ID: 1125734234

View in Genome Browser
Species Human (GRCh38)
Location 15:41912347-41912369
Sequence GCGCCCTAAACAATAACCCA GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 46
Summary {0: 1, 1: 0, 2: 1, 3: 5, 4: 39}

Found 6 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125734223_1125734234 25 Left 1125734223 15:41912299-41912321 CCTGTTACGCTGCCTCTGCATGT 0: 1
1: 0
2: 0
3: 9
4: 88
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734224_1125734234 13 Left 1125734224 15:41912311-41912333 CCTCTGCATGTCCACCCGCGTCC 0: 1
1: 0
2: 0
3: 15
4: 125
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734229_1125734234 -8 Left 1125734229 15:41912332-41912354 CCTGCCCTTCCTGGTGCGCCCTA 0: 1
1: 0
2: 2
3: 12
4: 136
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734227_1125734234 -1 Left 1125734227 15:41912325-41912347 CCCGCGTCCTGCCCTTCCTGGTG 0: 1
1: 0
2: 3
3: 36
4: 375
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734228_1125734234 -2 Left 1125734228 15:41912326-41912348 CCGCGTCCTGCCCTTCCTGGTGC 0: 1
1: 0
2: 2
3: 43
4: 441
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39
1125734225_1125734234 2 Left 1125734225 15:41912322-41912344 CCACCCGCGTCCTGCCCTTCCTG 0: 1
1: 0
2: 2
3: 37
4: 480
Right 1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG 0: 1
1: 0
2: 1
3: 5
4: 39

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125734234 Original CRISPR GCGCCCTAAACAATAACCCA GGG Intronic
907368660 1:53982929-53982951 GTGCCCTATCCAATACCCCATGG - Intergenic
909796747 1:79749039-79749061 GCACTCTAAAAAATAACCCATGG + Intergenic
920176394 1:204104507-204104529 CTGCCCTAAACAATAGGCCAAGG - Intronic
1083323490 11:61861852-61861874 GAGGCCTAAACCAGAACCCACGG - Intronic
1095710167 12:45279626-45279648 GTGTCCTAAACACTGACCCAGGG - Intronic
1095719005 12:45380216-45380238 GAGTCCTAAACACCAACCCATGG + Intronic
1103218504 12:119223235-119223257 GATCCCTAAACACAAACCCAAGG + Intergenic
1104874502 12:132024630-132024652 GAGCCCTAAACAAAAACACAGGG - Intronic
1106017127 13:25880094-25880116 GTGCCCAAAACAGTACCCCATGG - Intronic
1116565420 14:46438849-46438871 GCAGCCTAAACAAAACCCCAGGG + Intergenic
1118424708 14:65647938-65647960 GCTCCCTAAGCAAAACCCCAAGG - Intronic
1124129932 15:26974445-26974467 GGGCCATAGACAATAACACAGGG + Intronic
1125734234 15:41912347-41912369 GCGCCCTAAACAATAACCCAGGG + Intronic
1131812556 15:96187589-96187611 GCGTCATAAACAATAACTAAAGG + Intergenic
1135752907 16:25071031-25071053 GGGCCCTGAACACAAACCCAGGG - Intergenic
1144340403 17:14304950-14304972 GTGGCCTAACCAGTAACCCAGGG + Intronic
1147958423 17:44150997-44151019 GCGCCCCAAACTCCAACCCATGG + Exonic
1148835926 17:50465739-50465761 TCGCCCTTACCAATAACCCCTGG - Exonic
1159962152 18:74563733-74563755 GCCTCCTAGAAAATAACCCAGGG - Intronic
930426017 2:51213601-51213623 GTGCCATCAACATTAACCCAGGG - Intergenic
1172899972 20:38327566-38327588 GCTGCCAAAACAACAACCCAGGG - Exonic
1181433715 22:22898237-22898259 CCTCCCAAAACAAGAACCCAGGG + Intergenic
950888191 3:16378898-16378920 TCTCCCTAAAAAATAGCCCAAGG + Intronic
952452980 3:33448799-33448821 GGGCCATAACCAATAGCCCAGGG - Intergenic
962462335 3:135625778-135625800 GCCCCCCAAACAAAAACACAGGG - Intergenic
970336498 4:15050850-15050872 GGACCTTAAACTATAACCCATGG + Intronic
971706865 4:30056309-30056331 GGGTCCTAGACAATAAGCCATGG + Intergenic
975664640 4:76722861-76722883 GCGCACTAAACAATAATGGATGG + Intronic
990271498 5:54146448-54146470 GCGCCCTGCCCAATATCCCATGG + Intronic
995337449 5:111016512-111016534 GCTCCCTAAACACTATCCTAGGG + Intergenic
1000423263 5:161061383-161061405 GAGCCCTAATCAATAACCCATGG - Intergenic
1009283332 6:61779293-61779315 GGGCCATAAAAAATAACCCATGG + Intronic
1010768246 6:79800276-79800298 GGGCCTTAATCAATAACCCCAGG + Intergenic
1011383308 6:86766421-86766443 GCCACCTAGACAATAACCCAAGG + Intergenic
1012759021 6:103273244-103273266 GCCCCCTACAGAATAACCAAAGG + Intergenic
1016365342 6:143310377-143310399 GCACACTAATAAATAACCCATGG + Intronic
1018939909 6:168302150-168302172 GCTGGCTAATCAATAACCCAAGG - Intronic
1020713220 7:11635671-11635693 CTGCTCTAAACAACAACCCAGGG - Intronic
1030745886 7:113166002-113166024 GAGACCTAAAGAGTAACCCAGGG + Intergenic
1034950978 7:155297315-155297337 GGGCCCGAAAAAATCACCCAAGG + Intergenic
1040853976 8:51930003-51930025 GCACACTAAACAAAATCCCAGGG - Intergenic
1050316906 9:4411721-4411743 GCTCCCAAAGAAATAACCCATGG + Intergenic
1052373205 9:27689209-27689231 TCGCCCTGAACAAAAAACCAGGG - Intergenic
1058464272 9:105212478-105212500 GCTCCCTCAACCATAACCCATGG - Intergenic
1062467226 9:136686749-136686771 GCGCCCTGATCAATAGCCCTGGG + Intronic
1200078258 X:153562566-153562588 GCACCCTGATCAATAATCCATGG + Intronic