ID: 1125735769

View in Genome Browser
Species Human (GRCh38)
Location 15:41924561-41924583
Sequence ATCCAGTGCCTGGCATACAG GGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 607
Summary {0: 1, 1: 1, 2: 19, 3: 108, 4: 478}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125735763_1125735769 28 Left 1125735763 15:41924510-41924532 CCTAGAAAGCTGTCCAAAATGCT 0: 1
1: 0
2: 4
3: 15
4: 231
Right 1125735769 15:41924561-41924583 ATCCAGTGCCTGGCATACAGGGG 0: 1
1: 1
2: 19
3: 108
4: 478
1125735765_1125735769 15 Left 1125735765 15:41924523-41924545 CCAAAATGCTATCTACTGGTTAT 0: 1
1: 0
2: 0
3: 14
4: 117
Right 1125735769 15:41924561-41924583 ATCCAGTGCCTGGCATACAGGGG 0: 1
1: 1
2: 19
3: 108
4: 478

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125735769 Original CRISPR ATCCAGTGCCTGGCATACAG GGG Intronic
900667037 1:3822537-3822559 ATTCGCTGCCTGGCATAAAGAGG + Intronic
901067398 1:6500764-6500786 AGGCAGTGTCTGGCATGCAGTGG - Intronic
901663207 1:10811938-10811960 ACACAGTGCCTGGCACATAGTGG + Intergenic
902375828 1:16029540-16029562 GCACAGTGCCAGGCATACAGTGG + Intronic
902489655 1:16772037-16772059 TGCCAGAGCCTGGCATATAGGGG + Intronic
902551225 1:17220787-17220809 GTGCAGTGCCTGGCACAGAGAGG + Intronic
902690049 1:18105466-18105488 AGCCAGTGCCTGACACATAGTGG - Intergenic
902719272 1:18293210-18293232 GCCCAGGGCCTGGCACACAGTGG + Intronic
902719726 1:18295942-18295964 GCCCAGGGCCTGGCACACAGTGG + Intronic
902737011 1:18407951-18407973 AGGCAGCACCTGGCATACAGAGG - Intergenic
902776278 1:18676802-18676824 GGACAGTGCCAGGCATACAGCGG - Intronic
903022547 1:20404290-20404312 AAACAGTGCCTGGCACATAGTGG - Intergenic
903283525 1:22263514-22263536 CTCCAGGGCCTGGCATCTAGCGG - Intergenic
903381837 1:22902632-22902654 TCCCAGGGCCTGGCACACAGTGG - Intronic
903971654 1:27122792-27122814 ATCCAGTGCCTTTCCTGCAGGGG - Intronic
904141748 1:28358867-28358889 AGACAGTGCCTGGCATGGAGTGG - Intergenic
904339256 1:29823494-29823516 AGCCAGGGCCTGACATAGAGTGG - Intergenic
904386677 1:30147145-30147167 GTCCAGTGCCTGCCACAAAGTGG - Intergenic
904921067 1:34008830-34008852 CTCAAGTGCTTTGCATACAGTGG + Intronic
905241580 1:36584840-36584862 AACAAGTGTCTGGCACACAGTGG - Intergenic
905541356 1:38763014-38763036 ACACAGGGCCTGGCATAAAGTGG + Intergenic
905816370 1:40954015-40954037 TTCCAGTGCAGGGGATACAGAGG + Intergenic
906042019 1:42794917-42794939 TTCCAGTACCTGGCACACGGTGG - Intergenic
906144262 1:43550545-43550567 ACCCAGTTCCTGGCACCCAGGGG - Intronic
906182894 1:43837052-43837074 CTCCAGTGCCTTGCATAAATGGG - Intronic
906365697 1:45207356-45207378 ATCCTCTGCCTGGCACATAGTGG + Intronic
906746949 1:48228727-48228749 ATGCAGTGCCTGGCATACAGTGG + Intronic
907240823 1:53080126-53080148 ATCACATGCCTGGCATCCAGGGG - Intronic
907376638 1:54049407-54049429 ATACAGTGCCTGGCACATTGTGG - Intronic
907491061 1:54809058-54809080 TTGCAGTGCCTGGCACACATAGG + Intronic
907824902 1:58006152-58006174 GTTCAGTGCCTGGCATCCAGAGG + Intronic
908250571 1:62262366-62262388 GTCCAGTTCCTGGAACACAGAGG + Intronic
908754179 1:67452889-67452911 ACACAGTGCCTGGCATATACTGG - Intergenic
910093440 1:83492673-83492695 ACCCAGTGCCTGGCATGTCGTGG + Intergenic
910424959 1:87112463-87112485 GTGCAGTGCCTGGCAAACAGTGG - Intronic
910436193 1:87208564-87208586 ATACAGTGCCTGGCACACACCGG + Intergenic
910634502 1:89392234-89392256 ATGCAGTGCCTGGCATTTAGTGG - Intergenic
910789610 1:91037560-91037582 GTACAGTGCCAGGCACACAGGGG - Intergenic
912232906 1:107816388-107816410 ATCTAGTGCCAAGCATATAGTGG + Intronic
912719810 1:112010683-112010705 AAGCAGTGACTGGCATACAGTGG - Intergenic
915285057 1:154847141-154847163 AGCACGTGCCTGGCACACAGGGG - Intronic
915330332 1:155107752-155107774 TGCCAGTGCCTGGCACACAGTGG - Intergenic
916444693 1:164861513-164861535 GTCTAGTGCCTGGCACACGGTGG - Intronic
916715994 1:167447025-167447047 ACAAAGTGCCTGGCACACAGTGG + Intronic
917143299 1:171859580-171859602 AGACAGTGCCTGGCACACAGTGG - Intronic
917819997 1:178753094-178753116 ATTCAGTGCCTCGTATTCAGTGG - Intronic
918118463 1:181517021-181517043 ACACAGTACCTGGCACACAGTGG - Intronic
919102440 1:193111095-193111117 CTACAGTGCCTGGCATATGGTGG - Intergenic
919777400 1:201203187-201203209 AAACAGTGCCTGGCACACAGTGG + Intronic
919914865 1:202133007-202133029 ATCCAGGGCCTGGGAAAGAGGGG + Exonic
920101506 1:203519844-203519866 ATCCCATGTCTGGCACACAGTGG - Intergenic
920180150 1:204127383-204127405 ATCCAGTCCCTAGTATAGAGTGG - Exonic
921315336 1:213885125-213885147 GCTCAGTGCCTGGCACACAGTGG - Intergenic
921365280 1:214367890-214367912 ATCCAGTGCCTGGCACGTAGTGG + Intronic
923530783 1:234810492-234810514 TGCCAGTGCCTGGCATATAGGGG - Intergenic
923696071 1:236253807-236253829 ACCCAGTGCCTGACACATAGTGG - Intronic
924158652 1:241207461-241207483 TTCCAGTGCCTGGAATATATAGG - Intronic
924691295 1:246353802-246353824 ATACAGTGCCTGGCACACAGTGG + Intronic
924772670 1:247090279-247090301 CCCCAGTGGCTGACATACAGCGG - Intergenic
1063258415 10:4355009-4355031 ATCAGCTGCCTGGCATACTGTGG - Intergenic
1063636824 10:7789642-7789664 GGACAGTGCCTGGCATGCAGTGG + Intronic
1063980033 10:11445383-11445405 GCACAGTGCCTGGCATACAGGGG + Intergenic
1066342959 10:34553861-34553883 ATCCAGTGGCTGGCATCTTGAGG + Intronic
1067148904 10:43713448-43713470 CTCCAGTGCCTGGCACACAGAGG + Intergenic
1067659334 10:48222648-48222670 ATGAAGTGACTGGCATAGAGTGG - Intronic
1067829535 10:49602465-49602487 TCCCAGTGCCTGGCAAACAGTGG - Intergenic
1067928962 10:50540465-50540487 GTCTAGTGGCTGGCATATAGTGG - Intronic
1068313625 10:55312463-55312485 ATACAGTGCATGGCATAATGTGG - Intronic
1068420199 10:56781183-56781205 ACTTAGTGCCTGGCACACAGCGG - Intergenic
1069908300 10:71745117-71745139 CTCCAGTGCCTGGCACATAGTGG - Intronic
1070344063 10:75524508-75524530 ATACAGTGCCTGGCATACATAGG + Intronic
1070744801 10:78927317-78927339 GTGCAGTGCATGGCACACAGAGG + Intergenic
1072258071 10:93639925-93639947 ATCCAGTGCCTGGCACATGGTGG + Intronic
1072519897 10:96222093-96222115 ATACAGTGCCTCACACACAGAGG - Intronic
1072780444 10:98247602-98247624 AGCCAGGGCCTGGGATACACAGG - Intergenic
1073458959 10:103654528-103654550 ATGCAGGGCCTGACACACAGTGG - Intronic
1073498611 10:103916868-103916890 GAACAGTGCCTGGCATATAGTGG - Intronic
1073559588 10:104485528-104485550 GATCAGTGCCTGGCATAAAGTGG + Intergenic
1073559738 10:104486645-104486667 GCTCAGTGCCTGGAATACAGTGG - Intergenic
1073582977 10:104684464-104684486 CTCCCGTGCCGGGCACACAGTGG - Intronic
1073889587 10:108084021-108084043 ATACAGTGCGTGGCAGACACAGG + Intergenic
1074718271 10:116240753-116240775 ACACAGTGCTTGGCATAGAGTGG + Intronic
1074896402 10:117781198-117781220 GTCAACTGCCTGGCATGCAGTGG + Intergenic
1074963202 10:118466280-118466302 ATCCAGTGACTGGTATGGAGTGG - Intergenic
1075244041 10:120804643-120804665 GACCAGGGCCTGGCATACAGTGG - Intergenic
1076076729 10:127539141-127539163 ATCCAGTCCCTGGCACGTAGAGG + Intergenic
1076153514 10:128184663-128184685 ATCCAGTGCCTGGAGTACTGAGG - Intergenic
1077468878 11:2747538-2747560 TTCCAGTGACTGGCACACGGTGG - Intronic
1077988257 11:7377189-7377211 GAACAGTGCCTGGCATAGAGTGG - Intronic
1078665874 11:13324723-13324745 AAACAGAGCCTGGCACACAGTGG + Intronic
1078969597 11:16392338-16392360 GAACAGTGCCTGGCATATAGTGG - Intronic
1079391967 11:20029637-20029659 GCACAGTGCCTGGCACACAGGGG + Intronic
1080107657 11:28527464-28527486 ATACTGTGCCTGGCATGCAGGGG - Intergenic
1080429273 11:32183801-32183823 TTCCAGTGCCCAGCATCCAGCGG + Intergenic
1080549360 11:33358310-33358332 GCACAGTGCCTGGCATATAGTGG + Intergenic
1081622270 11:44625616-44625638 CCACAGTGCCTGGCATAGAGTGG - Intergenic
1081659887 11:44881640-44881662 GAACAGTGCCTGGCATACAGCGG - Intronic
1083636848 11:64125402-64125424 GCACAGTGCCTGGCACACAGGGG + Intronic
1083876480 11:65526682-65526704 AGCCAGGCCCTGGCATGCAGTGG + Intronic
1083945470 11:65920467-65920489 GGCCAGGGCCTGGCATACAGTGG + Intronic
1083965155 11:66039298-66039320 GTACAGGGCCTGGCACACAGAGG - Intergenic
1084195391 11:67521648-67521670 AGCCAGGGCCAGGCACACAGTGG + Intronic
1084408554 11:68992812-68992834 AATCAGGGGCTGGCATACAGTGG + Intergenic
1084433083 11:69122347-69122369 ACCCAGTGCCTGGCACACAGCGG + Intergenic
1084619028 11:70255935-70255957 GCCCGGTGCCTGGCATAAAGTGG + Intergenic
1085154851 11:74284022-74284044 GGCCAGTGTCTGGCACACAGTGG + Intronic
1085170718 11:74447526-74447548 ATCCACAGCCTGGCACAGAGTGG - Intergenic
1085215105 11:74822881-74822903 ACACAGTGCCTGGCATACAGTGG - Intronic
1085294788 11:75425324-75425346 ATTCTGCGCCTGGCACACAGTGG + Intronic
1085300037 11:75452583-75452605 ACGCAGTGCCTGGCACACACAGG + Intronic
1085426471 11:76409087-76409109 GCACAGTGCCTGGCATGCAGCGG - Intronic
1085957204 11:81413927-81413949 TTACAGTGCCTGGCACAGAGAGG - Intergenic
1086182666 11:83972811-83972833 ATCCTGTGCCTGGCACAGAGTGG - Intronic
1087282486 11:96227454-96227476 GCCCAGTGCCTGGCACACTGTGG + Intronic
1088796619 11:113271030-113271052 ATACAGTGCCTGGCATGTGGTGG - Intronic
1089139508 11:116274677-116274699 ACCCAGGGCCTGGCATTCACTGG + Intergenic
1089233233 11:116998710-116998732 AGCTAGGGCCTGGCACACAGAGG + Intronic
1089481044 11:118805323-118805345 GTACAGTGCCTGGAACACAGTGG - Intergenic
1089659943 11:119979207-119979229 ACCCAATGCCTGGCACATAGTGG - Intergenic
1089740547 11:120579100-120579122 GGACAGGGCCTGGCATACAGTGG - Intronic
1089767344 11:120777491-120777513 ACCCCGTGCCGGGCACACAGTGG - Intronic
1093043279 12:14410801-14410823 ATCCAGTTTCAGGCATTCAGTGG + Intronic
1093640250 12:21519630-21519652 CTCCAGTTCCTGGCATTTAGTGG + Intergenic
1095959985 12:47828418-47828440 CTACAGTGCCTGGCACACATTGG + Intronic
1096367810 12:51043428-51043450 TTCCAGTCCCTGGCACACAAGGG - Intergenic
1096687701 12:53299789-53299811 ATGCGGTGCCGGGTATACAGGGG - Exonic
1097338274 12:58409036-58409058 ACACAGTGCCTGGTATAGAGTGG - Intergenic
1098100051 12:67005661-67005683 GTGCAGTGCCTGGCACTCAGTGG - Intergenic
1098219817 12:68257239-68257261 GAACAGTGCCTGGCATATAGTGG + Intergenic
1098394491 12:70003890-70003912 GCCAAGTGCCTGGCATATAGAGG - Intergenic
1098463402 12:70759268-70759290 ATTTAGTGCCTGGCATGCAATGG - Intronic
1098481023 12:70961668-70961690 ATCCAGTGTCTGGCATAGAAAGG - Intergenic
1099086996 12:78257932-78257954 ATCCTGTGCCTGGCTCAGAGGGG - Intergenic
1099847622 12:88048139-88048161 ACCCAGTACCTGGCAGACAGTGG + Intronic
1100583328 12:95956499-95956521 ATCCAGTGTCTGGCAGACTAGGG + Intronic
1100747203 12:97659494-97659516 ATCTAGTCCCTGGAATACAGGGG - Intergenic
1101569009 12:105936035-105936057 TGCCAGTGCCTGGGACACAGTGG - Intergenic
1101735322 12:107458891-107458913 TTCCCATGCCTGGCATAGAGGGG - Intronic
1101753133 12:107599732-107599754 ATCCAGTGCCTGGCCGATACTGG + Intronic
1101993112 12:109503955-109503977 CCTCAGTGCCTGGCACACAGGGG - Intronic
1101993636 12:109508411-109508433 GTGCAGTGCCTGGCACAGAGTGG + Intronic
1102285884 12:111656166-111656188 CTCCAGTGCCTGGCACATGGTGG + Intronic
1102525721 12:113511260-113511282 CCCCAGTGCCTAGCATTCAGCGG + Intergenic
1103174448 12:118850159-118850181 GTACAGTGCCTGGCATATAGTGG + Intergenic
1103874032 12:124113606-124113628 ATCCTGTGCCTGCCATGCTGGGG + Intronic
1105913478 13:24892144-24892166 ATGCAGTGCCTGGCACACCCTGG + Intronic
1106229026 13:27807591-27807613 CCCCAGGGCCTGGCACACAGTGG + Intergenic
1106397618 13:29396382-29396404 GACTAGTGCCTGGCATATAGTGG + Intronic
1106563243 13:30864367-30864389 ACCCAGGGCCTGGCCTAGAGGGG + Intergenic
1107026433 13:35806557-35806579 ATCCAGTTCCTTACATACACAGG + Intronic
1107068376 13:36242662-36242684 ATAGAGTGCCTGGCATAAATTGG - Intronic
1107085936 13:36428077-36428099 AGCTACTGCCTGGCATACAATGG + Intergenic
1107246475 13:38302309-38302331 AAATAGTGCCTGGCATATAGTGG + Intergenic
1107928986 13:45290857-45290879 CCCCTGTGCCTGGCACACAGTGG - Intergenic
1108107191 13:47023953-47023975 ATCCAATGCATGACATACAATGG - Intergenic
1108409875 13:50134725-50134747 TTCCTGTGCCTGACATGCAGTGG - Intronic
1109354637 13:61221816-61221838 ATATAGTTCCTGCCATACAGGGG + Intergenic
1109810954 13:67511657-67511679 ATCTAGAGCCTGTCAAACAGTGG - Intergenic
1112315547 13:98359283-98359305 ACCCACTGCCTGGCACACAGTGG + Intronic
1113922304 13:113919941-113919963 ACTCAGTGCCTGGCACACTGGGG - Intergenic
1114102997 14:19394811-19394833 AACCGGTGCCTGGCACACCGTGG - Intergenic
1115458919 14:33636745-33636767 ACCCACTGCCTGGCACACCGGGG + Intronic
1117456605 14:55904010-55904032 TTCCAGTGCCTGGCCCAGAGCGG - Intergenic
1117553673 14:56862397-56862419 GCCCTGTGCCTGGCACACAGTGG - Intergenic
1118166834 14:63344952-63344974 CGCCAGTGCCTGGCACATAGCGG + Intergenic
1118433997 14:65752969-65752991 AAACAGTGCCTGACATATAGTGG - Intergenic
1119491453 14:75037445-75037467 GTACAGTCCCTGGCATACAATGG + Intronic
1119891285 14:78184256-78184278 TTCCAGTGCCTGGCATCGAGCGG - Intergenic
1120819120 14:88895604-88895626 GTCTAGTGCCTGCCACACAGTGG - Intergenic
1120968963 14:90191707-90191729 TTCCAGTGCCTGGCACAGAGAGG - Intergenic
1121229430 14:92345801-92345823 TCCCAGTGCCTGGCATACAGGGG - Intronic
1121456557 14:94042419-94042441 CCCCAGTGCCTGGCACAGAGGGG + Intronic
1122049415 14:99045413-99045435 ACCCAATGCCTAGCACACAGTGG + Intergenic
1122135429 14:99630130-99630152 AGCCACTGACTGGCACACAGTGG - Intergenic
1122273618 14:100579816-100579838 CTCCAGGGCCTGGCAGCCAGGGG - Intronic
1122516786 14:102314523-102314545 AAACAGTGCTTGGCACACAGCGG - Intergenic
1123207829 14:106730525-106730547 CTCCAGTGCCTGTAACACAGAGG - Intergenic
1124427333 15:29572699-29572721 CTTCAGTGCCTGGCACATAGTGG - Intergenic
1124585727 15:31004680-31004702 CTACAGTGCCTGTGATACAGAGG - Intronic
1124651044 15:31474182-31474204 TCCCAGTGCATGGCACACAGTGG + Intergenic
1125735769 15:41924561-41924583 ATCCAGTGCCTGGCATACAGGGG + Intronic
1125996213 15:44163389-44163411 AACTAGTGCCTGGAATAGAGGGG + Intronic
1126238031 15:46408359-46408381 ATACAATGCCTGGCACATAGTGG + Intergenic
1126650587 15:50917671-50917693 CTGCAGTATCTGGCATACAGTGG - Intronic
1127647167 15:60970428-60970450 ATACAATGCCTGGCACGCAGTGG - Intronic
1128192588 15:65717193-65717215 ATCCAATGCCTAGCATTCGGAGG + Intronic
1128381473 15:67116293-67116315 TTGCAGTGCCTAGCACACAGTGG + Intronic
1128388824 15:67169041-67169063 ATCCAGTGCCTACCATGTAGCGG + Intronic
1128702449 15:69814122-69814144 ATCTGGTGCCGGGCACACAGCGG - Intergenic
1128707352 15:69846594-69846616 ATGCAGTGCCTGGCATATAGTGG + Intergenic
1128938114 15:71765265-71765287 ACCCAGTGCCTGGCCCAGAGGGG - Intronic
1129106317 15:73309782-73309804 CCTCAGTGCCTGGCATATAGTGG - Intergenic
1129704178 15:77785169-77785191 ACTCAGGGCCTGGCACACAGTGG + Intronic
1129772215 15:78209471-78209493 CTCCTGTGCCGGGCAGACAGAGG + Intronic
1129956051 15:79637772-79637794 ATCCAGCTCCTGGCAAGCAGCGG + Intergenic
1130926497 15:88389535-88389557 GCCCAGTGCCTGGAACACAGTGG + Intergenic
1131062824 15:89414647-89414669 GCCCAGTGCTTGGAATACAGTGG + Intergenic
1132093583 15:98965681-98965703 ACCGAGTGCCTGGCACTCAGGGG + Intergenic
1132221117 15:100106236-100106258 ATCCAGGGGCTGGCATAGATGGG - Intronic
1132246606 15:100301020-100301042 ACCTAGTGCCTAGCATGCAGTGG + Intronic
1133064392 16:3195781-3195803 CCCCAGTGCCTGGCACACAGAGG + Intergenic
1133367808 16:5224884-5224906 ATTCAGTGCCTGGTACACATAGG - Intergenic
1133811631 16:9165379-9165401 AAACAGTGCCTGGCGCACAGTGG - Intergenic
1133920342 16:10147133-10147155 ATACTATGCCTGGCATACACAGG - Intronic
1134122852 16:11596879-11596901 TTCCAGGGCCTGGCACCCAGTGG - Intronic
1134528926 16:14967149-14967171 ATCCAGTGCCTAGGATGCAGTGG - Intergenic
1134677227 16:16099205-16099227 ATGAAGTGCCTGGCACACAGTGG + Intronic
1135100452 16:19600591-19600613 GATCAGTGCCTGGCACACAGGGG - Intronic
1135725219 16:24849064-24849086 ATGTAGTGCCTGGCACATAGAGG + Intronic
1136405046 16:30040327-30040349 GCCTGGTGCCTGGCATACAGTGG - Intronic
1137762815 16:50954212-50954234 TGCCAGGACCTGGCATACAGGGG + Intergenic
1138142574 16:54581501-54581523 GCACAGTGCCTGGAATACAGTGG - Intergenic
1138265151 16:55655307-55655329 GAACAGTGCCTGGCACACAGCGG + Intergenic
1138297410 16:55898863-55898885 ACCCAGTGCCAGACACACAGTGG - Intronic
1138310612 16:56020437-56020459 ACCCATTGCCTGGCATTGAGAGG - Intergenic
1138415254 16:56867941-56867963 ATCCAGAGCCTGGCATTTACAGG - Intronic
1138898898 16:61244519-61244541 ACCCAGAGCCTGCCAAACAGTGG - Intergenic
1139002251 16:62526548-62526570 ATCAATTACCTGGTATACAGTGG - Intergenic
1139657325 16:68396946-68396968 ACACAGTGCCTGGCACACAGTGG - Intronic
1139867440 16:70073829-70073851 ATCCAGTGCCTAGGATGCAGTGG + Intergenic
1139973885 16:70793566-70793588 ATCATGTGCCTGGCACACAGTGG - Intronic
1140792289 16:78403656-78403678 ATCCAGGGCCTGGCACAGGGGGG - Intronic
1140989472 16:80194734-80194756 ACCTAGTGCTTGGCATACAGTGG + Intergenic
1141008075 16:80371791-80371813 ACACAGTGCCTGGAATGCAGTGG + Intergenic
1141083127 16:81071081-81071103 ATCCAGTGCCAATCAGACAGCGG + Intronic
1141517744 16:84557631-84557653 GCCCAGTGCCTGGCAAACAGTGG - Intergenic
1141603990 16:85142732-85142754 ACCCAGTGCCTAGCAGACACAGG + Intergenic
1141770947 16:86089361-86089383 ATACATGGCCTGGCACACAGTGG - Intergenic
1141975803 16:87515709-87515731 ATGCAGAGCCTGGCATCCAGAGG + Intergenic
1142897713 17:2992681-2992703 GCCCAGTGCCTGGCACACAGCGG + Intronic
1144743036 17:17594978-17595000 CAAAAGTGCCTGGCATACAGTGG + Intergenic
1146265854 17:31452236-31452258 GCACAGTGCCTGGCATAGAGAGG + Intronic
1146541832 17:33702855-33702877 GTACATCGCCTGGCATACAGAGG - Intronic
1147246865 17:39127418-39127440 ATTCAGGGCCTAGCACACAGTGG - Intronic
1147757355 17:42777877-42777899 AGCCAGGGCCTGGCAGAAAGGGG - Intronic
1147844658 17:43396578-43396600 GACCAGAGCCTGGCATGCAGTGG + Intergenic
1147978341 17:44260378-44260400 ATCCAGGCCCTGGCAGGCAGGGG + Intronic
1148137630 17:45304964-45304986 GCACAGTGCCTGGCATGCAGTGG + Intronic
1148187330 17:45654167-45654189 ACCCAATGCCTTGCACACAGTGG - Intergenic
1148865330 17:50625394-50625416 CGCCAGTGCCTGGCACACAGAGG - Intronic
1148990470 17:51661751-51661773 ATTCAGTGTCTGGAACACAGTGG - Intronic
1149009976 17:51846174-51846196 ATCAAGTGCCTGCCATGCACTGG + Intronic
1149265993 17:54928264-54928286 CCACAGTGTCTGGCATACAGAGG - Intronic
1149530286 17:57389594-57389616 ATGCAGTGCTTGGCACATAGTGG + Intronic
1149804649 17:59604359-59604381 GCCCAGTGTTTGGCATACAGAGG - Intronic
1150497078 17:65616196-65616218 AATCAGTGCCTGACACACAGAGG + Intronic
1151162471 17:72176877-72176899 AGCCAGGGCCTGGTATCCAGGGG - Intergenic
1151768423 17:76144167-76144189 ACCCAGTGCTTGGCACACAGAGG + Exonic
1151781493 17:76249486-76249508 ACACAGTTCCTGACATACAGCGG + Intergenic
1151889881 17:76945791-76945813 GCACAGTGCCTGGCATACAGTGG - Intronic
1153946125 18:10018931-10018953 ACCCAGCGCTTGGCACACAGAGG - Intergenic
1155026258 18:21943523-21943545 ATACATTGCCTGACACACAGCGG + Intergenic
1155593208 18:27452441-27452463 TCCCAGAGCCTGGGATACAGTGG + Intergenic
1155911210 18:31506117-31506139 ATCCAGTGACTGGCACACAGCGG - Intronic
1157056819 18:44239187-44239209 ATCCAGTGCCTGGCATTTAAAGG + Intergenic
1157221968 18:45834710-45834732 CCCCAGTGCCTGGCATAAAGTGG + Intronic
1157290933 18:46409098-46409120 TAACAGTGCCTGGCATACAGGGG + Intronic
1157320743 18:46631970-46631992 CTCCTGTGCCTGGCAGACAGTGG - Intronic
1157415937 18:47502873-47502895 GTCCAGTGCCTGGCACATAGTGG - Intergenic
1157579349 18:48764454-48764476 ATGCAGCCCCTGGGATACAGAGG - Intronic
1158265987 18:55661261-55661283 ATACAGTGTCTGGTAAACAGAGG + Intronic
1160126260 18:76175147-76175169 AGACAGTGCCTGGCATCCAGTGG - Intergenic
1160737807 19:672289-672311 TCCCAGGGCCTGGCACACAGTGG + Intergenic
1161319993 19:3636700-3636722 CCACAGTGCCTGGCACACAGAGG + Intronic
1161548662 19:4898158-4898180 CTTCAGTGCATGGTATACAGTGG + Intronic
1161881172 19:6954045-6954067 AAACAGTGCCTGGCACATAGCGG + Intergenic
1161916820 19:7234562-7234584 ATCCAGTCCCTGACATAAAATGG - Intronic
1163277171 19:16292275-16292297 ATGCAGGGCCTGGCATATACTGG + Intergenic
1163598971 19:18236727-18236749 GTACAGGGCCTGGCACACAGTGG + Intronic
1163626024 19:18390240-18390262 GTCCGGGGCCTGGCATAAAGTGG - Intergenic
1163735803 19:18979835-18979857 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1163986944 19:20962410-20962432 GACCAGTGCTTAGCATACAGAGG - Intergenic
1165392776 19:35547895-35547917 ATCCCCTGGCTGCCATACAGAGG - Intergenic
1165990245 19:39807160-39807182 ATTCAGTGGCTGGGATACTGAGG - Intergenic
1166222290 19:41373466-41373488 AAACAGTGCCTGGCACAAAGTGG - Intronic
1166992058 19:46698498-46698520 GTACAGTGCCTGGCATACAGAGG + Intronic
1167194680 19:48019954-48019976 ACTCAGTGCCTGGCTCACAGTGG - Intronic
1167599830 19:50448136-50448158 GACCAGCGCCTGGCACACAGTGG + Intronic
1167747736 19:51362595-51362617 GAACAGTGCCTGGCACACAGTGG - Intronic
924963362 2:54990-55012 ATCAAGTGTTTGGCATGCAGAGG + Intergenic
925632839 2:5913218-5913240 CTTCAGTGCCTGGCATGGAGTGG - Intergenic
925755600 2:7128739-7128761 GTACAGTGTCTGGCATACAGAGG - Intergenic
926426564 2:12743876-12743898 ACCCAGTGCCTGGCACATGGAGG + Intergenic
926748676 2:16181181-16181203 GCCCAGTGCCTGGCATAGAGAGG + Intergenic
928085800 2:28345561-28345583 CACCAGTGCCTGGCACTCAGTGG + Intergenic
928096356 2:28407378-28407400 ATCCCATGCCTGTCACACAGAGG - Intronic
928298176 2:30103492-30103514 AACCAGTACCTGGCATTTAGTGG + Intergenic
928723257 2:34143836-34143858 ATACAGTGCCTGGTATTTAGTGG - Intergenic
929254335 2:39793024-39793046 AAACAGTGCCTGTCATAGAGTGG - Intergenic
930274733 2:49298241-49298263 ACACAGTGCCTGGTATAGAGCGG + Intergenic
930924313 2:56797962-56797984 GTCCAGTGCTTGGCGTACTGAGG - Intergenic
931216857 2:60253290-60253312 GAACAGTGCCTGGCACACAGTGG - Intergenic
931288103 2:60849540-60849562 CCCCAGTGCCTGGTAGACAGGGG + Intergenic
931808763 2:65833954-65833976 TCCCAATGCCTGGCATACACTGG - Intergenic
932180069 2:69638934-69638956 ATACAGTGCCTGCCACAAAGAGG + Intronic
932290039 2:70569385-70569407 ATCCAGGGCCTGGCACAGAGTGG + Intergenic
932782822 2:74572892-74572914 CAACAGTGCTTGGCATACAGTGG + Intronic
934872635 2:97881173-97881195 ATGCAGTGCCTAGGATACTGCGG - Intronic
935120682 2:100180914-100180936 ATGCCGTGCCTTGCACACAGAGG + Intergenic
935331438 2:101980376-101980398 ATCCAGGGCCAGGCACCCAGGGG - Intergenic
937435551 2:121877430-121877452 ATCCACTTCCAGGCATAGAGGGG - Intergenic
938107410 2:128542761-128542783 ACCCAGGGTCTGGCATACAGGGG - Intergenic
938263640 2:129911657-129911679 TTGCTGTGCCTGGAATACAGGGG + Intergenic
938296363 2:130181956-130181978 GCCCAGTGCCAGGCATACATTGG - Exonic
938460386 2:131492682-131492704 GCCCAGTGCCAGGCATACATTGG + Intronic
939003756 2:136764243-136764265 ATCCAATGCCTGGCACACCATGG - Intergenic
939884161 2:147662993-147663015 GCACAGTGCCTAGCATACAGTGG + Intergenic
940134880 2:150424991-150425013 ACACAGTGCCTGGCACACAGTGG - Intergenic
940358037 2:152767011-152767033 ATCCAGTTACTGCAATACAGTGG + Intergenic
940460936 2:153961914-153961936 AAACAGTGCCTGGCTTATAGTGG + Intronic
942070200 2:172309219-172309241 ATCCTGTGCCTGGCACACATAGG + Intergenic
944230908 2:197391410-197391432 GCACAGTGGCTGGCATACAGTGG + Exonic
944318317 2:198307115-198307137 GCCCAGTGCCTGGCACACAGTGG - Intronic
945401189 2:209385365-209385387 ACCCAGTGCATGCCATACACAGG - Intergenic
945679900 2:212901628-212901650 ATTAATTGCCTGGGATACAGAGG + Intergenic
945892206 2:215442086-215442108 ACCTAGTGCTGGGCATACAGAGG - Intergenic
946131553 2:217610693-217610715 ACCCAGTGCCTGGCACAGAGCGG + Intronic
946735519 2:222750780-222750802 CCACAGTGCCTTGCATACAGCGG - Intergenic
947182202 2:227421292-227421314 GTACAGTGCTTGGCACACAGTGG - Intergenic
947698814 2:232215739-232215761 AGCCAAAGCCTGGCACACAGGGG - Intronic
947702290 2:232244506-232244528 ATCCAGTTCATGGTATCCAGAGG + Intronic
948353345 2:237358774-237358796 CTCCAGTGCCTGGCACAAAGTGG - Intronic
948429364 2:237909359-237909381 AGCCTGTGCCTGTCATGCAGGGG + Intronic
1168798844 20:630890-630912 CTCCAGTGTCTGGCTGACAGTGG + Intergenic
1168837835 20:889699-889721 AAGCAGTGCCTGGCACACGGGGG + Intronic
1168862039 20:1052538-1052560 GCTCAGTGCCTGGCACACAGTGG - Intergenic
1168971711 20:1935746-1935768 GTCCAGTGCGTGGCACACAGTGG - Intronic
1169556002 20:6750684-6750706 AAACAGTGCCTGGCACATAGTGG - Intergenic
1169802327 20:9522899-9522921 GTCATGTTCCTGGCATACAGTGG + Intronic
1169854396 20:10087763-10087785 ATTTAGTGCCTGGCATACACTGG - Intergenic
1170640152 20:18144881-18144903 GCCCAGTGCCTGGTATGCAGAGG + Intronic
1170942314 20:20858692-20858714 GTGCAGAGCCTGGTATACAGTGG - Intergenic
1171178652 20:23074901-23074923 GACCAGGGCCTGGCATACTGTGG - Intergenic
1172062902 20:32199049-32199071 ATGCAGAGCCTGGCAAACAGTGG - Intronic
1172394046 20:34586652-34586674 ATGCAGAGCCTGGCACGCAGAGG + Intronic
1172487781 20:35309133-35309155 ATACAGAACCTGGCATAGAGTGG + Intronic
1172629439 20:36368094-36368116 GCCCCGTGCCTGGCATACAGTGG + Intronic
1172757287 20:37294893-37294915 CACCAGTGTCTGGCATTCAGGGG + Intronic
1172945126 20:38681457-38681479 GTGCAGTGCCTGGCACACACAGG - Intergenic
1173159484 20:40641785-40641807 AGCCTGTGCCTGGCACAGAGTGG - Intergenic
1173163802 20:40671899-40671921 ACACAGTGCCTGGCACAGAGGGG - Intergenic
1173349484 20:42232130-42232152 GTCCAATGCCTAGCATGCAGAGG + Intronic
1173381229 20:42544582-42544604 ACCCAAAGTCTGGCATACAGTGG - Intronic
1173413540 20:42836679-42836701 AGCCAGTGCCAGGAATTCAGTGG - Intronic
1173419900 20:42891762-42891784 ATACAGTGCCTGGCACACAGTGG - Intronic
1173523526 20:43715961-43715983 GTCCAGTGCCTGGAAGACGGTGG + Exonic
1173534400 20:43798344-43798366 GTCTGGTGCCTGGCACACAGAGG + Intergenic
1173606857 20:44337668-44337690 GTGCAGTGCCTGGCGCACAGTGG - Intronic
1174069028 20:47887120-47887142 AACCAATCCCTGGCAAACAGGGG - Intergenic
1174202929 20:48819806-48819828 GCACAGTGCCTGGCACACAGTGG + Intronic
1174569898 20:51494019-51494041 GTACAGTGCCTGGCAAAGAGTGG + Intronic
1174830620 20:53808885-53808907 GTTCAGTGCCTGGCACAGAGTGG + Intergenic
1174955660 20:55095015-55095037 ATCCAGAGCCTGGTACACAGTGG - Intergenic
1175606839 20:60318122-60318144 ACACAGTACCTGGCATGCAGTGG - Intergenic
1176305187 21:5119505-5119527 GCACAGTGCCTGGCACACAGGGG - Intronic
1177361072 21:20072051-20072073 ATCCACTGTCTCACATACAGCGG - Intergenic
1177491691 21:21833945-21833967 CTCCAGTGCCTGACATAAAATGG - Intergenic
1177946130 21:27471766-27471788 AAGCAGTGCCTGTCATACAGAGG - Intergenic
1178049480 21:28732329-28732351 TCACAGTGCCTGGCACACAGTGG - Intergenic
1178144263 21:29720417-29720439 ATCTAGTGCCTGGTAGAGAGGGG - Intronic
1178425358 21:32474651-32474673 AAGCAGTGCCAGGCATAGAGTGG + Intronic
1178993243 21:37373047-37373069 CTCCAGTGCCTGGCACATAGGGG + Intronic
1179288000 21:39994776-39994798 GCCCAGTGCCTGGTAAACAGTGG - Intergenic
1179851867 21:44142525-44142547 GCACAGTGCCTGGCACACAGGGG + Intronic
1180478029 22:15729555-15729577 AACCGGTGCCTGGCACACCGTGG + Intergenic
1181784891 22:25219871-25219893 GCACAGTGCCTGGCACACAGTGG + Intronic
1181978191 22:26747405-26747427 GAACAATGCCTGGCATACAGTGG - Intergenic
1181990984 22:26836520-26836542 ATGCAGTGCTTGTCATACAAGGG + Intergenic
1182129688 22:27841932-27841954 CTCCAGTGCCTGGCACACAGTGG - Intergenic
1182575273 22:31268735-31268757 GCCCAGTGCCTAGCATATAGAGG - Intronic
1182966716 22:34528499-34528521 ATACAGTGCTTGGCACACACAGG - Intergenic
1183000546 22:34855197-34855219 TTCCAGCACCTGGCATCCAGGGG - Intergenic
1183069088 22:35383829-35383851 AATCAGTACCTGGCATATAGTGG - Intronic
1183231144 22:36582876-36582898 AAAGAGGGCCTGGCATACAGGGG + Intronic
1183262696 22:36806088-36806110 GCACAGTGCCTGGCACACAGTGG + Intronic
1183480194 22:38059640-38059662 GTACAGTGCCTGGCACATAGTGG + Intronic
1183934111 22:41252397-41252419 ATGCAGTGCCTGGCAGAAAATGG + Intronic
1184280890 22:43436770-43436792 ACCCCGTGCCTGGCACACAGCGG - Intronic
1184310212 22:43636409-43636431 ACACAGTGCCTGGCACACACGGG - Intronic
1184425046 22:44404283-44404305 AACCAGTGGCTGCCAAACAGTGG + Intergenic
1184607682 22:45583495-45583517 CAGCAGTGCCTGGCACACAGTGG + Intronic
1184880764 22:47302997-47303019 TTCCAGTCCCTGGCTTAGAGTGG - Intergenic
1185051187 22:48555143-48555165 GCCCAGGGCCTGGCACACAGGGG + Intronic
949948866 3:9212803-9212825 ATCCACTGCTGGGCATACAGTGG + Intronic
950040512 3:9916659-9916681 CCCCAGAGCCTGGCAGACAGGGG - Intergenic
950159566 3:10750069-10750091 GTGCAGGGCCTGGCTTACAGTGG - Intergenic
950526925 3:13529618-13529640 AGCCAGAGCCTGGCACAAAGTGG - Intergenic
950581651 3:13866200-13866222 ACCCAGTGCCTGGCACATGGAGG - Intronic
950681114 3:14585724-14585746 AGTCAGTGCCTGGTATGCAGTGG - Intergenic
950738823 3:15033381-15033403 ACCCAGTGCCTGGCATGCAAGGG + Intronic
951044549 3:18023510-18023532 ATCCGGTGCCTAACCTACAGTGG + Intronic
952987152 3:38795794-38795816 ATCCAGAGTCTGAAATACAGTGG - Intergenic
953131441 3:40143161-40143183 ACACAGTGCCTGGCACATAGTGG + Intronic
953149135 3:40308930-40308952 ATCCTGGGCCTGGCATCGAGTGG - Intergenic
953647671 3:44769934-44769956 ATACAGTGCCTGTCATCCAGAGG - Intronic
954959478 3:54551322-54551344 AGCAGGTGCCTGGCACACAGTGG + Intronic
955145770 3:56317658-56317680 CCCCAGTGCCTGGCACATAGGGG - Intronic
955290856 3:57691362-57691384 ATGCAGTGCCTGGCACCTAGTGG - Intronic
955481296 3:59393245-59393267 GTACAGTGCCTGGCACACAGTGG - Intergenic
957029780 3:75227050-75227072 ATACAATGCCTGGAATGCAGTGG - Intergenic
957361762 3:79168719-79168741 AAACAGTGCCTGAAATACAGGGG - Intronic
957980019 3:87496983-87497005 TTTTAATGCCTGGCATACAGTGG - Intergenic
959631440 3:108511493-108511515 GTCCAGTGTTTGGTATACAGTGG - Intronic
959766693 3:110039357-110039379 ATACAGTGCCTGGCATGTTGTGG - Intergenic
960473812 3:118099332-118099354 ATCAGCTGCCTGGCCTACAGTGG + Intergenic
961363336 3:126381971-126381993 AGCCAGTAGCTGGCATACAGAGG + Intergenic
961870177 3:129981771-129981793 ATCCACTCCCCAGCATACAGTGG + Intergenic
962149642 3:132879350-132879372 GCACAGTGCCTGGCACACAGAGG + Intergenic
962650273 3:137481478-137481500 TCACAGTGCCTGGCATACAGTGG + Intergenic
962903952 3:139785046-139785068 GGCCAGTGCCTGCCATGCAGTGG + Intergenic
963128462 3:141836425-141836447 ACACAGTGCCTGGCACAGAGTGG + Intergenic
964066974 3:152592075-152592097 AGACAGTGACTGGCACACAGAGG - Intergenic
964191820 3:154011825-154011847 GCACAGAGCCTGGCATACAGTGG - Intergenic
965641612 3:170834784-170834806 ATACAGTGCCTGGCATGTTGTGG - Intronic
966004406 3:174991205-174991227 CACTAGTGGCTGGCATACAGCGG - Intronic
966152901 3:176884356-176884378 GCACAGTGCCTGGCATACAGTGG - Intergenic
966675492 3:182582958-182582980 ACACAGTGCCTGGTATACAGCGG - Intergenic
967414834 3:189204665-189204687 CTCCTGTGCCTGGAAAACAGAGG - Intronic
967440091 3:189497353-189497375 GTACAGTGCCTGGAATAGAGCGG - Intergenic
968982404 4:3857352-3857374 ATCCTGTGCCTAGTATACAGTGG - Intergenic
969038175 4:4272986-4273008 ATCCAGTCCCTGGCCTTCACGGG - Intronic
969428455 4:7139308-7139330 TGCCAGTGCCTGGCATGTAGTGG + Intergenic
969841900 4:9888951-9888973 TCCCAGTGCCTGGCACCCAGGGG - Intronic
970006645 4:11417334-11417356 AACCAATGCCTGGCAGACAGTGG - Intronic
970795719 4:19910572-19910594 AAACAGTGCCTGGTAAACAGAGG - Intergenic
970865481 4:20753835-20753857 CTCAAGTGACTTGCATACAGCGG + Intronic
971291847 4:25349947-25349969 AAACAGTGCCTGGCACACAGTGG - Intronic
972529817 4:39951309-39951331 ATCTACTGTCTGGCATACATGGG + Intronic
972689273 4:41381101-41381123 ATTCAGTGCCTGGCATTCAGTGG - Intronic
972741395 4:41890108-41890130 ATCCAGAGCCTGGCTTGCTGGGG + Intergenic
975095558 4:70453072-70453094 ATCCAGTGCTGTGCATACAGTGG - Intronic
975757718 4:77587585-77587607 GTACTGTACCTGGCATACAGTGG - Intronic
976300343 4:83510127-83510149 AGCAAGTGCCTGGCACACATGGG + Intronic
976330209 4:83822935-83822957 AACTAGTGCCTGACACACAGTGG - Intergenic
977174872 4:93807799-93807821 ATACAGTGCTTGGCACATAGTGG - Intergenic
979227744 4:118308810-118308832 GAACAGTGCCTGGCATACAGAGG + Intronic
980240347 4:130165379-130165401 TTACAGTGACTGGCACACAGTGG + Intergenic
982972317 4:162004827-162004849 CAACAGTCCCTGGCATACAGTGG + Intronic
983257509 4:165416856-165416878 GGACAGTGCCTGGCACACAGTGG + Intronic
984323350 4:178222708-178222730 GTCCAATGCCTGGTATAAAGTGG + Intergenic
984331548 4:178327149-178327171 ATACAGTGCCTGGCACATACTGG - Intergenic
984707057 4:182855320-182855342 GCTCAGTGCCTCGCATACAGTGG - Intergenic
985624844 5:979965-979987 CCCCAGTGCCTGGTATACAGTGG + Intronic
985988949 5:3539246-3539268 ATCCAGCGCCTGGTACACAGTGG + Intergenic
988335832 5:29908178-29908200 TTTCAGTTCCTGGCAGACAGTGG + Intergenic
988573184 5:32392255-32392277 ATACAGTTCCTGGCACACTGTGG + Intronic
988734106 5:34003378-34003400 GAACAGTGCCTGGCGTACAGTGG - Intronic
988842561 5:35097301-35097323 AAACAGTGCCTGGCATGCAGTGG - Intronic
989616420 5:43341107-43341129 ATCCTGTGCCTGGCTCAGAGGGG + Intergenic
990039131 5:51358002-51358024 ATCCAGTGCCTAGTAAACATGGG + Intergenic
990326144 5:54677263-54677285 CTACAGTGCCTGGCATAAAGGGG + Intergenic
990608528 5:57434592-57434614 ACCAAGTACCTAGCATACAGAGG - Intergenic
990742559 5:58927038-58927060 CTCCAATGCCTGGCTTATAGAGG - Intergenic
991561527 5:67958608-67958630 ACACAGTGCCTGGCATACGTAGG - Intergenic
992758270 5:79929646-79929668 GAACAGTGCCTGGCACACAGTGG - Intergenic
992768361 5:80024089-80024111 ACCCAGTGCCTGGCACATGGTGG - Intronic
992845038 5:80738236-80738258 ACCCACTACCTGGTATACAGGGG - Intronic
993048407 5:82895592-82895614 ACTCAGTGCCTGGCATAGAGTGG - Intergenic
993448400 5:88043178-88043200 GTACAGTGCCTGACATACAATGG + Intergenic
993875864 5:93306034-93306056 TTCCAGTGCCTGTAATTCAGAGG - Intergenic
995274842 5:110266410-110266432 AGTTAGTGCCTGGTATACAGAGG + Intergenic
995738010 5:115324209-115324231 TTACAGTGTCTGGCATATAGTGG - Intergenic
995767995 5:115639654-115639676 ACCTACTGCCTGGCACACAGAGG + Intergenic
996636427 5:125694869-125694891 ACACAGTCCCTGGCCTACAGAGG - Intergenic
997408855 5:133674705-133674727 ATACCATGCCTGGCACACAGTGG + Intergenic
997699300 5:135885264-135885286 ATCCAGTGCCAGGCATACAATGG + Intronic
997749312 5:136329308-136329330 TCTCAGTGCCTGGCATACAGTGG - Intronic
997851523 5:137337046-137337068 GAACAGTGCCTGGCACACAGTGG + Intronic
997879807 5:137579508-137579530 GTACAGGGCCTGGCATATAGTGG - Intronic
998191642 5:140030383-140030405 ATCCAGAGCTTGTCGTACAGAGG - Intronic
998213352 5:140218432-140218454 GGCCAGTGCCTAGTATACAGCGG - Intronic
998478652 5:142442895-142442917 ACACAGTGCCTGGCACATAGAGG + Intergenic
998500757 5:142630619-142630641 ATGCAGTGGCTGGAATAGAGGGG - Intronic
998775448 5:145595529-145595551 GTCCAGTGCCTGGCACACTGAGG - Intronic
1001117004 5:168948224-168948246 ATGCACTGCCTGGCACACAGTGG + Intronic
1001322407 5:170693403-170693425 ACCCAGAGCATGGCACACAGAGG - Intronic
1001576260 5:172765931-172765953 GTAAAGTGCCTGGCACACAGTGG - Intergenic
1002191497 5:177480276-177480298 TGTCAGTGCCTGGCATATAGTGG - Intergenic
1002309870 5:178307815-178307837 GCCCAGATCCTGGCATACAGTGG - Intronic
1002526787 5:179819656-179819678 AGCCACTGCCTTGCAGACAGGGG - Intronic
1002548066 5:179965274-179965296 GCACAGTGCCTGGCACACAGTGG + Intronic
1002878163 6:1229365-1229387 GTTCAGTGCCTGGCACATAGTGG - Intergenic
1002966963 6:1976396-1976418 ACCCAGTGCCTGGCACATAACGG + Intronic
1002994144 6:2267384-2267406 TCACAGTGCCTGGTATACAGTGG - Intergenic
1004065395 6:12239062-12239084 ACCCAGTTCCTGGCACACAGTGG + Intergenic
1004405397 6:15328316-15328338 GCCCAGTGCCTGGTACACAGCGG - Intronic
1004433784 6:15570104-15570126 GCAGAGTGCCTGGCATACAGTGG + Intronic
1004762820 6:18689196-18689218 ACACAGTGCCTGAAATACAGTGG - Intergenic
1004869551 6:19890839-19890861 AGTGAGTGCCTGGTATACAGTGG - Intergenic
1005091865 6:22065492-22065514 GTCCAGTACCTGGCACATAGAGG - Intergenic
1006130705 6:31867778-31867800 ACCCAGTGCCTGGCACATAGTGG + Intronic
1006737189 6:36282620-36282642 ATACAGTGCCTGGCACTCACAGG - Intronic
1006737611 6:36285668-36285690 ATATAGTGCCTGGAATACGGTGG - Intronic
1006839766 6:37021389-37021411 ATCCAGCGCCTGGTACCCAGTGG + Intronic
1007096245 6:39214952-39214974 ATCCAGCACTGGGCATACAGCGG + Intronic
1007467795 6:42066946-42066968 TTCCAGAGCCAGGCACACAGCGG - Intronic
1008703457 6:54129364-54129386 ATACAATGCCTGGAATACTGTGG + Intronic
1008831390 6:55766987-55767009 ATGCTGTGCCTGGCATATAATGG + Intronic
1009675815 6:66819212-66819234 ATTCAGTGCCTGTTATAAAGTGG - Intergenic
1011070942 6:83382284-83382306 GTAAAGTGCCTGGCATGCAGTGG + Intronic
1011960825 6:93087780-93087802 ACACGGTACCTGGCATACAGTGG + Intergenic
1013455348 6:110324840-110324862 TACCAGTGCCTGGCACAGAGTGG - Intronic
1014635962 6:123846902-123846924 GTACAGTGCCTGGAATAGAGTGG - Intronic
1014903939 6:127003530-127003552 ATAATGTGCCTGGCATACACTGG - Intergenic
1015160880 6:130151104-130151126 CTCCAGTGCCTGTCCTACAAAGG + Intronic
1015236657 6:130979000-130979022 TTCAAGTGCCTGGAACACAGGGG + Intronic
1015471484 6:133611504-133611526 AAGCATTGCCTGGCATAGAGTGG + Intergenic
1015845744 6:137519111-137519133 TTCCAGTGCTTTGCAGACAGTGG + Intergenic
1016224918 6:141723290-141723312 ATCATGTGCCTAGTATACAGTGG + Intergenic
1017540514 6:155397505-155397527 GAACAGTGCCTGGCATACAGTGG + Intronic
1017560751 6:155625671-155625693 AGCCAGTACCTGGCACAGAGTGG - Intergenic
1017572717 6:155764579-155764601 TACAAGAGCCTGGCATACAGGGG + Intergenic
1017590417 6:155973393-155973415 GCCCAGTTCCTGGCACACAGAGG + Intergenic
1019501232 7:1365739-1365761 GAACAGTGCCTGGCACACAGGGG - Intergenic
1019917138 7:4140754-4140776 ATGAAGTGCCTGGAATATAGAGG + Intronic
1020432181 7:8125705-8125727 TCCCAGTGCCTGGCACACAGTGG + Intronic
1021441549 7:20682677-20682699 AGACAATGCCTGGCACACAGTGG + Intronic
1021450934 7:20783884-20783906 ATCCAGTGCCTGGTAGACAGCGG - Intronic
1021606348 7:22413128-22413150 GCACAGTGCCTGGCACACAGAGG + Intergenic
1021764443 7:23932727-23932749 GCACAGTGCCTGGCATACAGTGG - Intergenic
1021865758 7:24955386-24955408 TTCCAGTGCTGGGAATACAGTGG + Intronic
1022798663 7:33753848-33753870 ACTATGTGCCTGGCATACAGGGG + Intergenic
1023851941 7:44155337-44155359 ATGCAGGGCCTGGCATATGGAGG - Intronic
1024193396 7:47035076-47035098 GTTCAGTGCCTGGCACATAGAGG - Intergenic
1024255133 7:47535148-47535170 GCCCAGCGCCTGGCAGACAGTGG + Intronic
1026256556 7:68716943-68716965 CTTCAGTCCCTGGCATGCAGTGG + Intergenic
1026773908 7:73219407-73219429 AGCTAGTGCCTGGCACACAGAGG - Intergenic
1027014765 7:74772797-74772819 ATCTAGTGCCTGGCACACAGAGG - Intergenic
1027073266 7:75173158-75173180 ATCTAGTGCCTGGCACACAGAGG + Intergenic
1027977228 7:85174304-85174326 TTACAGTGCCTGGCATGCAGCGG + Intronic
1028730933 7:94147516-94147538 CCCCAGTGCCTGGCATGTAGTGG + Intergenic
1030150303 7:106397959-106397981 ATCCAGTGACTGGCACTTAGGGG - Intergenic
1030670905 7:112335717-112335739 TTCCAGAGCCTGGCATACAGTGG - Intronic
1031406169 7:121390164-121390186 ATTAAGTGCCTGGCAACCAGAGG - Intronic
1031979381 7:128114959-128114981 GCCCAGTGCCTGGCACACAGTGG + Intergenic
1032240906 7:130158095-130158117 ATCCAGGGCCTGGACTGCAGAGG - Intergenic
1032283964 7:130527303-130527325 AGAGAGTGCCTGGCATACATGGG + Intronic
1032839010 7:135699303-135699325 GTCCAGTTCCTGACACACAGTGG + Intronic
1033605737 7:142927369-142927391 GTGCAGTGCCTGACATACAGCGG + Intronic
1034478733 7:151303713-151303735 AGCCAGTGCCTGGCATGGAGTGG - Intergenic
1035424604 7:158760835-158760857 ATCCAGTGCCTGGCACACCCAGG + Intronic
1036705542 8:11043546-11043568 ACCCAGTGCCTGCCCTCCAGGGG - Intronic
1038065987 8:23964253-23964275 ATCCATTGTTTGGCATCCAGTGG + Intergenic
1038075247 8:24065950-24065972 ATAGAGTGCCTGGCACATAGGGG + Intergenic
1038260705 8:25991394-25991416 GTTCAGTTCCTGGCATACAATGG - Intronic
1039009804 8:33080689-33080711 TTCCAGGGCCTGGAATGCAGAGG - Intergenic
1040060053 8:43096091-43096113 CCCCAGTGCCTGGCACACAGCGG - Intronic
1041244034 8:55874189-55874211 ATCTTGTTCCTGGCACACAGGGG + Intergenic
1042624442 8:70741433-70741455 ACCCAGTCCCTGGTATTCAGCGG + Intronic
1042701217 8:71617033-71617055 ATGCAGTGTCTGGCACAGAGAGG - Intergenic
1042809486 8:72808428-72808450 ATATAGTGCCTGGCATATAATGG + Intronic
1044819755 8:96147739-96147761 CTCCAGTACCTGGACTACAGTGG - Intronic
1045054906 8:98360409-98360431 GTCCAGTGCCTGTCATACTGTGG + Intergenic
1045593069 8:103620774-103620796 AGAAAGTGCCTGGCATATAGTGG + Intronic
1047221018 8:122918280-122918302 TTGCAGTGCCTGGCACACATGGG - Intronic
1047534850 8:125710075-125710097 ACCCTGTGCCTGGCACATAGTGG + Intergenic
1047586352 8:126278111-126278133 ATCAAAAGCCTGGCATTCAGTGG + Intergenic
1047985007 8:130223682-130223704 ATCTAGTATCTGGTATACAGTGG + Intronic
1048298064 8:133229645-133229667 GTCCAGTGCAAGGTATACAGTGG + Exonic
1049045480 8:140148004-140148026 AGCCAGTGCCTGGCACACAGTGG - Intronic
1049277137 8:141725510-141725532 ATACAGCACCTGGGATACAGTGG - Intergenic
1050932629 9:11349336-11349358 ATCCACAGCCTGACAGACAGTGG + Intergenic
1051589402 9:18761029-18761051 ATACAGTGCCTAGCACTCAGTGG + Intronic
1051909555 9:22137908-22137930 ATACAGTGCCTGGCACATATAGG - Intergenic
1053417706 9:37957110-37957132 CTCCAGCGCCTGACACACAGAGG + Intronic
1055415949 9:76083249-76083271 AACCAGTGCTTGGCATATAGTGG - Intronic
1057427926 9:94968803-94968825 ATCCAGTGCCTGATACACAGAGG - Intronic
1057748502 9:97771439-97771461 ACCCAGTGCCTGGCTCACAGGGG - Intergenic
1057778373 9:98029071-98029093 ACCCAGTGCTTGGAACACAGTGG - Intergenic
1057839807 9:98477151-98477173 CTACAGTGCCTGGTATACAGGGG + Intronic
1057866802 9:98687809-98687831 ACACAGTGCCTGGCACACAGAGG + Intronic
1057891874 9:98875739-98875761 GCCCAGTGCCTGGCACACAGAGG - Intergenic
1057942170 9:99294801-99294823 GCCCAGAGCCTGGCACACAGTGG - Intergenic
1057980823 9:99661119-99661141 AGCTAGTGCATGGCTTACAGTGG - Intergenic
1059222966 9:112643280-112643302 GCCCAGTGCCTGGCACAGAGAGG + Intronic
1059774713 9:117463554-117463576 GCCCAGTGCCTGGCACACAGTGG - Intergenic
1060019767 9:120119002-120119024 GCCCAGTGCCTGGCACAAAGTGG + Intergenic
1060260657 9:122071117-122071139 ATCCAGTGCCTGGCTTAGAGTGG + Intronic
1060265153 9:122107785-122107807 AAGCAGTGCCTGGCACGCAGTGG - Intergenic
1060784025 9:126434929-126434951 GCCCAGGGCCTAGCATACAGGGG + Intronic
1060912471 9:127361997-127362019 ACCCAGGGCCTGGTACACAGAGG - Intronic
1061694113 9:132358288-132358310 CTCCAGAGCCTGGGCTACAGAGG - Intergenic
1061934785 9:133851340-133851362 GTATAGTGCCTGGCACACAGTGG - Intronic
1185472213 X:390784-390806 ATCCAGAGCATGTCATACAGTGG - Intergenic
1185723463 X:2400558-2400580 ATTCAGTGCCTGAAACACAGTGG - Intronic
1185853045 X:3507111-3507133 TCCCAGTACCTGTCATACAGTGG - Intergenic
1186589871 X:10918528-10918550 GTATAGTGTCTGGCATACAGTGG + Intergenic
1188269949 X:28127100-28127122 ATCCAGAGACTGGCAGATAGGGG - Intergenic
1188382231 X:29508995-29509017 ACCAAGTGACTGGCATAAAGTGG - Intronic
1189222109 X:39381404-39381426 GTACAGTGCCTGGCACACAGTGG - Intergenic
1189337620 X:40179855-40179877 GTACAGTGCCTGGCACAAAGTGG - Intergenic
1190736655 X:53259912-53259934 GCACTGTGCCTGGCATACAGAGG - Intronic
1191764995 X:64688460-64688482 ATCCAGTGACTGGGTTACATTGG - Intergenic
1192085703 X:68095178-68095200 AAACAGTACCTGGCATAAAGTGG + Intronic
1192282889 X:69703171-69703193 AGCGAGTGCCTGGCACACACCGG + Intronic
1193881655 X:86930051-86930073 ATCCAGTACCTCACATACCGTGG - Intergenic
1195599509 X:106729184-106729206 GTAGAGTGCCTGGCATATAGTGG - Intronic
1195915056 X:109927811-109927833 ATCATGTGCCGGGCAGACAGTGG + Intergenic
1196150430 X:112367651-112367673 CCCCAGTGCCTGGCATATAGTGG - Intergenic
1198235736 X:134734490-134734512 CCCCAATGGCTGGCATACAGGGG + Intronic
1198585313 X:138114197-138114219 TTCCAGTGCCTGGCAGGGAGGGG + Intergenic
1198727851 X:139695829-139695851 TTCCAGGGCTTGGCATATAGTGG + Intronic
1198754830 X:139971543-139971565 ATTCCATGCCTGGCATACGGTGG - Intergenic
1199418565 X:147616022-147616044 ATGCTGTGCCTGGCACAAAGTGG + Intergenic
1199784276 X:151090449-151090471 ATACAGTGCCTGGCACAGAGTGG + Intergenic
1200229117 X:154435299-154435321 AACCAGTGCCGGGCAGACACTGG - Exonic
1200863750 Y:8020529-8020551 ACCCAGTGCCCTGCCTACAGGGG - Intergenic