ID: 1125734229

View in Genome Browser
Species Human (GRCh38)
Location 15:41912332-41912354
Sequence TAGGGCGCACCAGGAAGGGC AGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 151
Summary {0: 1, 1: 0, 2: 2, 3: 12, 4: 136}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734229_1125734233 -9 Left 1125734229 15:41912332-41912354 CCTGCCCTTCCTGGTGCGCCCTA 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1125734233 15:41912346-41912368 TGCGCCCTAAACAATAACCCAGG 0: 1
1: 0
2: 0
3: 4
4: 34
1125734229_1125734234 -8 Left 1125734229 15:41912332-41912354 CCTGCCCTTCCTGGTGCGCCCTA 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734229 Original CRISPR TAGGGCGCACCAGGAAGGGC AGG (reversed) Intronic
900581814 1:3413240-3413262 AGGAGCGCACCAGGAGGGGCAGG - Intronic
900625617 1:3607287-3607309 TAGGGCGCACCAGGCGGGCAGGG - Intronic
901306391 1:8236081-8236103 CAGGGTGCCCCAGGTAGGGCTGG - Intergenic
903065741 1:20698313-20698335 TGGGGCCCAGCGGGAAGGGCAGG - Intronic
904281866 1:29426325-29426347 TAGAGGCCACCAGGAAGAGCAGG - Intergenic
904291704 1:29490412-29490434 GAGAGGGCTCCAGGAAGGGCTGG + Intergenic
910867558 1:91802235-91802257 TAGTGCACTCCAGGAAGGCCTGG - Intronic
913082222 1:115399289-115399311 CAGGGCCCACCAGAAAGGGATGG + Intergenic
914410313 1:147421118-147421140 TAGGCAGCTCCTGGAAGGGCAGG - Intergenic
914667197 1:149841513-149841535 TAGGGCGCAGCAAGAAAGGGGGG - Intergenic
914668570 1:149852277-149852299 TAGGGCGCAGCAAGAAAGGGGGG + Intronic
915105512 1:153533159-153533181 TAGGGCGCCCCGGGAATGTCAGG - Intergenic
915171056 1:153977491-153977513 CAGGGCGCTGGAGGAAGGGCCGG + Exonic
916527158 1:165621234-165621256 TGGGGGGCACCAGCAAGGGAAGG + Intergenic
920299943 1:204982536-204982558 GCGGGAGCACCAGGAGGGGCTGG - Intronic
923337914 1:232986056-232986078 CAGGGCTCACCAGGACAGGCTGG - Intronic
1062901089 10:1147584-1147606 CAGGGCCCACCAGGCAGCGCTGG - Intergenic
1071511428 10:86264814-86264836 CAGGGCCAACCAGGAAGGGGCGG - Intronic
1072758392 10:98036134-98036156 TATGCCAGACCAGGAAGGGCTGG - Intergenic
1077328946 11:1975635-1975657 CAGGGCGCAGCAGGCAGGGCTGG - Intronic
1077508658 11:2943842-2943864 CTGGGAGCAGCAGGAAGGGCAGG - Intergenic
1078823454 11:14905570-14905592 GAGGGCGCTGCAGGACGGGCTGG + Intronic
1081977842 11:47247096-47247118 TAGGGCACATCAGGGAGGACTGG - Intronic
1082138572 11:48579581-48579603 TGGGGAGCCCAAGGAAGGGCTGG - Intergenic
1082243967 11:49899019-49899041 TGGGGAGCCCAAGGAAGGGCTGG + Intergenic
1082612505 11:55318705-55318727 TGGGGAGCCCAAGGAAGGGCTGG - Intergenic
1082618202 11:55388674-55388696 TGGGGAGCCCAAGGAAGGGCTGG - Intergenic
1082621625 11:55430621-55430643 TGGGGAGCCCAAGGAAGGGCTGG - Intergenic
1083731678 11:64655639-64655661 AAGGGAGCACCAGGAATGGGGGG + Intronic
1085711420 11:78832218-78832240 TAGGGTGGACCAAGAAGGCCCGG - Intronic
1088727276 11:112650521-112650543 TAGGGCCCACAAGGATGAGCTGG + Intergenic
1202811925 11_KI270721v1_random:30814-30836 CAGGGCGCAGCAGGCAGGGCTGG - Intergenic
1092143788 12:6201016-6201038 TAGGGGGCGCCAGGAAGGGAGGG + Intronic
1092290508 12:7157305-7157327 AACAGCCCACCAGGAAGGGCAGG - Intronic
1093473933 12:19534223-19534245 AGGGGCACACCATGAAGGGCAGG + Intronic
1097748608 12:63327640-63327662 CAGGGCGGACTTGGAAGGGCTGG - Intergenic
1097968111 12:65603214-65603236 TAGGGTGGAGCAGGAAGGGAAGG - Intergenic
1108274014 13:48789750-48789772 CATGGAGCACCAGGGAGGGCAGG + Intergenic
1108880211 13:55104323-55104345 TAAGCTGCACCAGAAAGGGCAGG - Intergenic
1108890653 13:55254118-55254140 TAGGGCACAAATGGAAGGGCTGG - Intergenic
1109156025 13:58910635-58910657 TAGGTCTCACCAGCAAGGGCTGG - Intergenic
1109180967 13:59213643-59213665 TAGGGCCCACGAGGAAGTGAAGG + Intergenic
1110113840 13:71785965-71785987 AAGGGAGCACCATGAGGGGCAGG + Intronic
1113426136 13:110210023-110210045 TAGGGCCCACCAGGACTGCCAGG - Exonic
1113975462 13:114224741-114224763 TAGGGCCCATCAGGGAGGGCTGG - Intergenic
1114624751 14:24121536-24121558 CAGGGGGCCTCAGGAAGGGCAGG + Intronic
1115471535 14:33773425-33773447 TAGGTTGCAGAAGGAAGGGCTGG - Intronic
1122210924 14:100173534-100173556 TGGGGCGCACCAGGCCAGGCTGG - Intergenic
1122832187 14:104403899-104403921 GAGGGGGCCCCAGGAAGGGCAGG + Intergenic
1123037957 14:105478953-105478975 TGGGGCGCACGAGTCAGGGCGGG - Intronic
1125734229 15:41912332-41912354 TAGGGCGCACCAGGAAGGGCAGG - Intronic
1128669798 15:69566506-69566528 CAGGGGTCTCCAGGAAGGGCTGG + Intergenic
1129711422 15:77822107-77822129 TAGGGCTCACCTGGAAGCCCTGG - Intergenic
1134069887 16:11254634-11254656 GAGGGAGCACCAGGAGGGGGAGG + Exonic
1134242013 16:12513259-12513281 GAGGGAGCACTAGGAAGGGGAGG - Intronic
1136072530 16:27796595-27796617 GAGGGCTCAGGAGGAAGGGCAGG + Intronic
1136278419 16:29192769-29192791 TGGGGGGCACCAGGCAGTGCAGG + Intergenic
1140492092 16:75346285-75346307 TAAAGAGCACCAGGTAGGGCTGG + Intronic
1141769877 16:86083389-86083411 CAGGGCGGGCCAGAAAGGGCAGG + Intergenic
1144729399 17:17517934-17517956 TAGGAGGCACCTGGAGGGGCAGG - Intronic
1145845374 17:28034009-28034031 TATGGAGTACCAGGAAGGACAGG - Intergenic
1145938493 17:28728556-28728578 TAGGGCGCGCCCGCAATGGCGGG - Intronic
1146815202 17:35936898-35936920 TAGGGCTGTCCAGGGAGGGCTGG - Intronic
1147256471 17:39185013-39185035 CAGGGAGAACCAGGAAGGGTGGG + Intronic
1147982244 17:44281710-44281732 TAGGACAGACCAAGAAGGGCTGG - Intergenic
1151894301 17:76969678-76969700 GAGGGGGCACCAGGAAGGGCTGG - Intergenic
1152278173 17:79370071-79370093 CAGGGAGCATCAGGAAGGGCTGG - Intronic
1157306138 18:46519027-46519049 GAAGGCACACCAGGAAGAGCAGG - Intronic
1157334759 18:46729632-46729654 TAAGGGGCACCAGGCAGGGAGGG + Intronic
1157761970 18:50272121-50272143 GAGGCCGCTCCAGGAAGTGCAGG + Intronic
1158931090 18:62325473-62325495 TCGGGAGCCCCGGGAAGGGCCGG + Intronic
1159908071 18:74116638-74116660 AAGGGCACACCAGGAGGAGCTGG - Intronic
1160810181 19:1009930-1009952 CAGGGAGCACCAGGCAGAGCCGG + Exonic
1160946573 19:1646556-1646578 TGGGGCGGAGCAGGACGGGCCGG - Intronic
1161026516 19:2039723-2039745 TAGCTCGGACCAGGACGGGCTGG + Exonic
1163690731 19:18736907-18736929 GAGCGAGCCCCAGGAAGGGCTGG + Intronic
1165383854 19:35498971-35498993 AAGGGCCCAGCAGCAAGGGCAGG + Intronic
1168722675 19:58562838-58562860 TCGGGCGCACCAGGAGGGGCCGG + Exonic
926006375 2:9376234-9376256 GAGGGCCCAGCAGGCAGGGCAGG + Intronic
926043356 2:9692169-9692191 TCGGGAGCACCAGGATGGTCAGG + Intergenic
927514195 2:23662547-23662569 AAGCGCCCACCAGGAGGGGCTGG - Intronic
935938874 2:108217851-108217873 TAAGGGGAACCAGGAAGTGCTGG - Intergenic
938798063 2:134735308-134735330 CAGGGCCCAGCAGGAAAGGCTGG - Intergenic
939094837 2:137822573-137822595 TAGGCCTCACCAGCAAAGGCAGG + Intergenic
945442220 2:209893988-209894010 CAGGAACCACCAGGAAGGGCTGG - Intronic
949048972 2:241887021-241887043 TCTGCCGCACCGGGAAGGGCAGG - Intergenic
1169191628 20:3661898-3661920 AAGGGAGCATCAGGAAGGGCTGG - Intronic
1171273405 20:23834379-23834401 CAGGATGCACCAGGGAGGGCAGG - Intergenic
1172836044 20:37873857-37873879 TAGGGAGCAGCAAGAGGGGCAGG - Intergenic
1173249516 20:41357277-41357299 GATGGCCCACCAGGAAGGGAGGG - Intronic
1176419086 21:6499583-6499605 AAGGGAGCACTAGGAAGTGCGGG + Intergenic
1177646767 21:23908760-23908782 TAAGGAGCACCAGGAAGGCCAGG + Intergenic
1179694579 21:43107905-43107927 AAGGGAGCACTAGGAAGTGCGGG + Intergenic
1179714280 21:43279821-43279843 TTGGGCGCTCCAGAAGGGGCAGG + Intergenic
1179789369 21:43747627-43747649 CAGGGAGCACCATGAAGGGAAGG - Intronic
1180949762 22:19715704-19715726 CAGGGTGCAGCAGGCAGGGCAGG + Intronic
1180995658 22:19963968-19963990 AAGGTGGCACCAGGAGGGGCAGG + Intronic
1181047545 22:20222761-20222783 GAGGGAGCAGCAGGAGGGGCTGG + Intergenic
1182004594 22:26949364-26949386 CAGGCCACACCAGGAAGGCCAGG + Intergenic
1184109982 22:42388915-42388937 AAGGCCGCACAAGGCAGGGCAGG - Intronic
1185324531 22:50219231-50219253 CAGGGCGGGCCAGGACGGGCTGG + Intronic
950703587 3:14766720-14766742 AAGGGCCCACCAGGCAGGGAGGG + Intronic
954419109 3:50409241-50409263 TTGGGCTCATGAGGAAGGGCTGG + Intronic
956455261 3:69414749-69414771 TAGGGCGTACCCAGAAGTGCAGG + Intronic
960945653 3:122964660-122964682 TAGGGCAACCCAGGAAGAGCGGG - Intronic
966240751 3:177753048-177753070 TTGTGCGCTCCAGGATGGGCTGG - Intergenic
968872639 4:3249561-3249583 TGGGCCCCACCAGGACGGGCGGG + Intronic
968884157 4:3318366-3318388 TAGGGAGGAGCAGGAAGGGGAGG - Intronic
969085522 4:4653296-4653318 CAAGGAGCACCAGGAATGGCTGG + Intergenic
983093171 4:163529973-163529995 TACAGTGCACCAGGAAGGGATGG + Intronic
983941391 4:173537804-173537826 GAGTGGGCACCAGGAAGGCCAGG - Intergenic
988968914 5:36446341-36446363 TTGGCCGCACCAAGAAGGCCTGG + Intergenic
992765089 5:79991116-79991138 CAGGGCGCAGGAGGAAGGGGCGG - Intronic
994094409 5:95835879-95835901 GAGGGTGCACCGGGAAGGGAGGG + Intergenic
999790734 5:154937670-154937692 TGGCGCGCACCAGGCTGGGCAGG + Intronic
1002407622 5:179048188-179048210 TAGGGAGCCTCAGGATGGGCTGG - Intergenic
1003308686 6:4950214-4950236 CAGGGCCCTGCAGGAAGGGCGGG + Intronic
1005303447 6:24492701-24492723 TAGGGGGCATCAGGACAGGCTGG + Intronic
1006468060 6:34207982-34208004 TAGGGAGGATCAGTAAGGGCTGG - Intergenic
1007462830 6:42030667-42030689 TGGGCCGCTCCAGGAAGGCCTGG - Intronic
1017602611 6:156100201-156100223 TGGGGCACACCAGCATGGGCAGG - Intergenic
1017722649 6:157254811-157254833 CAGGGCAGACCAGGATGGGCTGG - Intergenic
1018635271 6:165854792-165854814 CAGGGCGCGCCAGGCAGGGCAGG + Intronic
1018864795 6:167737896-167737918 AAGGGGGCAGCAGGCAGGGCCGG - Intergenic
1020916385 7:14198846-14198868 TAGGGGGAACCTGGAAGGACAGG + Intronic
1021606967 7:22418181-22418203 TAGGGAACACCAGGAAGAGAAGG - Intergenic
1022502372 7:30890276-30890298 TAGGGAGCACAACGTAGGGCAGG + Intronic
1029561101 7:101303347-101303369 TAGGACGGACAGGGAAGGGCTGG - Intergenic
1029576751 7:101408397-101408419 GAGGGTGCCCCAGGAAGAGCTGG + Intronic
1029654994 7:101918458-101918480 TAGAACCCACCAGGAAGGGGAGG + Intronic
1029706655 7:102279975-102279997 TGGGGCCCAGCGGGAAGGGCAGG - Intronic
1030059105 7:105608947-105608969 TAGGGAGGACCAGGAAGGATTGG - Intronic
1034455616 7:151168149-151168171 GAGGGCGCACCAGCAGGGACAGG + Intronic
1034991131 7:155548757-155548779 CTGGGTCCACCAGGAAGGGCTGG - Intergenic
1038643225 8:29343532-29343554 AAGGGCCCACCAGGAAGGGGTGG - Intronic
1041981441 8:63865947-63865969 TAGTGGGCAGTAGGAAGGGCTGG + Intergenic
1045422428 8:102029172-102029194 TAGGGTGTACCAGGAAGTGGAGG + Intronic
1048852814 8:138660461-138660483 TAGGGTGCACCAGGAAATCCAGG - Exonic
1049208676 8:141375335-141375357 TGGGCCCCACCAGCAAGGGCTGG - Intergenic
1049376970 8:142293976-142293998 TAGGCCCCACCTGGAGGGGCAGG + Intronic
1049574068 8:143382444-143382466 TGGGGCCCAGCAGGACGGGCCGG - Exonic
1055301390 9:74887108-74887130 TATGGCGCAACAGGAAGTTCTGG - Intronic
1060859007 9:126938574-126938596 GAGGGCGTACAAGGAAGGGTGGG + Intronic
1061909459 9:133715102-133715124 TAGGGAGCGCCTGGGAGGGCAGG - Intronic
1062082189 9:134629992-134630014 CATGGGGCACCTGGAAGGGCTGG - Intergenic
1062457524 9:136646610-136646632 CAGGCCGGAGCAGGAAGGGCTGG - Intergenic
1062579706 9:137223835-137223857 AGGGGAGCACCAGGAAGGGCGGG - Intergenic
1203790473 EBV:148891-148913 AAGGGCTCACCAGGGAGGCCTGG - Intergenic
1187061444 X:15790651-15790673 GAGCGCGCACCAGGAAGGAATGG - Intronic
1196718358 X:118830730-118830752 AAGGGCACACCTGGAAAGGCAGG - Intergenic
1201060143 Y:10037449-10037471 GAGGGAGGACCAGGAAGGGAGGG + Intergenic