ID: 1125736904

View in Genome Browser
Species Human (GRCh38)
Location 15:41933290-41933312
Sequence TCCTCCCCAGGATACACGTG TGG (reversed)
Strand -
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 136
Summary {0: 1, 1: 0, 2: 0, 3: 14, 4: 121}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125736904_1125736910 26 Left 1125736904 15:41933290-41933312 CCACACGTGTATCCTGGGGAGGA 0: 1
1: 0
2: 0
3: 14
4: 121
Right 1125736910 15:41933339-41933361 AGCTTCATAGATAACAGGAACGG 0: 1
1: 0
2: 1
3: 16
4: 172
1125736904_1125736909 21 Left 1125736904 15:41933290-41933312 CCACACGTGTATCCTGGGGAGGA 0: 1
1: 0
2: 0
3: 14
4: 121
Right 1125736909 15:41933334-41933356 CTCTGAGCTTCATAGATAACAGG 0: 1
1: 0
2: 0
3: 14
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125736904 Original CRISPR TCCTCCCCAGGATACACGTG TGG (reversed) Intronic
900506512 1:3032131-3032153 TCCTCCCCAGGGTGCCCGGGTGG - Intergenic
900624627 1:3602577-3602599 TCCTGCTCAGCACACACGTGGGG + Exonic
901303869 1:8218316-8218338 TCCTCCCCAGGCTACCTGTGGGG - Intergenic
902556788 1:17251447-17251469 TCATCCCCAGGCAACAGGTGAGG - Intronic
902792076 1:18776134-18776156 GCCCCCCCTGGATGCACGTGTGG - Intergenic
903662180 1:24984892-24984914 TCCTCACTAGGATGCAAGTGTGG - Intergenic
905100417 1:35516367-35516389 TCATCCCCAGGATGCAAGTTTGG + Intronic
905624955 1:39483430-39483452 GCCTACCCCAGATACACGTGTGG - Intronic
906871097 1:49481949-49481971 TCCTCCCCAGGATGCAAGATTGG - Intronic
908117531 1:60954453-60954475 GCCTCCCCAGAACGCACGTGGGG + Intronic
908981062 1:69959811-69959833 TCATCCCCAGGATACAAGGTTGG - Intronic
908984368 1:69999029-69999051 TCCTCCCCAGCAGCCAAGTGGGG + Intronic
914139890 1:144936581-144936603 TCCTCCCCAGGTTAGATGTAAGG - Intronic
920485058 1:206362120-206362142 TCCTCCCCAGGTTAGATGTAAGG + Intronic
1065762361 10:28994216-28994238 TCCTCCCCAGGACACACTTAGGG - Intergenic
1069876551 10:71566732-71566754 TCATCCCCAGAATACACCAGTGG + Intronic
1070403107 10:76070785-76070807 ACCTCCCCAGGATGAATGTGAGG - Intronic
1071213876 10:83376171-83376193 TCATCCCCAGGATGCAAGTTTGG + Intergenic
1071716661 10:88103873-88103895 TGCTCCCCAGGGTTCATGTGAGG + Intergenic
1076435810 10:130440580-130440602 TCCTGCCAAGGGTACACATGAGG + Intergenic
1076784295 10:132742008-132742030 TCCTCTCCAGGAGACTCGTGAGG - Intronic
1077524130 11:3054050-3054072 TCCTCCCCACGATTCATGTCTGG - Intronic
1078527968 11:12114893-12114915 GCCTCCACAGGTCACACGTGGGG + Intronic
1080663099 11:34313335-34313357 TCCTACCCAGGAGACAGCTGAGG - Intronic
1083252475 11:61477358-61477380 TCCTGCCCATGTTACATGTGAGG - Intronic
1084967563 11:72752450-72752472 CCCTCCCCGGGAGTCACGTGGGG - Intronic
1090882837 11:130849241-130849263 TCTTCCTCAGGATTCACATGTGG + Intergenic
1097809857 12:64006757-64006779 TCCCCCCCAGGACACACTGGTGG - Intronic
1097910361 12:64963051-64963073 TCATCCCCAGGATACAAGGTTGG - Intergenic
1098830346 12:75353808-75353830 TCATCCCCAGGATGCAAGTCTGG + Intronic
1101433407 12:104645346-104645368 TCATCCCCACCATACAGGTGAGG + Intronic
1101519497 12:105468407-105468429 TCCTACACAGGATACGGGTGGGG - Intergenic
1102795569 12:115686411-115686433 TCATCCCCAGGACACAGATGTGG - Intergenic
1106958557 13:34971677-34971699 TCATCCCCAGGATACAAGGTTGG - Intronic
1107314445 13:39116314-39116336 TCATCCCCAGGATACAAGGCTGG - Intergenic
1108502850 13:51084224-51084246 TCCTCCCCAGGAGACAACTGGGG + Intergenic
1110175788 13:72553984-72554006 TCCTCCCCTGGAGTCCCGTGAGG + Intergenic
1113436901 13:110299565-110299587 TCATCCCCATCATACACATGAGG + Intronic
1113489571 13:110680533-110680555 TCCTCACCAGGAGACACGTAAGG - Intronic
1113875595 13:113592731-113592753 TCCTGCCCAGGTGACAGGTGTGG + Intronic
1114193865 14:20460797-20460819 TCCTCCCCAGGCAACACGGCTGG + Exonic
1114675925 14:24440377-24440399 TCTTCCCCTGGATACACATCGGG - Exonic
1114958519 14:27852714-27852736 TCATCCCCAGGATACAAGGCTGG + Intergenic
1121003466 14:90470011-90470033 TCCTCCCCAGGTTACAAGTTTGG - Intergenic
1121634645 14:95445732-95445754 TCCTACCCAGTTTACACATGAGG + Intronic
1124642214 15:31402673-31402695 GCCTCCCCAGGCTCCACCTGGGG - Intronic
1125736904 15:41933290-41933312 TCCTCCCCAGGATACACGTGTGG - Intronic
1131786748 15:95921619-95921641 TCCTCCCCAGGACATTCCTGGGG + Intergenic
1133284058 16:4682529-4682551 TCCTCCCCAGGAACCACCAGCGG + Intronic
1135660818 16:24295006-24295028 TCCTCCCCAACATGCATGTGAGG - Intronic
1136268421 16:29133987-29134009 TCCTTCCCAGGGTCCACGGGCGG + Intergenic
1141394588 16:83693227-83693249 TCCTCCCCATGTTTCAGGTGGGG - Intronic
1141501918 16:84450410-84450432 TCTTCCCCTGGATGCATGTGGGG - Intronic
1142071722 16:88094291-88094313 TCCTTCCCAGGGTCCACGGGCGG + Intronic
1142139572 16:88466844-88466866 TCATGCCCATGATACAAGTGAGG - Intronic
1143961500 17:10724889-10724911 TCCTCCACAGGGTACACTGGGGG + Intronic
1144146543 17:12404572-12404594 ACCTCCCCAGGTTACAGGTGAGG - Intergenic
1145246167 17:21271159-21271181 ACCTCCCCAGGAAAGACATGTGG - Intergenic
1154484966 18:14866145-14866167 GCCTCCTCAGCATGCACGTGGGG - Intergenic
1167535543 19:50048838-50048860 CCCTCCCCAGCAAAGACGTGAGG - Intronic
926042100 2:9681557-9681579 CCCTCCCCAGGAAACAAATGTGG + Intergenic
926471110 2:13259478-13259500 TAATCCCCAGGACACACCTGGGG - Intergenic
931691785 2:64839818-64839840 TCATCCCCAGTACACAGGTGAGG - Intergenic
937606923 2:123811625-123811647 TCATCCCCAGGATGCAAGTTTGG + Intergenic
948139770 2:235663838-235663860 TCCTCTACAGGATTCACGGGAGG - Intronic
948594705 2:239072512-239072534 GCCTCCCCAGCACACGCGTGTGG + Intronic
948981522 2:241497143-241497165 CCCTCCCCAGGCTCCAGGTGGGG + Intronic
1171462771 20:25308297-25308319 CCCTTCCCATGATACACCTGAGG - Intronic
1176026708 20:62989718-62989740 TCCACGCCAGGAAACAGGTGTGG - Intergenic
1180081133 21:45488104-45488126 CCCTGCCCAAGAGACACGTGGGG + Intronic
1181055802 22:20260051-20260073 CCCTCCCCAGGGGACACTTGGGG + Intronic
1182667048 22:31967609-31967631 TCCTCCCCAGGAAACTCGGGAGG - Intergenic
950652536 3:14416295-14416317 CCCTCCCCAGCACACACGTCTGG + Intronic
950659262 3:14456683-14456705 TCCTGCCCAGGATGCTCTTGGGG - Intronic
952679161 3:36071339-36071361 TCATCCCCAGGATACAAGGTTGG - Intergenic
955349506 3:58183473-58183495 TGCTCCACAGGAGGCACGTGGGG - Intergenic
956157562 3:66314440-66314462 TCATCCCCAGGATGCACGGCTGG - Intronic
956739611 3:72265390-72265412 TCCTCCCCAGGGTAGATGTCAGG - Intergenic
960370256 3:116827802-116827824 TCTTGCACAGGAAACACGTGGGG + Intronic
961716223 3:128859351-128859373 TCCAACCCAGGATACAAGAGTGG - Intergenic
963415939 3:144995688-144995710 TCCTCCCCAGGATGCAAGGCTGG - Intergenic
964198064 3:154087565-154087587 TCATCTCCATGATACAAGTGAGG - Intergenic
969754352 4:9138626-9138648 TCATCCCCAAGTTACACATGAGG + Intergenic
969789448 4:9481836-9481858 TCCTTCCCAGTATCCAGGTGGGG - Intergenic
972919006 4:43914910-43914932 TCCTCCCTGGGATACAAGTTTGG + Intergenic
977757415 4:100689433-100689455 TCCTCCCATGGGTACAAGTGGGG - Intronic
979068163 4:116166124-116166146 TCATCCCCAGGATACAAGGTTGG - Intergenic
983839281 4:172436426-172436448 TTCTCCCCAGGAGACACCTGGGG + Intronic
990940381 5:61197161-61197183 TCATCCCCAGGATACAAGGCTGG - Intergenic
992355686 5:75980531-75980553 TCATCCCCGGGATACAAGTTGGG + Intergenic
1000405853 5:160887746-160887768 TCTTCCCCAAGATACCTGTGTGG + Intergenic
1001998161 5:176178687-176178709 TCCTCCCTAGAATCCACCTGTGG + Intergenic
1001998465 5:176181103-176181125 TCCTCCCCAGAATCCACCAGTGG + Intergenic
1002214469 5:177620190-177620212 TCCTCCCCAGGAAACTTCTGAGG - Intergenic
1002592469 5:180300153-180300175 TCCAGCCCATGATACAGGTGAGG + Intergenic
1006519960 6:34565520-34565542 CCCTCCCCAGGATCCACATGTGG + Intergenic
1013463152 6:110394776-110394798 TCCTCCCCATGATGCAGATGAGG - Intronic
1015232166 6:130927658-130927680 TCCTCCTCAAGATACATGTGTGG - Intronic
1015784547 6:136908580-136908602 TCCGCCCAAGGATACACAAGTGG - Intronic
1017180988 6:151551725-151551747 TCCTCCCCAGGATTGACCAGGGG - Intronic
1017876228 6:158526537-158526559 TCATCCCCAGGATGCACGGCTGG + Intergenic
1019745691 7:2699480-2699502 ACGTCCCCAGGACACACGTGAGG - Intronic
1020702662 7:11502452-11502474 TCATCCCCAGGATACAAGACTGG + Intronic
1022075926 7:26970490-26970512 TCATCCCCAGGATGCAAGTTTGG - Intronic
1023254765 7:38302103-38302125 TCCTCCCTAGGAGACAGGAGAGG + Intergenic
1023968525 7:44975940-44975962 TCCTCCCCAGGCTGCAGCTGAGG - Intronic
1024062406 7:45708891-45708913 TCCTCCTCACGACACAGGTGAGG - Intronic
1024654248 7:51435613-51435635 TCCTTCCCAGTTTACAGGTGAGG - Intergenic
1026309581 7:69172085-69172107 TCCTCCCCATGAGACACCTAAGG - Intergenic
1030813282 7:114003143-114003165 TCATCCCCAGGATACAAGCTTGG + Intronic
1033791949 7:144800856-144800878 TCATCCCCAGGATACAAGGCTGG + Intronic
1038275257 8:26115909-26115931 TCCTCACTAGGGGACACGTGGGG + Intergenic
1042046119 8:64653816-64653838 TCATCCCCAGGATGCAAGTTTGG + Intronic
1042523245 8:69736538-69736560 TGTTCCCCAGGATACACATAGGG - Intronic
1045594151 8:103633365-103633387 TCATCCCCAGGATGCAAGTTTGG - Intronic
1049600609 8:143505696-143505718 TCCGCCCCAGGATGCACATGTGG - Intronic
1050163203 9:2739144-2739166 TCTTCCCCAGGATACCTGTGGGG - Intronic
1050166919 9:2774596-2774618 TCATCCCCAGGATACAAGGCTGG + Intronic
1055205768 9:73728577-73728599 TCCTGCCCCACATACACGTGAGG + Intergenic
1055556081 9:77475452-77475474 TCATCCCCAGGATACATTTTAGG - Intronic
1056757116 9:89388780-89388802 CCCTCCCCAGGAACAACGTGGGG - Exonic
1057670423 9:97082160-97082182 TCATCCCCAGGATGCAAGAGTGG + Intergenic
1057803095 9:98201786-98201808 TCCTGCCCAGGAGACACCTCGGG + Intronic
1062590016 9:137270055-137270077 ACCTCCCCGGGGTCCACGTGGGG + Intronic
1186106127 X:6208551-6208573 TCATGCCCAGTATACACGTCGGG + Intronic
1188427035 X:30060867-30060889 TGCTCCCCAGGATACTCTTTTGG + Intergenic
1190604453 X:52126494-52126516 TCTTCCCCAGGAGCCACTTGAGG - Intergenic
1191039165 X:56060510-56060532 TCATCCCCAGGATGCAAGGGTGG - Intergenic
1191651473 X:63542744-63542766 TCATCCCCAGGATACAAGGATGG + Intergenic
1191743363 X:64459905-64459927 TCATCCCCAGGATGCAAGTTTGG - Intergenic
1192564186 X:72149574-72149596 TCTTCGCCATGATACACATGGGG - Intergenic
1192784743 X:74325054-74325076 TCCTGCCCAGGATGTAGGTGGGG - Intergenic
1192982625 X:76362787-76362809 TCATCCCCAGGATGCAAGTTTGG - Intergenic
1193030592 X:76893896-76893918 TCATCCCCAGGATGCAAGTTTGG + Intergenic
1193316328 X:80069736-80069758 TCATCCCCAGGATACAAGATTGG - Intergenic
1196468487 X:115996957-115996979 TCATCCCCAGGATGCAAGTTTGG - Intergenic