAGCAGGAGGCAGG - Intronic
1129696139 15:77741561-77741583 ACCCAGGAGGGGCAGGCCGCAGG + Intronic
1130908513 15:88255966-88255988 CTCCTGGAAGGGCAGGATTCAGG - Exonic
1131228889 15:90646375-90646397 CTCCAGGAGAGGCAGGACACAGG - Intergenic
1131303860 15:91224103-91224125 GACCAGGAGGGCCAGGAAGCAGG + Intronic
1132279846 15:100602949-100602971 CCCCAGGCAGGGCCGGACCCTGG - Exonic
1132322400 15:100935607-100935629 CACCAGGAGGGCCAGGATGGTGG + Intronic
1132451566 15:101971606-101971628 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
1132455324 16:19022-19044 CATGAGGAAGGGCAGGAGGAGGG + Exonic
1132648485 16:1009939-1009961 CACCAGGAGGGGCTGGGCGTGGG + Intergenic
1132744806 16:1432168-1432190 CACTTGGGAGGGGAGGACGCTGG - Intergenic
1132877476 16:2146836-2146858 CCCCAGGAAGAGAAGGAGGCAGG - Intronic
1135047504 16:19167774-19167796 CACGAGGCCGGGCACGACGCTGG + Intronic
1135120958 16:19766370-19766392 CACCAGGAAGGGCACGTGGATGG - Intronic
1135279445 16:21141259-21141281 CACCAGAGAAGGCAGGACGGTGG - Intronic
1135623437 16:23975398-23975420 TACCAGCAAGGGGAGGATGCTGG + Intronic
1135942134 16:26831057-26831079 CAGCAAGAAGTGCAGGAGGCAGG + Intergenic
1136063139 16:27740574-27740596 CACCGGCAAGGACAGGAAGCAGG + Exonic
1136749150 16:32617116-32617138 CACCAGGAAGGGCTTGATGTGGG + Intergenic
1137683772 16:50372240-50372262 CACCAGAAAGGGGAGGAAGGAGG - Intergenic
1138149695 16:54644681-54644703 CAGCAGGAATGGCAGCACCCAGG - Intergenic
1138495943 16:57409547-57409569 GACCAGGAAGGCCTGGAAGCTGG + Intronic
1139651085 16:68362369-68362391 CCACAGGGAGGGCAGGGCGCTGG + Intronic
1141167812 16:81671998-81672020 CACCAGGTTGGGCAGGACCCGGG - Exonic
1141947463 16:87320418-87320440 GACCAAGAAGGTCAGGACACAGG - Intronic
1142086119 16:88183451-88183473 CAGCACCAAGGGCGGGACGCTGG + Intergenic
1142206481 16:88785347-88785369 CACCAGGGCGGGCCGGAGGCGGG - Intergenic
1142285469 16:89169860-89169882 CAGCAGGAAGGTCAGGAGGCAGG - Intergenic
1203051283 16_KI270728v1_random:876330-876352 CACCAGGAAGGGCTTGATGTGGG + Intergenic
1142542613 17:672062-672084 CCCCAGGAAGGGCAGGAGGCTGG + Intronic
1142599019 17:1044040-1044062 CGCCAAGAAGGGCCGGACCCTGG + Intronic
1144492090 17:15721942-15721964 CACAAGGAAGGGAAGAAAGCAGG - Intergenic
1144578502 17:16444631-16444653 CAGCAGGCAGGGCAGGGCTCAGG + Intronic
1144708356 17:17384575-17384597 CACCAGGAAGGCCAGGCCCTGGG + Intergenic
1144773230 17:17771002-17771024 CCCAAGGAAGGGCAGGGCTCAGG + Intronic
1144908383 17:18657258-18657280 CACAAGGAAGGGAAGAAAGCAGG + Intronic
1146318953 17:31831521-31831543 CACCACGAAGGCCAGAAGGCAGG + Intergenic
1147416619 17:40295904-40295926 CAGCAGGAGGGGCAGGAGGATGG - Intronic
1147653235 17:42073670-42073692 AACCAGGAAGAGCAGGAGGCAGG + Intergenic
1147966916 17:44198995-44199017 CACTGGGAAGGGTAGGAGGCCGG + Intronic
1148443700 17:47725382-47725404 CAACAGGAAGGCCAGGAGGTGGG + Intergenic
1148862057 17:50609634-50609656 CACCGGGAGGGGCAGGCAGCCGG - Intronic
1149563384 17:57625347-57625369 CACCAGGAAGTGAGGGACGGTGG + Intronic
1150871108 17:68911514-68911536 CACCATAAAGGGAAGGACACAGG + Intronic
1151167660 17:72219239-72219261 CCCCATGAAGGGCTGGAAGCTGG + Intergenic
1151683891 17:75635830-75635852 CACGAGGAAGGGCTGGCAGCAGG - Intronic
1151894298 17:76969671-76969693 CACCAGGAAGGGCTGGAACGGGG - Intergenic
1152022412 17:77787408-77787430 CGCGGGGAAGGGCAGGAGGCAGG - Intergenic
1152584836 17:81184299-81184321 CATCAGGAGGGGCAGGACCTGGG - Intergenic
1152604165 17:81280757-81280779 CACGGGGCAGGTCAGGACGCAGG + Intronic
1152635687 17:81429706-81429728 GCCCAGGATGGGCAGGAGGCAGG + Intronic
1152699552 17:81812233-81812255 CACCAGGATGGCCAGGAAGACGG - Exonic
1152809553 17:82375130-82375152 CAGCCAGAAGGGCAGGAAGCAGG - Exonic
1153744927 18:8167979-8168001 CACAAGCAAGGGCAGAAAGCTGG - Intronic
1157402133 18:47397464-47397486 CAGCAGCAAGGCCAGGACCCAGG - Intergenic
1160004500 18:75059909-75059931 CACCAGGCGGGGATGGACGCGGG + Intronic
1160018699 18:75164045-75164067 AACTAGGAAGGGCTGGACCCTGG + Intergenic
1160121303 18:76132795-76132817 CGCCAGGAAGCACAGGAGGCTGG + Intergenic
1160200057 18:76788706-76788728 CTCCCGGCAGGGCAGGACTCAGG - Intergenic
1160271820 18:77393757-77393779 CACCAGAAGTGGCAAGACGCAGG - Intergenic
1160633696 19:60941-60963 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
1160729026 19:632363-632385 CACCAGCCAGGCCAGGACGAGGG + Intronic
1160731513 19:643576-643598 GACCAGGACGGGCAGGAAGTGGG - Exonic
1162466257 19:10842847-10842869 CACCCGCAAGGGCATGACACTGG + Intronic
1163691925 19:18743007-18743029 CACCTGGAAGGGCAGGTCCATGG - Exonic
1163717428 19:18880178-18880200 GACCAGGCAGGGAAGGAGGCGGG - Intronic
1164161364 19:22627486-22627508 CACCAGGAAGAAGAGGAGGCCGG + Intergenic
1164491158 19:28715253-28715275 CACCCTGAAGGGAAGGACACAGG + Intergenic
1164679479 19:30124134-30124156 CCCCAGGAAGGGAAGAAAGCTGG + Intergenic
1166088120 19:40490229-40490251 CACCTGGAAGCGCAGGATGATGG - Exonic
1167470253 19:49671822-49671844 CACCAGAAGGAGCAGGACGGAGG - Intronic
1167735742 19:51293668-51293690 AACCAGGAAGCGGAGGAAGCTGG + Intergenic
1168115985 19:54221627-54221649 CACCTGGAAGGGGAGGACTCAGG - Intronic
1168666515 19:58209074-58209096 CATCAGGCAGGGCTGGACCCAGG + Intronic
925005173 2:437736-437758 CACAAGGAAGTGAAGGACGTTGG + Intergenic
926233983 2:11025700-11025722 CACCAGGAAGGTCAGAAGGGAGG - Intergenic
926998662 2:18768885-18768907 CCCCAGGAGGGGAAGGATGCTGG - Intergenic
927194542 2:20538638-20538660 CCCCAGGAAGAACAGGAGGCAGG + Intergenic
927247827 2:20972066-20972088 AGCCAGGAAGGGCAGGACATGGG - Intergenic
928174911 2:29027006-29027028 CACCAGGTAGGGCAGGGCCAGGG + Exonic
928210477 2:29320092-29320114 CACCAGGCTGGGCAGGATGTGGG - Intronic
928783660 2:34854983-34855005 CACCATGAAGGGAAGGACATAGG + Intergenic
929931992 2:46264601-46264623 CACCAGGCAGTGCAGGATCCCGG + Intergenic
930380608 2:50623045-50623067 TCACAGGAAGGGCAGGTCGCAGG + Intronic
931443109 2:62305182-62305204 CACCAGGTAAGGCAGGTGGCAGG - Intergenic
931572347 2:63681613-63681635 CACCTTGAAGGGAAGGACACAGG + Intronic
931637347 2:64352363-64352385 CACCCTGAAGGGAAGGACACAGG + Intergenic
932233558 2:70102711-70102733 CAGCAGGTGGGGCAGGAGGCCGG - Intergenic
932288121 2:70553795-70553817 CCGCAGGTAGGGCAGGAGGCTGG - Exonic
932330849 2:70897558-70897580 CTCTAGGAAGGGGAGGACGCCGG + Intergenic
936567778 2:113594072-113594094 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
937461895 2:122096383-122096405 CACCAGGAATGACAGGAAACGGG + Intergenic
938364134 2:130720591-130720613 CACTAGGAGGAGCAGGAGGCAGG + Intergenic
940436897 2:153666370-153666392 CACCAGGAGCAGCAGGACGGTGG - Intergenic
943700804 2:190986448-190986470 CACCAGGAAGGGGAACACGGGGG + Intronic
944217849 2:197273643-197273665 CTCCAGGAAGCCCAGGCCGCAGG - Intronic
946242910 2:218367786-218367808 CAGCAGGAAGAGCAGGAAGTCGG - Exonic
948695486 2:239731213-239731235 CTTGAGGAAGGGCAGGACTCAGG - Intergenic
949006899 2:241654854-241654876 CAGCAGGAAGGGCAAGGCCCAGG - Intronic
1168786522 20:544283-544305 CCCTAGGAAGGGCATGGCGCAGG + Intergenic
1169264541 20:4159954-4159976 CACCAGGAGGGGAAGGTCTCGGG + Intronic
1169355396 20:4901004-4901026 CGTCAGGAAGGGCATGATGCAGG + Intronic
1169587107 20:7097165-7097187 CACCTTGAAGGGAAGGACACAGG + Intergenic
1170168070 20:13382031-13382053 CACCAGGAGGAGCAGGCTGCCGG - Intergenic
1171129000 20:22630959-22630981 CACCAGGAGCGGCAGGTGGCAGG - Intergenic
1172913508 20:38427460-38427482 AGCCAGGAAGGGCAGGAGGATGG + Intergenic
1174035093 20:47663899-47663921 CACCAAGCAGGGCAGGACACAGG - Intronic
1174057706 20:47809948-47809970 GATCAGGAAGAGCAGGAAGCCGG - Intergenic
1174192678 20:48751324-48751346 AGCCAGGGAGGGCAGGAAGCTGG + Intronic
1175539150 20:59737279-59737301 CGCGAGGAAGGACAGGACCCAGG - Intronic
1175834642 20:61985808-61985830 CACCTGGAAGGCCTGGATGCAGG + Intronic
1176015407 20:62928536-62928558 CACCAGGGAGGGCAGCTCCCAGG - Intronic
1177831886 21:26148330-26148352 CACAAGGAGGGGCAGGACTAGGG + Intronic
1178914376 21:36698666-36698688 CACCGGGAGGGCGAGGACGCGGG + Intergenic
1179474400 21:41634096-41634118 CACCATGAGGGGCAAGACCCTGG - Intergenic
1179538566 21:42068425-42068447 CACCTGGATGGGCTGGATGCTGG + Intronic
1179722677 21:43324508-43324530 CACCAGGAGCTGCAGGAGGCAGG - Intergenic
1179889480 21:44328357-44328379 CATCAGGCAGGGCAGGCCGAGGG - Intergenic
1179912605 21:44458174-44458196 CACCCAGAGGGGCAGGAAGCAGG - Exonic
1180150101 21:45943003-45943025 CACCGGGGAGGGCAGGACTCGGG + Intergenic
1180949765 22:19715711-19715733 CAGCAGGCAGGGCAGGAGGGCGG + Intronic
1181372811 22:22431725-22431747 CACCAGGCAGGGCAGGCGGCTGG - Intergenic
1181486094 22:23232577-23232599 CACCTGGAAAGGCAGGACCCTGG + Intronic
1182004596 22:26949371-26949393 CACCAGGAAGGCCAGGCCCCAGG + Intergenic
1183520878 22:38295408-38295430 CACAGGGAAGGGCAGGGGGCTGG + Intronic
1183585096 22:38748790-38748812 CACGCGGGAGGGCAGGACGGGGG + Intronic
1183628514 22:39019316-39019338 CACTAGGAAGGGCTGGGAGCTGG - Exonic
1183642496 22:39101055-39101077 AACCAGGGAAGGCAGGAAGCGGG + Intronic
1183665804 22:39245073-39245095 CGCCAGGAGGGGGGGGACGCGGG + Intergenic
1183828427 22:40405656-40405678 CTCCAGGAACAGCAGGAGGCAGG - Exonic
1184362416 22:44026327-44026349 CAGGAGGAGGAGCAGGACGCCGG + Intronic
1184661000 22:45965463-45965485 CAGCAGGAAGGGGAGGAGGGAGG + Intronic
1184881527 22:47307473-47307495 CAGCAAGAAGGGAAGGAGGCTGG - Intergenic
1185088869 22:48755029-48755051 CACTAGGCAGGGGAGGACGCAGG - Intronic
1185116825 22:48942614-48942636 CAACAGGCAGGGCTGGAGGCTGG - Intergenic
1185354860 22:50362122-50362144 CTCCAGGAAGGGGAGGAGTCGGG + Intronic
1185368103 22:50446176-50446198 CACCAAGAAGGGAAGGACGGGGG + Exonic
950408231 3:12817613-12817635 CAGCAGGAAGGGCAGGAAGTCGG - Exonic
950472228 3:13193444-13193466 CCACAGGAAGGGGAGCACGCTGG + Intergenic
950679193 3:14573404-14573426 CACCAGGTAGTGCAGGATCCTGG + Intergenic
950851843 3:16069716-16069738 CATCAGGCAGGGAAGAACGCAGG + Intergenic
951032152 3:17894974-17894996 CACCATGAAAGGAAGGACACAGG - Intronic
951204452 3:19910530-19910552 CACCCTGAAGGGAAGGACACAGG + Intronic
952729248 3:36621426-36621448 CAACAGCAAGGGAAGGACGGAGG - Intergenic
953408527 3:42673350-42673372 CACCAGGAAGCACAGTACACAGG + Intergenic
954826452 3:53377669-53377691 CAGCAGGAAGGGCCAGGCGCAGG - Intergenic
960914383 3:122681259-122681281 CGCCTGGAAGCGCAGGGCGCCGG - Intronic
960960546 3:123067506-123067528 CAGCCGGTCGGGCAGGACGCCGG + Intronic
961049946 3:123737604-123737626 CACTAGGATTGGCAGGAGGCAGG - Intronic
961137072 3:124521075-124521097 CACAAGGAAGAGCAGGACACTGG - Intronic
961652108 3:128421794-128421816 CACCAGGAAGCCCAGGACCAGGG + Intergenic
963854845 3:150242873-150242895 CACCAGTTAGGGCTGGACTCTGG - Intergenic
968502731 4:958537-958559 GACCAGGGAGGACAGGATGCTGG + Exonic
968516590 4:1018116-1018138 GACGGGGAAGGGCAGGCCGCAGG + Intronic
969575128 4:8032299-8032321 CACGTGGAGGGGCAGGAGGCAGG + Intronic
969663704 4:8545009-8545031 CACCAGGGTCTGCAGGACGCGGG + Intergenic
971231757 4:24805870-24805892 CAGCAGGAAGAGCAGGAAGATGG + Intergenic
974439465 4:61898170-61898192 CACCACGTAGGGCAGAAGGCAGG + Intronic
974749694 4:66121102-66121124 CACAAGGAAGGCCAGCAGGCTGG - Intergenic
975485819 4:74933386-74933408 CTCCCGGAAGGGCAGGTCGCGGG + Intronic
977462812 4:97346456-97346478 CACCAAGAAGGACAGTATGCTGG + Intronic
978116251 4:105023074-105023096 CACCCTGAAGGGAAGGACACAGG + Intergenic
979480337 4:121208980-121209002 CTCCAGGAAGGGGAGGGAGCTGG + Intronic
981020392 4:140021748-140021770 CACCAGGAAGCGGAGGAAGAAGG - Intronic
985209759 4:187580426-187580448 AACCATGAAGGGCCGGGCGCAGG + Intergenic
985572720 5:658343-658365 CAGCAGCAAGGGGAGGAGGCCGG - Intronic
985652172 5:1112300-1112322 CAGCAGGAGGGGCAGGGGGCTGG - Intergenic
986326006 5:6675024-6675046 CACTAGGACAGGCAGGCCGCTGG + Intergenic
987012739 5:13783556-13783578 CACCAGGCAGAGCATGACTCGGG + Intronic
987788379 5:22531947-22531969 CACCAGGCAGGGCTGAAGGCTGG + Intronic
988454959 5:31379273-31379295 CACCCAGAAGGGGAGGACGGGGG + Intergenic
988801436 5:34699751-34699773 CACCAGCAGTGGCAGGACACTGG - Intronic
989681320 5:44032622-44032644 CACCCAGAAGGGAAGGACACAGG + Intergenic
989797898 5:45498604-45498626 CACCAGCAACGGAAGGAAGCTGG - Intronic
989955550 5:50355014-50355036 CACCAGAATGGTCAGGATGCAGG - Intergenic
990507437 5:56458568-56458590 CACAAGCAAGGGCAGGTCTCCGG - Intronic
992669322 5:79043147-79043169 CCCCAGGAAGGGCAAGAAGCTGG - Intronic
993771865 5:91938642-91938664 CACCAGGAAGGCCAGAACTGTGG + Intergenic
994235536 5:97358170-97358192 CACCCTGAAGGGAAGGACACAGG - Intergenic
995500143 5:112795458-112795480 CTCCAGGAAGAGAAGGAGGCTGG - Intronic
996772132 5:127097034-127097056 CAGGTGGAAGGGCAGGATGCAGG + Intergenic
996903054 5:128565888-128565910 AACAAGGAAGGCCAGGAAGCTGG - Intronic
997626016 5:135330981-135331003 GACTGGGAGGGGCAGGACGCTGG + Intronic
998093034 5:139382002-139382024 CAGCAGGAAGGGCACGGCGATGG + Exonic
998307603 5:141095098-141095120 CACCTGGAAAGGTAGGACACAGG - Exonic
999818088 5:155197925-155197947 CATCAGGAGGGTCAGGAGGCAGG - Intergenic
1000463296 5:161547764-161547786 GAGCAGGAAGGGCAGGTGGCCGG + Intronic
1001201249 5:169719124-169719146 GAGCAGGAAGGGCAGAACTCAGG + Intronic
1001431651 5:171667363-171667385 CACAAGGAAGGGCACGCGGCAGG - Intergenic
1004412035 6:15390087-15390109 AACAGGGAAGGGCAGGAGGCAGG - Intronic
1007236810 6:40396370-40396392 GCCCAGGAAGGGCAGGAAGACGG - Intronic
1007401678 6:41606112-41606134 CACCAGACAGGGGAGGACCCCGG + Intergenic
1007412841 6:41674824-41674846 CACTAGGAAGGGGAGGAGGTGGG + Intergenic
1013449757 6:110268525-110268547 CCCCAGGAATGGCAGCAAGCAGG - Intronic
1014544525 6:122717853-122717875 CTTCAGCAAGGGCAGGCCGCCGG + Exonic
1016136805 6:140554487-140554509 CACCCTGAAGGGAAGGACACAGG - Intergenic
1017778361 6:157697151-157697173 TGCCAGGAAGGGCACGAGGCTGG - Intergenic
1018214360 6:161512770-161512792 CACCAGGGAGGCCAGGAGGACGG - Intronic
1018429516 6:163712531-163712553 CTCCCGGAAGAGCTGGACGCTGG - Intergenic
1018812764 6:167309284-167309306 CACTAGGAAGAGAAGGAAGCTGG + Intronic
1018996101 6:168711796-168711818 CACCAGGGAGGGCAGAGCGGAGG + Intergenic
1019168742 6:170116843-170116865 CAGGAGGAAGAGCAGGAGGCTGG + Intergenic
1019277737 7:184692-184714 CCCAGGGAAGGGCAGGACCCTGG + Intergenic
1019354804 7:572887-572909 GAGCAGACAGGGCAGGACGCCGG + Intronic
1019510176 7:1413882-1413904 CACCAGGAAGGACCCCACGCGGG - Intergenic
1019516040 7:1440648-1440670 CTCCAGGAAGGCCAGGAGGACGG - Exonic
1019568166 7:1694983-1695005 CAACAGGGAGGGCAGGGAGCTGG - Intronic
1019646005 7:2129238-2129260 CACCAGGCAGGCCAGGGGGCAGG + Intronic
1019717223 7:2544916-2544938 GGCCAGGAAGCGCAGGGCGCTGG + Exonic
1020134736 7:5580900-5580922 CACCAGCAAGGTCAGCACCCAGG + Intergenic
1021382326 7:19983367-19983389 CACCCTGAAGAGCAGGTCGCAGG - Intergenic
1023791132 7:43754728-43754750 TGCCTGGAAGGGCAGGAAGCTGG - Intergenic
1024415093 7:49096859-49096881 CACCCTGAAGGGAAGGACACAGG + Intergenic
1024571328 7:50725062-50725084 CAGCAGGTAGGGCAGGCAGCAGG - Intronic
1026881232 7:73908049-73908071 CAGCCGGAGGGGCAGGGCGCAGG - Intergenic
1026956705 7:74380873-74380895 CACCAGGCCGGGCGGGACTCTGG + Intronic
1027569146 7:79841320-79841342 CACCAGGAAGAGGAGGATTCAGG - Intergenic
1028464684 7:91137331-91137353 CACCAGGAAGGTCAGGCCGCTGG + Intronic
1029127705 7:98306166-98306188 GACCAGGAGGGGCAGGGCACAGG + Intronic
1029185567 7:98736022-98736044 GAGCAGGGAGGACAGGACGCTGG - Intergenic
1029374805 7:100171260-100171282 GACCTGGACGGGCAGGACGCGGG - Exonic
1029409234 7:100398183-100398205 CACCAGGAAAGGCAGGCAGAGGG - Intronic
1029651561 7:101896286-101896308 CAGCAGGTAGGCCAGGAAGCAGG + Intronic
1034488351 7:151380235-151380257 CAGTAGGAAGGAAAGGACGCAGG - Intronic
1035435619 7:158856934-158856956 CGCGAGGGATGGCAGGACGCCGG + Intronic
1035727861 8:1835612-1835634 CAGCAGGGTGGGAAGGACGCTGG - Intronic
1036209860 8:6833320-6833342 CACCAGGGTGGTCAGGAGGCAGG - Intronic
1037759254 8:21730996-21731018 CACGAGGAAGGGAAGGAGCCCGG - Intronic
1037878543 8:22561414-22561436 CCCCAGGGAGGGGCGGACGCAGG - Intronic
1037883219 8:22582931-22582953 CACCTGGGAGGGTAGGAGGCGGG - Intronic
1037974819 8:23201627-23201649 GACCAGGAGGGGCAGGTTGCAGG + Intronic
1040466808 8:47702922-47702944 CTCAAGGGAGGGCAGGAGGCTGG + Intronic
1040521358 8:48178891-48178913 CAACAGGGAGGGCAGGACACAGG - Intergenic
1042726795 8:71887983-71888005 CACCCTGAAGGGAAGGACACAGG - Intronic
1044330448 8:90913981-90914003 AACCAGCAAGGGCTGGATGCAGG + Intronic
1048553531 8:135455449-135455471 CACCCAGAAGGGCAGGAGTCTGG - Intergenic
1048560750 8:135534716-135534738 CTCCGGGAAGGGCACCACGCAGG - Intronic
1049425870 8:142537642-142537664 CACCAGGATGGGCAGGGGGAGGG - Intronic
1049502337 8:142974175-142974197 CACCAGGCAGGGCAGCCCACAGG + Intergenic
1049559897 8:143304740-143304762 CCCCAGGGAGGCCAGGACCCGGG - Intronic
1049687180 8:143943684-143943706 AAACAGGAAGGGGAGGGCGCAGG + Intronic
1049766604 8:144358119-144358141 CCCGAGGAAGGGCCCGACGCGGG - Exonic
1049804942 8:144534469-144534491 GAACAGGAAGGGCAGGACCTGGG + Intronic
1049858799 8:144883128-144883150 CCCCTGGGAGGGCAGGACTCAGG - Intronic
1049884752 9:19446-19468 CATGAGGAAGGGCAGGAGGAGGG + Intergenic
1052900655 9:33791944-33791966 CAAGAGGAGGGGCAGGAGGCAGG + Intronic
1053378479 9:37628775-37628797 CACCAGGAAGGGAAGGAGGAAGG - Intronic
1055058106 9:72042114-72042136 CTTCAGGAAGGGCAGGACTCAGG - Intergenic
1057041098 9:91847876-91847898 CTCCAGGACGGGAAGGATGCAGG + Intronic
1057305514 9:93910036-93910058 TCACAGGAAGGGCAGGAAGCAGG - Intergenic
1057800907 9:98191257-98191279 CCCCAGGAGGGGCAGGAAGCTGG + Intronic
1059515467 9:114890056-114890078 CACCCTGAAGGGAAGGATGCAGG + Intergenic
1060304134 9:122395049-122395071 GAGCAGGAAGGACAGGAAGCTGG + Exonic
1060547002 9:124467797-124467819 CACCAGGAAGAGCAAGAAGGTGG - Exonic
1061160028 9:128888420-128888442 CCCCAGGAAGGGCTGGGCTCAGG - Intronic
1061486256 9:130922002-130922024 CCCCAGCAGAGGCAGGACGCGGG - Intronic
1061857220 9:133448933-133448955 CACCTGGCAGGGCAGGGCTCTGG - Intronic
1061952785 9:133945603-133945625 CACCAGGAAGGTCAGGGGCCCGG + Intronic
1062025615 9:134338883-134338905 CAGCAGGGAGGGCAGAACGGCGG - Intronic
1062375344 9:136259495-136259517 GACCAGGAAGGGAAGGAAGGAGG + Intergenic
1062502188 9:136856362-136856384 CACCCGGAAGGGCCGGCGGCGGG - Intronic
1062544441 9:137055220-137055242 CACCAGGGAGTGCAGGCTGCTGG + Intergenic
1062722192 9:138050331-138050353 CACCAGCGAGGGCTGGAGGCTGG + Intronic
1185459458 X:328154-328176 CACGTGGAAGGCCAGGACCCTGG - Intergenic
1187039473 X:15578653-15578675 CACCAAGAAGGGCATGACTGAGG + Intronic
1187471295 X:19571444-19571466 CAACAGAAAGGGCAGGATGGAGG + Intronic
1187850225 X:23584268-23584290 CACCAAGAAGGCCAAGATGCTGG + Intergenic
1190726787 X:53195117-53195139 CACCAGGGAGGGAAGGAGGCGGG - Intronic
1191928763 X:66344911-66344933 ACCCAGGAAGGGCAAGAAGCTGG - Intergenic
1192836205 X:74802139-74802161 CACCCTGAAGGGTAGGACACAGG + Intronic
1194920864 X:99761874-99761896 CACCATGAAGGGTAGAACACAGG + Intergenic
1195363695 X:104107771-104107793 CCCCAGAAAGGCCAGGAAGCAGG + Intronic
1195704532 X:107729394-107729416 CAGGCAGAAGGGCAGGACGCTGG + Intronic
1195971428 X:110477853-110477875 CACCCTGAAGGGAAGGACACAGG - Intergenic
1196357211 X:114809063-114809085 CACCCTGAAGGGAAGGACACAGG - Intronic
1197161964 X:123333883-123333905 CACCTGGAATGGCTGGAGGCAGG - Intronic
1198841106 X:140859034-140859056 CACCACGAAGGGAAGGACACAGG + Intergenic
1199191896 X:144980726-144980748 CACCATGAAGGGGAAGACACAGG + Intergenic
1199374162 X:147087953-147087975 CACCCTGAAGGGAAGGACACAGG - Intergenic
1199692630 X:150320302-150320324 CACCAGGTAGGGCAGGAAGGGGG + Intergenic
1199812097 X:151360140-151360162 CAGCAGGAAGGACAGTTCGCTGG - Intergenic
1199817438 X:151411339-151411361 CACCAAGAAGTCCAGGAGGCTGG - Intergenic
1200401056 X:156020706-156020728 CATGAGGAAGGGCAGGAGGAGGG - Intergenic
1201626734 Y:16023453-16023475 CACCAGCAACGGAAGGAAGCTGG - Intergenic