ID: 1125734228

View in Genome Browser
Species Human (GRCh38)
Location 15:41912326-41912348
Sequence GCACCAGGAAGGGCAGGACG CGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 487
Summary {0: 1, 1: 0, 2: 2, 3: 43, 4: 441}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734228_1125734234 -2 Left 1125734228 15:41912326-41912348 CCGCGTCCTGCCCTTCCTGGTGC 0: 1
1: 0
2: 2
3: 43
4: 441
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734228_1125734233 -3 Left 1125734228 15:41912326-41912348 CCGCGTCCTGCCCTTCCTGGTGC 0: 1
1: 0
2: 2
3: 43
4: 441
Right 1125734233 15:41912346-41912368 TGCGCCCTAAACAATAACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 34

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734228 Original CRISPR GCACCAGGAAGGGCAGGACG CGG (reversed) Intronic
900001943 1:19332-19354 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
900021663 1:189855-189877 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
900106687 1:984384-984406 TCCCCAGGAGGGGCAGGACCTGG - Intergenic
900232489 1:1567668-1567690 GCACAAACAAGGGCCGGACGCGG + Intronic
900363884 1:2302701-2302723 TCACCCGGAATGGCAGGACAAGG + Intronic
900479099 1:2889674-2889696 GGACCAGGAAGGGGTGGCCGGGG + Intergenic
900567144 1:3339114-3339136 GCACCCGGAAAGGCGGGACATGG - Intronic
900598768 1:3494226-3494248 GGACGAGGACGGGCAGGAGGGGG - Intronic
900640927 1:3687756-3687778 GCGCCAGGAGAGGCAGGAAGGGG - Intronic
900763023 1:4485695-4485717 GCACAGGGCAGGGCAGGACCAGG - Intergenic
901067499 1:6501271-6501293 GCACCAAGAAGGGCTGGGCTGGG - Intronic
901157580 1:7150719-7150741 GCAGAAGGACGCGCAGGACGTGG + Intronic
901957316 1:12795932-12795954 GCCACAGGAAGGGCAGGGGGTGG - Exonic
901962433 1:12838165-12838187 GCCACAGGAAGGGCAGGGGGTGG + Intergenic
901965335 1:12861715-12861737 GCCACAGGAAGGGCAGGGGGTGG - Exonic
901973714 1:12928189-12928211 GCCACAGGAAGGGCAGGGAGTGG - Intronic
901980728 1:13032066-13032088 GCCACAGGAAGGGCAGGGGGTGG - Exonic
902001362 1:13196865-13196887 GCCACAGGAAGGGCAGGGGGTGG + Exonic
902011464 1:13273578-13273600 GCCACAGGAAGGGCAGGGAGTGG + Intergenic
902020599 1:13342570-13342592 GCCACAGGAAGGGCAGGGGGTGG + Exonic
902227792 1:15007633-15007655 AAACCAGGAAGGGAAGGAAGGGG - Intronic
902450003 1:16490948-16490970 GCATCAGGCAGGGCAGGTGGAGG + Intergenic
902627770 1:17686691-17686713 CCACAAGGAAGGGCAGGAGTGGG + Intronic
903007894 1:20310547-20310569 GACACAGGAAGGGCAGGAAGTGG - Intronic
903383728 1:22913621-22913643 GCACCAGGAGGGCCGGCACGTGG - Exonic
903606080 1:24576149-24576171 GGACCAAGAAAGGCAGGTCGGGG - Intronic
903996854 1:27311139-27311161 GCACCAGGAGAGGCAGAAGGAGG - Intergenic
904400611 1:30254162-30254184 GTTCCAGGAAGGGCAAGATGAGG - Intergenic
904492636 1:30870319-30870341 GCACGAGGCAGGCCAGGACCTGG - Intronic
904821568 1:33248271-33248293 TGACCAGGCAGGGCAGGACATGG - Intergenic
905313532 1:37066634-37066656 TGACCAGGAAGGGCAGGGTGGGG + Intergenic
905793833 1:40804202-40804224 GCAGCAGGAAGGGCAGGGGCAGG + Intronic
905892177 1:41524462-41524484 GCACCAGGCTGGGCAGGCCAGGG + Intronic
906265357 1:44424764-44424786 GCACCAAGAAGGGGAGGTCTGGG - Intronic
906270377 1:44473077-44473099 ACACTAGGCAGGGCAGGAGGAGG + Intronic
906280414 1:44549629-44549651 GCAGGAGGAAGGGGAGGAAGGGG - Intronic
907306879 1:53518156-53518178 GCAGCGGGGAGGGCAGGACCAGG - Intronic
907706317 1:56835618-56835640 GCACCAGAAAGGGGAGGACTAGG + Intergenic
910050856 1:82973029-82973051 GTGCCAGGAAGGGAAGGGCGTGG + Intergenic
910761507 1:90736966-90736988 GCAGCAGGAAAGGCAGGATGTGG + Intergenic
911931664 1:103912348-103912370 GCTCAAGCAAGGGCAAGACGGGG + Intergenic
912496437 1:110094939-110094961 ATCCCAGGAGGGGCAGGACGAGG + Intergenic
913958179 1:143321565-143321587 GCAACAGCAAGGGCAGGAGCAGG + Intergenic
914052494 1:144146940-144146962 GCAACAGCAAGGGCAGGAGCAGG + Intergenic
914126703 1:144819601-144819623 GCAACAGCAAGGGCAGGAGCAGG - Intergenic
914433737 1:147641845-147641867 GCCCCGGGAAGGGCAGGCGGAGG + Intronic
914462878 1:147900985-147901007 ACACCAGAAAGGACAGGAAGGGG + Intergenic
915006752 1:152645361-152645383 GCTCCAGTAAGAGCAGGAAGTGG + Intergenic
915034470 1:152910598-152910620 GCACCAGGAGGGGCAGCTGGAGG + Exonic
915625497 1:157111792-157111814 GGACCAGAGAGGGCAGGAGGAGG + Intergenic
915835276 1:159171453-159171475 GCACCACGAAGGCAAGGAGGGGG + Intergenic
915931540 1:160063377-160063399 GCCCCAGGAAGAGAAGGCCGGGG + Intronic
919780825 1:201219804-201219826 GTCCTAGGAAGGGCAGGACATGG + Intronic
920299941 1:204982530-204982552 GCACCAGGAGGGGCTGGTCTGGG - Intronic
921257728 1:213357385-213357407 GCACCAGGAAGGGTGAGAGGGGG + Intergenic
922021181 1:221706287-221706309 GGAACAGGAAGGGCAAGATGGGG + Exonic
922099307 1:222468825-222468847 TCACCTGGAAGGCCAGGTCGTGG - Intergenic
1062923167 10:1295110-1295132 GTTCCAGGAAGGCCAGGACAAGG + Intronic
1063225564 10:4012241-4012263 GGACCTGGATGGGCAGGACCTGG + Intergenic
1063372906 10:5533344-5533366 GCATCAGGATGGGTAGGAAGTGG - Intergenic
1063580467 10:7301771-7301793 GCACCAGGAAAGGCTGGAATGGG - Intronic
1066733966 10:38455055-38455077 TCACCTGGAAGGCCAGGTCGTGG + Intergenic
1067163827 10:43849028-43849050 GCCCCAGGAAGGGCAAGCCCTGG - Intergenic
1069703327 10:70441637-70441659 GCAGAAGGAAGGGCAGGCAGTGG + Exonic
1069737967 10:70670012-70670034 GCACGAGCATGGGCAGGAGGGGG - Intergenic
1070324320 10:75378078-75378100 GCACCAGGCAGGGGAGGCCGGGG + Intergenic
1070701534 10:78604935-78604957 GCAGCACCAAGGGCAGGATGTGG + Intergenic
1071491840 10:86141442-86141464 GCTCCAGAGAGGGCAGGACTGGG - Intronic
1073056761 10:100708049-100708071 GGAGAAGGAAGGGGAGGACGGGG + Intergenic
1073249890 10:102114854-102114876 GCACCAGGAGAGGCAGGACCCGG + Intronic
1073423147 10:103440467-103440489 GAACCAGAAGGGGCAGGAGGAGG + Exonic
1073467626 10:103703460-103703482 ACACTAGGCAGGGCAGGAGGGGG - Intronic
1076284017 10:129275856-129275878 GCACTGGGAAAGTCAGGACGCGG - Intergenic
1076353809 10:129838162-129838184 GCTGCAGGAGGGGCAGGACTGGG - Intronic
1076672724 10:132131911-132131933 GCAGCAGGCAGGGCAGGATTCGG - Intronic
1077328942 11:1975629-1975651 GCAGCAGGCAGGGCTGGGCGGGG - Intronic
1077496043 11:2886805-2886827 GTACCAGGAAGGGCTGCAGGCGG - Intergenic
1077508657 11:2943836-2943858 GCAGCAGGAAGGGCAGGTGCAGG - Intergenic
1077609522 11:3635878-3635900 GGACCAGGAAGGGGTGGGCGAGG - Intergenic
1078042822 11:7884223-7884245 GCACCATGAATGGCAGCAGGAGG - Intergenic
1080600752 11:33819079-33819101 GCACCAGGAGGTGCAGGGGGTGG - Intergenic
1080852004 11:36078302-36078324 GCACCATGAAAGGCAGCAGGAGG - Intronic
1081851458 11:46277833-46277855 GCCCCAGGAGGAGCAGGAGGAGG + Exonic
1082678327 11:56137619-56137641 GCACTAGGAAGACCAGGAAGAGG + Exonic
1082683701 11:56211721-56211743 GCACCAGGAAGACCAGGAAGAGG + Intergenic
1082695582 11:56360324-56360346 GCACCAGAAAGACCAGGAAGAGG - Exonic
1083581918 11:63830487-63830509 GCAGCTGGGAGGGCAGGAGGTGG - Intergenic
1083595919 11:63918216-63918238 GGACCAGGAAGGGAAGGGAGAGG - Intergenic
1083767780 11:64850113-64850135 GCACCAGGTCTGGCAGCACGTGG - Intergenic
1083911595 11:65713126-65713148 GCTCCTGGATGGGCAGGAGGCGG + Intronic
1084005074 11:66318167-66318189 CCTCCAGGAAGGGCGGGAAGAGG - Intergenic
1084106997 11:66986698-66986720 GGACCAGGAAGGGCCTGGCGTGG + Intergenic
1084315240 11:68341983-68342005 GCACCAGGAGGGGCTGGCCATGG - Intronic
1084704293 11:70806867-70806889 GCCCCTGGAAGGGCAGGAATGGG - Intronic
1084733501 11:71089653-71089675 GCACCCGGAATGGCTGGAAGTGG + Intronic
1085308087 11:75499777-75499799 GGCCTAGGAAGGTCAGGACGTGG - Intronic
1087088685 11:94245820-94245842 GCACCAGGGAGGTAAGGAGGTGG + Intergenic
1088366318 11:109043889-109043911 GCCACAGGAAAGGCAGGAGGTGG + Intergenic
1088701427 11:112416106-112416128 GGACCAGGAAGGGGAAGAAGAGG + Intergenic
1088891638 11:114049334-114049356 GAATCAGGAAGGGCAGGTGGTGG - Intergenic
1089214716 11:116828876-116828898 GCAGCAGGGATGGCAGGATGAGG - Intergenic
1089686007 11:120147235-120147257 GCTCTAGGAAGGGCTGGGCGGGG + Intronic
1089768543 11:120786047-120786069 GCACAAGGCAGGGGAGGACTTGG - Intronic
1090367307 11:126217627-126217649 GCAACAGTAAAGGCAGGAGGAGG - Intronic
1202811921 11_KI270721v1_random:30808-30830 GCAGCAGGCAGGGCTGGGCGGGG - Intergenic
1092088001 12:5780770-5780792 TTACAAGGAAGGGCAGGCCGTGG + Intronic
1092429288 12:8396485-8396507 GCCCCAGGACGGCGAGGACGGGG - Intergenic
1095960326 12:47830416-47830438 GCACTGGGAAGGGCAGGAGAAGG - Intronic
1095975453 12:47938101-47938123 CCTCCAGGAAGGCCAGGACCTGG - Intronic
1096243832 12:49973592-49973614 GCACCTGGAGGGCCAGGAGGCGG + Intronic
1097284311 12:57865601-57865623 GCTGCAGGAAGGGCAGGCTGGGG - Intergenic
1097496044 12:60336038-60336060 GCACCAGGAAGAGCAGTTGGAGG + Intergenic
1099113969 12:78600673-78600695 GCACCAGCAAGAGCAGCAGGAGG + Intergenic
1099734230 12:86547315-86547337 GCAAAAGGAAGAGCAGGAAGAGG - Intronic
1100844448 12:98644741-98644763 TCACCAGGGGGAGCAGGACGTGG + Exonic
1102470807 12:113158889-113158911 GCTCCAAGAAGGGCAAGATGCGG - Exonic
1103113491 12:118304000-118304022 GCAAAAGGAAGGGCAAGACCAGG - Intronic
1103344311 12:120239108-120239130 GCACCAGGAAGGGCAGTAGTGGG - Intronic
1104645428 12:130494202-130494224 GCTCCAGGAGGGCCAGGGCGGGG - Intronic
1107559863 13:41549438-41549460 GCGCCAAGAAGGGCAGTACAGGG + Intergenic
1108493569 13:51003861-51003883 GCACCAGATAGTGCAGGAAGAGG + Intergenic
1109633742 13:65085971-65085993 GCACCATGAATGGCAGTAGGAGG - Intergenic
1111002647 13:82205537-82205559 GCACCATGAATGGCAGCAGGAGG + Intergenic
1111362791 13:87197092-87197114 GGAGGAGGAAGGGCAGGAGGAGG + Intergenic
1112380727 13:98886820-98886842 TGACCTGGAAGGGCAGGAAGGGG - Intronic
1113294019 13:108938401-108938423 GAGCCAGGAAGGGCTGGACTGGG + Intronic
1113381492 13:109810005-109810027 TTACCAGGAAGGACAGGAGGAGG + Intergenic
1113892549 13:113744012-113744034 GCTCCAGGAGGGGCAGGCCCAGG - Intergenic
1114055566 14:18964907-18964929 GCACCAGGAAGGACAGTCTGGGG - Intergenic
1114106980 14:19436856-19436878 GCACCAGGAAGGACAGTCTGGGG + Intergenic
1114186093 14:20403663-20403685 TCTCCAGGAAGGGCAGGACAAGG - Intronic
1114961247 14:27892680-27892702 GAACCAGGTGGGGCAGGGCGTGG - Intergenic
1115979218 14:39030657-39030679 GTGCCAGGAAGGGAAGGGCGTGG - Intergenic
1117014891 14:51508189-51508211 GCAACAGGCAGGGCCGGATGGGG - Intronic
1117419895 14:55534057-55534079 GCAGCAGGAAAGGGAGGCCGTGG + Intergenic
1118213685 14:63788437-63788459 GCACCCGGGAGGGCAGGGCAGGG + Intergenic
1118923053 14:70167495-70167517 GCCCCTGGAAGGGAAGGAAGTGG - Exonic
1121013576 14:90535329-90535351 GGACCAGGAAGGGAAGGAGGAGG - Exonic
1121496638 14:94396340-94396362 TTACCAGGGAGGGCAGGACAAGG + Intergenic
1122719206 14:103712769-103712791 GCACCGGGAAGGCCAGCACGTGG + Intronic
1122977044 14:105175013-105175035 GCATCGGGAAGAGCAGGCCGTGG - Intronic
1124355643 15:28993016-28993038 GCCCCTGGAGGGGCAGGAAGAGG + Intronic
1125734228 15:41912326-41912348 GCACCAGGAAGGGCAGGACGCGG - Intronic
1125887678 15:43240772-43240794 GCAGGAGGAAGGGCAGAACGAGG - Intronic
1125903773 15:43371456-43371478 GAACCAGGGAGCGCAGGAGGGGG + Intronic
1126096070 15:45091556-45091578 GCCCCAGGAAGGGTAGGACCAGG + Intergenic
1126406652 15:48329571-48329593 ACACCATGAAGGGCAGGGTGCGG + Intergenic
1128237230 15:66076696-66076718 GCACCAGGAAAGGCAGAGGGAGG + Intronic
1128669780 15:69566420-69566442 ATTCAAGGAAGGGCAGGACGGGG + Intergenic
1128692592 15:69736434-69736456 GCAGAAGGAAGGGCAGGAGGTGG + Intergenic
1128760257 15:70212014-70212036 GCAGCAGGGAGCGCAGGACTGGG - Intergenic
1128793317 15:70448680-70448702 GCACCAGGGTGGGCAGGACTTGG - Intergenic
1128965246 15:72051827-72051849 GCACCATGAACAGCAGGAGGAGG + Intronic
1129450818 15:75650203-75650225 GCACCAGGACTTGCAGGACGTGG + Exonic
1129704833 15:77788173-77788195 GGCCCAGGCAGGGCAGGGCGGGG - Intronic
1129858286 15:78840779-78840801 GCAGAAGGAAGAGCAGGAAGTGG - Intronic
1130285626 15:82552076-82552098 GGCACAGGAAGGGCAGGACCAGG + Intronic
1130381730 15:83377853-83377875 GCAGCAGGAATGGCAGGTGGTGG - Intergenic
1131038946 15:89244406-89244428 GAACCCGGAAGGGAAGGCCGCGG + Intronic
1132142483 15:99407181-99407203 GCACCATGATGGGCACGAGGTGG - Intergenic
1132451567 15:101971607-101971629 TCATGAGGAAGGGCAGGAGGAGG - Intergenic
1132455323 16:19021-19043 TCATGAGGAAGGGCAGGAGGAGG + Exonic
1132648484 16:1009938-1009960 ACACCAGGAGGGGCTGGGCGTGG + Intergenic
1132658824 16:1052656-1052678 GCAGCAGGGAGGGCAGGGCAGGG + Intergenic
1132731119 16:1362489-1362511 GGACCAGGTAGAGCAGGACCTGG + Exonic
1132903428 16:2270571-2270593 GCTCCTGGAAGGGCAGGGTGGGG - Intergenic
1132989712 16:2786505-2786527 GCACCAGAAGGAGCAGGACCTGG + Exonic
1133147314 16:3798681-3798703 GCAACAGGGTGGCCAGGACGTGG + Intronic
1133175413 16:4010695-4010717 GCTCCAGGAAGCACAGGAGGGGG + Intronic
1133915599 16:10106793-10106815 GCAACAGGTAGAGCAGGACATGG + Intronic
1134131113 16:11650904-11650926 GCCCCAGGCAGGTCAGGAGGAGG - Intergenic
1136479627 16:30533443-30533465 GCACCAAGAAAGGCAGAACCAGG + Intronic
1136483405 16:30556402-30556424 GCACCAAGAAAGGCAGAACCAGG + Intronic
1136749149 16:32617115-32617137 ACACCAGGAAGGGCTTGATGTGG + Intergenic
1138459538 16:57140023-57140045 GGAACAGGAAGCGCAGGGCGTGG + Intronic
1138496584 16:57412700-57412722 GCTCCAGGCAGGGCAGCACCTGG - Intronic
1139750710 16:69107394-69107416 GTACCAGGAAGAGCAGGGCCTGG + Intronic
1139953858 16:70684360-70684382 GCACCATGAGGGGCAGGGGGTGG + Intronic
1140492094 16:75346291-75346313 GCACCAGGTAGGGCTGGGCATGG + Intronic
1140526289 16:75625680-75625702 GCACCAGGTGAGGCAGGAAGGGG - Intergenic
1140905637 16:79406829-79406851 GTCCCAGGAAGGGCAGGAAGCGG - Intergenic
1141167813 16:81671999-81672021 CCACCAGGTTGGGCAGGACCCGG - Exonic
1141656831 16:85421156-85421178 GAAACAGGAAGGGCAGGGCTGGG + Intergenic
1142196694 16:88742366-88742388 CCACCAGGAAGAGCAGGCTGAGG + Exonic
1142206482 16:88785348-88785370 GCACCAGGGCGGGCCGGAGGCGG - Intergenic
1142222119 16:88860675-88860697 GCCCCAGGAAGGGGTGGAGGAGG - Intronic
1142233116 16:88909056-88909078 GCCCCAGGCAGGGGAGGAGGAGG + Intronic
1142395644 16:89829692-89829714 GCTCCAGGATGAGCAGGACCTGG - Intronic
1203051282 16_KI270728v1_random:876329-876351 ACACCAGGAAGGGCTTGATGTGG + Intergenic
1142562062 17:816048-816070 CCATCAGGAGGGGCAGGACACGG + Intronic
1142715869 17:1746715-1746737 TCACCAGGAGGGGCCGGGCGCGG - Intronic
1143684808 17:8505054-8505076 GCACCTGCTAGGGCAGGAGGAGG + Intronic
1143785871 17:9255194-9255216 GCCCCAGGAAAGGCATGACAGGG + Intronic
1144708355 17:17384574-17384596 TCACCAGGAAGGCCAGGCCCTGG + Intergenic
1144739110 17:17571406-17571428 GAACAAGGAAGAGCAGGAGGAGG + Intronic
1144765460 17:17730214-17730236 GCCCTGGGAAGGGCAGGAAGGGG - Intronic
1145817237 17:27804363-27804385 GCACCTTGAAGGGCAGGCGGGGG + Intronic
1146662591 17:34674515-34674537 GCATCAGGAAGGGGAGGGGGAGG - Intergenic
1147450620 17:40501763-40501785 GCAGCAGGAAGGGAAGCACTGGG + Intergenic
1148443699 17:47725381-47725403 ACAACAGGAAGGCCAGGAGGTGG + Intergenic
1148470799 17:47892057-47892079 GCAGCAGGTAGGGTAGGAAGAGG + Intergenic
1148849505 17:50547931-50547953 GCTCCAGGAAGGGCCGGGGGAGG + Intronic
1149691611 17:58581883-58581905 CCACCAGGAAGGGAAGGCAGAGG - Intronic
1150003425 17:61455729-61455751 GCACCAGGTAGGGGAGGCCTGGG + Intronic
1150191074 17:63239906-63239928 GCAGGAGGAAGAGCAGGAGGAGG + Intronic
1150223342 17:63509401-63509423 TCTTCAGGAAGGGCAGGACCGGG - Intronic
1151166616 17:72209372-72209394 TACCCAGGAAGGGAAGGACGTGG + Intergenic
1151414608 17:73953012-73953034 GCAGCAGGAACGGAAGGGCGGGG - Intergenic
1151894299 17:76969672-76969694 GCACCAGGAAGGGCTGGAACGGG - Intergenic
1152219359 17:79053521-79053543 GCCCTAGGAAGGGCAGGATATGG - Intergenic
1152244032 17:79176024-79176046 ACCCCAGGAAGGGCAGGACAGGG + Intronic
1152584837 17:81184300-81184322 GCATCAGGAGGGGCAGGACCTGG - Intergenic
1152630425 17:81408458-81408480 GCCCCAGGAGGGGCAGGGCACGG - Intronic
1153791675 18:8584762-8584784 GCAGCAGGAGGAGCAGGAAGTGG + Intergenic
1154300139 18:13185162-13185184 GCTCCAGGAAGCGCAGGCCTGGG - Intergenic
1156473096 18:37389678-37389700 GCTGCAGGGAGGGCAGGATGCGG - Intronic
1156570288 18:38244763-38244785 GCAGCAGGCAGGGCAGGACCAGG + Intergenic
1157111503 18:44824789-44824811 GCAATAGGAAGGGAAGGAAGTGG + Intronic
1157166545 18:45363036-45363058 GCACAGGGAAGGGCAGGCAGGGG - Intronic
1157317122 18:46601526-46601548 TAACCAGGAAGGGGAGGAGGGGG - Intronic
1157578284 18:48758437-48758459 GCACCAGGGAGGACAGCAAGAGG + Intronic
1160004499 18:75059908-75059930 GCACCAGGCGGGGATGGACGCGG + Intronic
1160633695 19:60940-60962 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
1160698158 19:494477-494499 GCACCAGCCTGGGCAGGAGGGGG + Intronic
1160729025 19:632362-632384 CCACCAGCCAGGCCAGGACGAGG + Intronic
1160731514 19:643577-643599 AGACCAGGACGGGCAGGAAGTGG - Exonic
1160790418 19:920382-920404 GCACCAGGAACAGCTGGATGGGG - Exonic
1160970368 19:1765231-1765253 GCACCAGGACGGGAGGGATGTGG - Intronic
1160972054 19:1773883-1773905 GGAGCAGGAAGAGCAGGACTCGG + Intronic
1161424965 19:4198336-4198358 GCACCAGGGAGGGCGGGACCGGG + Intronic
1161571842 19:5035181-5035203 GCACCAGGGAGAGGAGGAAGAGG - Intronic
1162134697 19:8548193-8548215 GCCCCAGGGAGGACAGGATGTGG + Intronic
1162461302 19:10815836-10815858 GCCCCAGGATAGGCAGGACTGGG + Intronic
1163475522 19:17523774-17523796 GCTCCAGGAACAGCAGGAAGTGG - Intronic
1163717429 19:18880179-18880201 GGACCAGGCAGGGAAGGAGGCGG - Intronic
1164593525 19:29519252-29519274 GAACCAGGAAGGGTGGGGCGAGG + Intergenic
1165373742 19:35426853-35426875 GAAGCAGGATGGGCAGGAGGGGG - Intergenic
1165398702 19:35583645-35583667 GAGCCAGGAAAGGCAGGACTAGG - Intergenic
1165771985 19:38385497-38385519 GCACCTGGAAGGGCAGCCAGTGG + Exonic
1166150039 19:40866122-40866144 GCACCAGGAATCTCAGGACTTGG + Intronic
1166235458 19:41452634-41452656 GGAGCAGGAAGGGCAGGGCATGG - Intergenic
1166885203 19:45956273-45956295 GCCCCAGGAAGAGCTGGCCGAGG + Intronic
1167285352 19:48596131-48596153 GATCCAGGAAGGGGAGGATGAGG + Intronic
1167571097 19:50289711-50289733 GCAGCAAGAAGGGCAGCAAGGGG + Intronic
1167576713 19:50321134-50321156 GTGCCAGGAAGGGTAGGACTGGG + Intronic
1167631489 19:50628900-50628922 GCACCAGGAAGTGGAGGTTGTGG - Intronic
1202691892 1_KI270712v1_random:99364-99386 GCAACAGCAAGGGCAGGAGCAGG + Intergenic
925261143 2:2529670-2529692 GGACCAAGAAGGGCAGGCCATGG + Intergenic
926434140 2:12821498-12821520 GAAGGAGGAAGGGCAGGAGGTGG - Intergenic
927087656 2:19687543-19687565 GCAAAAGGAAGGGCAGGAGCTGG + Intergenic
927247828 2:20972067-20972089 CAGCCAGGAAGGGCAGGACATGG - Intergenic
927533888 2:23837030-23837052 GCACCATGAATGGCAGCAGGAGG - Intronic
927695489 2:25236876-25236898 GGAGAAGGAAGGGCAGGATGAGG - Intronic
928115859 2:28544811-28544833 GCAGCAGCAAGGGCAGGAAGAGG + Intronic
928174910 2:29027005-29027027 ACACCAGGTAGGGCAGGGCCAGG + Exonic
928210478 2:29320093-29320115 ACACCAGGCTGGGCAGGATGTGG - Intronic
931500031 2:62855425-62855447 GCACCATGAATGGCAGCAGGAGG + Intronic
932015685 2:68024125-68024147 CCACCAGAAAGCGCAGGACCTGG + Intergenic
932278705 2:70471411-70471433 GCTCCAGGAGGGGCAGCACTGGG + Intronic
933315256 2:80707098-80707120 GCACAGGGAAGGGCAGGCTGTGG - Intergenic
933714348 2:85349349-85349371 GGACCCAGAAGGGCAGGGCGGGG + Intronic
934132028 2:88957377-88957399 GCAGTAGGAAGGGCAAGGCGAGG + Intergenic
935153942 2:100465709-100465731 GCACCAGGGTGGTCAGGAGGTGG + Intergenic
935281524 2:101521964-101521986 GCACCAGGAAAGCCAGGAGCAGG + Intergenic
935570964 2:104659677-104659699 GCCCCAGGAAGCCCAGGTCGAGG + Intergenic
936479210 2:112869329-112869351 GCACCAGGAAGGAAAGGGAGAGG - Intergenic
936567779 2:113594073-113594095 TCATGAGGAAGGGCAGGAGGAGG - Intergenic
937413432 2:121696241-121696263 GCACAGGGGAGGGCAGGATGGGG + Intergenic
938068146 2:128292797-128292819 GCAGCAGGAAGGGCAGGCAGGGG + Intronic
941630465 2:167878751-167878773 GGAGCAGGAAGGACAGGATGAGG + Intergenic
942074296 2:172342492-172342514 GCAGGAGGAAGAGCAGGAGGAGG - Intergenic
943023514 2:182602052-182602074 GCACCATGAATGGCAGCAGGAGG - Intergenic
943700803 2:190986447-190986469 CCACCAGGAAGGGGAACACGGGG + Intronic
946156093 2:217807811-217807833 GCAGCAGGGATGGCAGGAAGTGG - Intronic
946420811 2:219563493-219563515 GTACAAGGACGGGCAGGAGGTGG - Exonic
947628701 2:231637645-231637667 GCTCCAGGGAGGGAAGGAAGTGG + Intergenic
948514781 2:238497262-238497284 GTGCCAGGAAGGGAAGCACGTGG - Intergenic
948658203 2:239489928-239489950 GCCCCAGGCAGGGCAGCACAGGG - Intergenic
948946600 2:241223682-241223704 GCACCAGGAGGTCCAGGAGGCGG - Exonic
949021821 2:241745038-241745060 CCACCAGGAAGGCCAGGTCCTGG - Intronic
1168799206 20:633702-633724 GCCCCAAGAAGGGCAGGAATTGG - Intergenic
1168863009 20:1059663-1059685 GCCCCAGGAAGGGCATGGCCTGG + Intergenic
1169191626 20:3661892-3661914 GCATCAGGAAGGGCTGGAGAGGG - Intronic
1169250844 20:4060278-4060300 GCAGCAGGAGGGGCGGGGCGAGG - Intergenic
1171099073 20:22365442-22365464 GGATGAGGAAGGGCAGGAGGCGG - Intergenic
1171273403 20:23834373-23834395 GCACCAGGGAGGGCAGGGACAGG - Intergenic
1171978557 20:31610842-31610864 GCACCAGCCAGGGCAGGTCCAGG - Intergenic
1172167611 20:32908497-32908519 GTCCCAGGAGGGACAGGACGTGG - Intronic
1172304945 20:33874145-33874167 GCAGCTGGAAGCCCAGGACGTGG + Intergenic
1172447419 20:35000488-35000510 GGAGCAGGCAGGGCGGGACGAGG + Exonic
1172457944 20:35092581-35092603 GGACCAGGAGGGGCGGGGCGGGG - Intronic
1173801421 20:45896921-45896943 GCCCCAGGAAGACCAGGTCGGGG - Intronic
1174037838 20:47679058-47679080 GGGACAGGAAGGGCAGGAGGGGG - Intronic
1174047507 20:47743995-47744017 GCACCAGGAAGAGCAGCAAAAGG - Intronic
1174180665 20:48672416-48672438 GCAGCAGGGAGGGCAGTAGGAGG - Intronic
1175924045 20:62463303-62463325 CCAGCAGGCAGGGCAGGACTTGG + Intergenic
1176408371 21:6434189-6434211 GCACCATGAATGGCAGCAGGAGG + Intergenic
1176719402 21:10380883-10380905 GCACAACGAAGGGCCGGGCGAGG - Intergenic
1176857764 21:13985536-13985558 GCACAGGCAAGGGCAGGACCTGG - Intergenic
1177831885 21:26148329-26148351 ACACAAGGAGGGGCAGGACTAGG + Intronic
1179889481 21:44328358-44328380 TCATCAGGCAGGGCAGGCCGAGG - Intergenic
1180059026 21:45375293-45375315 GCACCATGCAGAGCAGGATGTGG + Intergenic
1180078489 21:45475340-45475362 GCACCAGAGAGGGCTGGACGAGG + Intronic
1180143619 21:45907834-45907856 GGAGCTGGAAGGGAAGGACGGGG + Intronic
1180150100 21:45943002-45943024 GCACCGGGGAGGGCAGGACTCGG + Intergenic
1180474043 22:15687459-15687481 GCACCAGGAAGGACAGTCTGGGG - Intergenic
1180667887 22:17529219-17529241 GCAGCAGGAAGTCCAGGGCGAGG + Intronic
1180982566 22:19885682-19885704 GCACCAGGAAGTGCTGGGCCTGG - Intronic
1181033797 22:20160448-20160470 GCACCAGGAAGGGAGGGGCAGGG - Intergenic
1181125322 22:20698574-20698596 GCACCAGCAGGAGCAGGAGGTGG + Intergenic
1182237229 22:28884601-28884623 GCAGCAGGCAGGGGAGGAGGCGG + Intronic
1182576899 22:31278950-31278972 GCTCCAGGAAGGACAGGATCTGG - Intronic
1183585095 22:38748789-38748811 CCACGCGGGAGGGCAGGACGGGG + Intronic
1183665803 22:39245072-39245094 GCGCCAGGAGGGGGGGGACGCGG + Intergenic
1183673012 22:39283833-39283855 GCCCCAGGCAGGGCAGGGCAGGG + Intergenic
1184043603 22:41958570-41958592 GCCCCAGGCAGGGCAGGAGGTGG + Intergenic
1184109980 22:42388909-42388931 GCACAAGGCAGGGCAGGACTTGG - Intronic
1184280830 22:43436542-43436564 GCTGCAGGAAGTGCAGGCCGGGG + Intronic
1184894816 22:47400780-47400802 GCAGCTGTAAAGGCAGGACGTGG - Intergenic
1185354859 22:50362121-50362143 GCTCCAGGAAGGGGAGGAGTCGG + Intronic
1185368102 22:50446175-50446197 ACACCAAGAAGGGAAGGACGGGG + Exonic
950833008 3:15893806-15893828 TCACCAGCCAGGGCAGGACAGGG - Intergenic
952258337 3:31714652-31714674 AAAACAGGAAAGGCAGGACGCGG - Intronic
952557776 3:34552935-34552957 GAAGGAGGAAGGGCAGGAGGAGG - Intergenic
953484936 3:43286470-43286492 GCCGCGGGAAGGGCAGGGCGGGG - Intergenic
954004589 3:47580632-47580654 GCCTCAGGAAGGGAAGGAGGAGG - Exonic
954420858 3:50418403-50418425 GCACAAGCAAAGGCAGGAAGGGG - Intronic
954751827 3:52818194-52818216 GGAGCAGGAAGGGCAGGCTGGGG + Exonic
956491116 3:69773251-69773273 GTTCCAGGAATGGCAGGAGGTGG + Intronic
960926792 3:122802214-122802236 GCGACAGGCAGGGCAGGACAGGG + Intronic
961184365 3:124901800-124901822 GCACCTGGGAGCGCAGGGCGTGG + Intergenic
961327016 3:126114874-126114896 GCAGCAGGAAGGGCAGTCCAGGG - Intronic
961387483 3:126530595-126530617 ACACCAGGCAGGGCAGGGCCAGG - Intronic
961450200 3:126999204-126999226 GCCCCAGGAAGGGCTGCCCGAGG - Intronic
961652107 3:128421793-128421815 GCACCAGGAAGCCCAGGACCAGG + Intergenic
962105272 3:132383033-132383055 GCACCATGAATGGCAGCAGGAGG - Intergenic
962121466 3:132565149-132565171 ACACCAGCAAAGGCAGGATGGGG + Intronic
962979109 3:140471791-140471813 GCAACTGGAAGTGCAGCACGAGG - Intronic
963793142 3:149604714-149604736 TCAGCAGGAAGGGCAGCACACGG - Intronic
965743085 3:171897246-171897268 GCCCCAGGGAGAGCAGGCCGAGG - Intronic
966902894 3:184499848-184499870 GCACCAGGGAGACCAGGAAGGGG + Intronic
967937004 3:194737007-194737029 GCAGCAGAAAAGGCAGGAGGAGG - Intergenic
968539287 4:1155132-1155154 GTAGGAGGAAGGGCAGGTCGTGG - Intergenic
968578423 4:1378604-1378626 GCACCTGGACGGGGAGGAAGCGG + Intronic
968917518 4:3503054-3503076 GCACCAGGAGGGGCAGCACGAGG - Intergenic
969196301 4:5566429-5566451 GCCTCAGGAAGGGCAGGGCCAGG - Intronic
969244761 4:5925050-5925072 GCACCAGGTAGGAGAGGACCAGG + Intronic
969346814 4:6575285-6575307 GCACCACGAAGGCCCGGATGGGG - Exonic
969457566 4:7308822-7308844 GCACAAGGAAGAGCAGAAAGAGG - Intronic
969474998 4:7417304-7417326 GCTCCAAGAAAGGCAGGACTTGG - Intronic
969663703 4:8545008-8545030 GCACCAGGGTCTGCAGGACGCGG + Intergenic
970328787 4:14957195-14957217 GCACCAGGAACTGGAGGACAAGG - Intergenic
970824549 4:20254781-20254803 TCAGCAGGAAGGGCCGGAGGGGG - Intronic
973988048 4:56374994-56375016 GCTCCAGAAAGGGAAGGACTAGG - Intronic
975172332 4:71246433-71246455 GCACCTGGAAGAACAGGAAGTGG + Intronic
975485818 4:74933385-74933407 CCTCCCGGAAGGGCAGGTCGCGG + Intronic
975658816 4:76668071-76668093 GCACCAGGAGCTGCAGGAGGAGG - Intronic
975928767 4:79492313-79492335 GCAACAGGAAGGGAAGGGTGAGG - Intergenic
978902530 4:113969909-113969931 GGACCAGCAAGGGAAGGAAGAGG + Intronic
979260318 4:118638044-118638066 TCACCTGGAAGGCCAGGTCGTGG + Intergenic
980712479 4:136588814-136588836 GGAGCAGGAAGGGCAGGAGAAGG + Intergenic
980738249 4:136918117-136918139 GCACCAGGAATGGCAGCAGGAGG + Intergenic
983941388 4:173537798-173537820 GCACCAGGAAGGCCAGGCTGGGG - Intergenic
987410981 5:17614860-17614882 GCGCTTGGAAGCGCAGGACGAGG + Intergenic
988454958 5:31379272-31379294 ACACCCAGAAGGGGAGGACGGGG + Intergenic
991435953 5:66596994-66597016 GTCCCAGGAGGAGCAGGACGAGG + Exonic
992894630 5:81235460-81235482 GCAGGTGGAAGGGCAGGAGGAGG - Intronic
997143209 5:131405475-131405497 GTTCCAGGAAGGACAGGACGGGG + Intergenic
997560548 5:134842780-134842802 GCTCCAGGAAGGGTTGGAAGTGG - Intronic
999256410 5:150212084-150212106 GGGCCAGGGAGGGCAGGACAGGG - Intronic
1000812153 5:165876736-165876758 GAACCAGGAAGGGCAGCCAGAGG + Intergenic
1001316092 5:170642151-170642173 GCACCCGCTAGGGCAGCACGCGG + Intronic
1002329150 5:178429621-178429643 TCACCAGGAAGACCAGGAAGCGG - Intronic
1002528461 5:179828987-179829009 GTACCAGGAAAGGCAAGAGGTGG + Intronic
1002534842 5:179870414-179870436 GCTCCAGGTAGGGCAGGCTGGGG + Exonic
1002792244 6:445143-445165 GTGCCAGGGAGGGCAGGGCGTGG + Intergenic
1003895902 6:10607356-10607378 GCAGGAGGAAGAGCAGAACGGGG + Intronic
1004304453 6:14487555-14487577 GCACCATGGAGGGCAGCAGGAGG + Intergenic
1006193729 6:32224334-32224356 GCCCCAGGAGGGGCAGGACCTGG + Intergenic
1007072640 6:39048577-39048599 GAATCAGGAAGCGCAGGAGGCGG - Intergenic
1007412840 6:41674823-41674845 ACACTAGGAAGGGGAGGAGGTGG + Intergenic
1008521139 6:52362785-52362807 GCCCGAGGAAGGGCAGCCCGAGG + Intronic
1009393988 6:63176058-63176080 GCAACAGGAAAGGCAGGATTAGG - Intergenic
1011378730 6:86719592-86719614 GGACCATGAAGTGCAGGATGAGG - Intergenic
1012889904 6:104885884-104885906 GCACCATGAACGGCAGCAGGAGG + Intergenic
1013189564 6:107790705-107790727 GCATCAGGAATGGCCAGACGAGG + Intronic
1013797309 6:113902096-113902118 GCACCAGGAAGGCAACAACGTGG + Intergenic
1013849706 6:114498934-114498956 GCACCAGGAAAGGGAGGACTTGG + Intergenic
1014289255 6:119539596-119539618 GCACCATGAATGGCAGCAGGAGG + Intergenic
1015143266 6:129958763-129958785 GCACCATGAAGAGCAGCAGGAGG + Intergenic
1015496921 6:133891792-133891814 GCACCTCCAAGGTCAGGACGCGG - Exonic
1016895689 6:149050100-149050122 ACACCATTAAGGGCAGGACTTGG + Intronic
1016930322 6:149400297-149400319 GCAGCAGGAAGAGCAGCAGGAGG - Exonic
1017011340 6:150065777-150065799 CCAGCAGCAAGGGCAGGACTTGG - Intronic
1017420548 6:154268116-154268138 GCACCATGAACGGCAGCAGGAGG - Intronic
1018090210 6:160340193-160340215 GCAGCAGGAAGGGCTGGCTGTGG + Intergenic
1018906674 6:168079759-168079781 GCAGCTGGAAGGCCAGGAAGGGG + Intronic
1018953641 6:168394069-168394091 GCAGCAGGAGGGGCAGGGGGAGG - Intergenic
1019510177 7:1413883-1413905 GCACCAGGAAGGACCCCACGCGG - Intergenic
1020777189 7:12470094-12470116 AAACCAGTAAGGGCCGGACGTGG + Intergenic
1021359845 7:19698462-19698484 GCACCAGGAAGTTCAGGACCAGG - Exonic
1021500800 7:21330134-21330156 GCACCAGGAAGGGTGGCAGGAGG - Intergenic
1022172452 7:27843046-27843068 GCCCCAGGCAGGGCAGGAAGGGG + Intronic
1023224610 7:37956116-37956138 GGAGCAGGAAGGGGAGGAGGAGG + Intronic
1023402036 7:39797644-39797666 TCACCTGGAAGGCCAGGTCGTGG + Intergenic
1024141535 7:46467416-46467438 TCACCAGCACAGGCAGGACGGGG + Intergenic
1024647586 7:51383015-51383037 TCACCTGGAAGGCCAGGTCGTGG - Intergenic
1025050745 7:55732048-55732070 GCACCAGGAGCGGCAGAAGGAGG - Intergenic
1025695020 7:63770327-63770349 TCACCTGGAAGGCCAGGTCGTGG + Intergenic
1026243453 7:68597399-68597421 GCCCAAGGGAGGGCAGGATGTGG + Intergenic
1029374806 7:100171261-100171283 CGACCTGGACGGGCAGGACGCGG - Exonic
1029409235 7:100398184-100398206 ACACCAGGAAAGGCAGGCAGAGG - Intronic
1029899275 7:104022370-104022392 GCACCATGAATGGCAGCAGGAGG + Intergenic
1030304090 7:108002369-108002391 GCACCAGAAACAGCAGGACCTGG - Intronic
1032052547 7:128658037-128658059 TCACCTGGAAGGCCAGGTCGTGG + Intergenic
1033637580 7:143226371-143226393 GGCCCAGGAAGGGCAGGCCTGGG + Intergenic
1034248606 7:149670027-149670049 GGAGCAGGAAGAGCAGGAAGAGG - Intergenic
1034419047 7:150979415-150979437 GCCCCGGGAAGGCCAGGGCGGGG + Intergenic
1034446952 7:151118645-151118667 GGGACAGGAAGGGCAGGGCGGGG - Intronic
1034903911 7:154927347-154927369 GCAGGAGGAGGGGCAGGAGGAGG + Intergenic
1034971620 7:155423202-155423224 GCTCCAGGGAGGGCGGGCCGGGG - Intergenic
1034991128 7:155548751-155548773 CCACCAGGAAGGGCTGGAGGAGG - Intergenic
1035019825 7:155794327-155794349 GCCACAGGCAGGGCAGGAGGTGG - Intergenic
1035222627 7:157415116-157415138 GCAGCAGGCAGGGCAGGCCTGGG - Intronic
1035261040 7:157661781-157661803 ACACTACGATGGGCAGGACGTGG + Intronic
1037092097 8:14933048-14933070 ACAGCAGGGAGGGCAGGAGGGGG + Intronic
1037572605 8:20171417-20171439 GTGCCAGGAAGGCCAGGATGAGG + Exonic
1037673541 8:21035722-21035744 GCACCAGGCAGTGCTGCACGGGG - Intergenic
1039787590 8:40847519-40847541 GAACAGGGAAGGGGAGGACGTGG + Intronic
1042576037 8:70219663-70219685 GACACAGGAAGGGCAGGAGGAGG + Intronic
1044369412 8:91390875-91390897 GCACCAGGCAGGGCAGCACAGGG - Intronic
1044552958 8:93532565-93532587 ACAGCAGGAAGGGCATGAGGGGG - Intergenic
1047288419 8:123508041-123508063 GAACCAGCAGGGGCAGGACAAGG - Intronic
1047605888 8:126473945-126473967 GCACCAGGAGAGGCAGGGAGTGG - Intergenic
1048184816 8:132229976-132229998 TCAGAAGGAAGGGCAGGATGGGG + Intronic
1048994940 8:139788459-139788481 GCACCAGGAAGGGCCAGGCTGGG - Intronic
1049288387 8:141788838-141788860 GCCCCAGGAAGGGAAGGATTTGG - Intergenic
1049425871 8:142537643-142537665 ACACCAGGATGGGCAGGGGGAGG - Intronic
1049559899 8:143304741-143304763 GCCCCAGGGAGGCCAGGACCCGG - Intronic
1049583656 8:143423442-143423464 GCACGGGGAGGGGCAGCACGGGG - Intronic
1049684300 8:143933169-143933191 GCTTCAGGGAGGGCAGGGCGGGG + Intronic
1049735065 8:144200444-144200466 GCAGCAGGAAGGCCAGTAGGCGG - Exonic
1049766606 8:144358120-144358142 GCCCGAGGAAGGGCCCGACGCGG - Exonic
1049804941 8:144534468-144534490 GGAACAGGAAGGGCAGGACCTGG + Intronic
1049884751 9:19445-19467 TCATGAGGAAGGGCAGGAGGAGG + Intergenic
1050137301 9:2479885-2479907 GCAGCAGGAGGAGGAGGACGAGG + Intergenic
1051001746 9:12290705-12290727 GCACCATGAATGGCAGTAGGAGG + Intergenic
1051759019 9:20439582-20439604 GCACCAGGAAGGGGAGTGGGGGG + Intronic
1052568785 9:30193637-30193659 CCACCCTGAATGGCAGGACGAGG + Intergenic
1052866190 9:33466008-33466030 GCACCAGGGATGTCAGGGCGTGG - Intronic
1052996153 9:34552522-34552544 GGACCAGGAATGGCAGGAGTTGG + Intronic
1053128147 9:35599416-35599438 GCACCATGAATGGCAGCAGGAGG + Intergenic
1053136707 9:35655399-35655421 GGAGGAGGAAGGGCAGGACAGGG - Intergenic
1053575558 9:39355562-39355584 GCAGCAGGAGGGGGAGGAGGAGG - Intergenic
1055497710 9:76872098-76872120 GCACCTGGAAGGGTAGGCCCTGG + Intronic
1058095206 9:100852354-100852376 GCACGAGGAAGGGCCAGACATGG - Intergenic
1059923867 9:119186808-119186830 GAACCAGGAATGGCAGGGCGTGG - Intronic
1060393200 9:123296469-123296491 GCATCAGGAAGGGGAGGTCTGGG - Intergenic
1061175327 9:128992184-128992206 GTACCAGGAAGGGCTGGGCGCGG - Intronic
1061220039 9:129245201-129245223 GCAGCAGGAAGGAGAGGACCAGG + Intergenic
1061498408 9:130989005-130989027 ACCACAGGAAGGGCAGGAGGTGG - Intergenic
1061509584 9:131052531-131052553 GCACCCGGAAGGTCAGTATGAGG - Exonic
1061886028 9:133591515-133591537 GCACCAGGGAGGACTGGACCAGG - Intergenic
1061947556 9:133917198-133917220 GCCCCTGGAAGAGGAGGACGGGG - Intronic
1062501036 9:136852155-136852177 TCACCAGGCAGGGCAGGGCAGGG + Intronic
1062566029 9:137164358-137164380 GCACCAGGCAGGACCGGACCTGG - Intronic
1185463148 X:341516-341538 GCAGGAGGAGGGGCAGGAGGGGG - Intronic
1187253563 X:17621476-17621498 ACACAAGGAAAGGCAGGATGAGG + Intronic
1189288094 X:39866405-39866427 GGACCAGGAGAGGCAGGAGGTGG + Intergenic
1189714615 X:43852908-43852930 GCACCATGAAGGCAAGGAAGAGG + Intronic
1190274654 X:48892029-48892051 GGACCAGGGAGGGCAGCGCGGGG - Intergenic
1190275522 X:48896862-48896884 CAAGCAGGAAGGGAAGGACGGGG + Intronic
1190726788 X:53195118-53195140 GCACCAGGGAGGGAAGGAGGCGG - Intronic
1190733046 X:53236976-53236998 GCTCCTGGAAGGGCAGGAGCAGG + Intronic
1193108488 X:77704546-77704568 GCACCATGAATGGCAGCAGGAGG - Intronic
1193406300 X:81106315-81106337 GCAGGAGGAAGCGCAGGAGGAGG - Intergenic
1197801407 X:130353451-130353473 GAACCAGAAAGGGTAGGATGGGG + Intronic
1198933132 X:141880680-141880702 GCACCAGGAATGGCAGTAGGTGG - Intronic
1198935120 X:141896353-141896375 GCACCAGGAATGGCAGTAGGTGG - Intronic
1198960046 X:142174265-142174287 GCACCAGGAATGACAGTAGGTGG + Intergenic
1199692629 X:150320301-150320323 GCACCAGGTAGGGCAGGAAGGGG + Intergenic
1199899492 X:152159120-152159142 GCACAAGGAAGACCAGGAGGAGG - Intergenic
1200135368 X:153872113-153872135 GGACCAGGGAGGGCAGGTCCCGG - Intronic
1200401057 X:156020707-156020729 TCATGAGGAAGGGCAGGAGGAGG - Intergenic
1200785273 Y:7255391-7255413 GCACCAGCCAAAGCAGGACGAGG - Intergenic
1202332653 Y:23770881-23770903 TCTCCAGGAGGGGCAGGATGGGG + Intergenic
1202538116 Y:25899182-25899204 TCTCCAGGAGGGGCAGGATGGGG - Intergenic