ID: 1125738028

View in Genome Browser
Species Human (GRCh38)
Location 15:41942164-41942186
Sequence CGTAAGTCAACTCTGTCCTC TGG
Strand +
Crispr in exon? No
Crispr in intron? Yes
Off-Target Counts All Exonic Intronic Intergenic
Total 74
Summary {0: 1, 1: 0, 2: 0, 3: 9, 4: 64}

Found 8 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125738022_1125738028 2 Left 1125738022 15:41942139-41942161 CCCTCCCGATCAGGCATTTCCTC 0: 1
1: 0
2: 0
3: 9
4: 133
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738024_1125738028 -2 Left 1125738024 15:41942143-41942165 CCCGATCAGGCATTTCCTCTCCG 0: 1
1: 0
2: 0
3: 14
4: 101
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738017_1125738028 28 Left 1125738017 15:41942113-41942135 CCTGTGATGGCAGGAACCCATCC 0: 1
1: 0
2: 0
3: 9
4: 140
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738019_1125738028 11 Left 1125738019 15:41942130-41942152 CCATCCTGACCCTCCCGATCAGG 0: 1
1: 0
2: 0
3: 13
4: 322
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738021_1125738028 7 Left 1125738021 15:41942134-41942156 CCTGACCCTCCCGATCAGGCATT 0: 1
1: 0
2: 1
3: 3
4: 63
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738018_1125738028 12 Left 1125738018 15:41942129-41942151 CCCATCCTGACCCTCCCGATCAG 0: 1
1: 0
2: 0
3: 6
4: 134
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738023_1125738028 1 Left 1125738023 15:41942140-41942162 CCTCCCGATCAGGCATTTCCTCT 0: 1
1: 0
2: 0
3: 9
4: 100
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64
1125738025_1125738028 -3 Left 1125738025 15:41942144-41942166 CCGATCAGGCATTTCCTCTCCGT 0: 1
1: 0
2: 0
3: 13
4: 120
Right 1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG 0: 1
1: 0
2: 0
3: 9
4: 64

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125738028 Original CRISPR CGTAAGTCAACTCTGTCCTC TGG Intronic
901550190 1:9990249-9990271 TGTGAGTCAACACTGTCATCGGG + Intergenic
912379487 1:109239680-109239702 GGTAAGTCAGCTGGGTCCTCAGG - Intergenic
923152980 1:231251341-231251363 CGTAAGTGAAATATGTCGTCTGG + Intronic
923940007 1:238811568-238811590 CCTAAATCAACCCTGTCCTTGGG + Intergenic
1077489442 11:2853661-2853683 CATGAGTCTTCTCTGTCCTCGGG - Intergenic
1078194569 11:9124827-9124849 GGCCAGTCATCTCTGTCCTCTGG - Intronic
1078770798 11:14349749-14349771 AGTATTTGAACTCTGTCCTCAGG - Intronic
1080643054 11:34169146-34169168 AGTAAGTCAAGTCTGTCCGCAGG - Intronic
1087173692 11:95076700-95076722 AGTAAATCATCTCTTTCCTCTGG + Intergenic
1089513069 11:119013038-119013060 TCTAAGACAACCCTGTCCTCAGG - Intronic
1096995847 12:55837703-55837725 AACAAGTCACCTCTGTCCTCAGG + Intronic
1098694431 12:73534817-73534839 CAAAAGTCTACTCTGTCATCTGG + Intergenic
1100984841 12:100194007-100194029 TGTAAGTAAGCTCTCTCCTCTGG + Intergenic
1102012176 12:109625597-109625619 CCTAAGCCCTCTCTGTCCTCAGG + Intergenic
1108462231 13:50678080-50678102 CGTGAGTCTCCTCTGCCCTCTGG - Intronic
1112316436 13:98366559-98366581 CCAGAGTCAACTCTGTCTTCAGG - Intronic
1114428697 14:22642028-22642050 CAGAGGTCAACTCAGTCCTCGGG - Intergenic
1118904373 14:70012930-70012952 CTTAAGTCAACTTTGACCACTGG + Intronic
1125738028 15:41942164-41942186 CGTAAGTCAACTCTGTCCTCTGG + Intronic
1129411794 15:75354475-75354497 CATACCTCCACTCTGTCCTCAGG - Exonic
1132748294 16:1445978-1446000 CGTGAGTCACCCCAGTCCTCTGG + Exonic
1137513768 16:49124776-49124798 GGCAAGTCACCTCTGGCCTCTGG - Intergenic
1140926371 16:79588348-79588370 CATCAGTCAACTCTGTCCTTTGG - Intronic
1141784595 16:86190657-86190679 TATCAGTTAACTCTGTCCTCTGG + Intergenic
1142314081 16:89332395-89332417 TGTAAGGCATCTCTGTCCTCGGG - Intronic
1144074101 17:11701427-11701449 CCTAAGTCAACCCTGACCTTGGG + Intronic
1144117411 17:12111862-12111884 CATGTGTTAACTCTGTCCTCAGG + Intronic
1144414292 17:15031796-15031818 TGTGTGTCAACTCTGTCCTCTGG - Intergenic
1150440433 17:65186973-65186995 TGTAAGTCCACTCTGGCCCCAGG + Intronic
1151718987 17:75845076-75845098 CGGGAGCCAAGTCTGTCCTCAGG - Intergenic
1152221866 17:79073254-79073276 CCTAAGTCCTTTCTGTCCTCAGG + Intergenic
1154945387 18:21157356-21157378 GGTGAGGCAGCTCTGTCCTCAGG + Intergenic
1156204498 18:34871426-34871448 CATAAATCAACTCTCTCCTTGGG + Intronic
1160093198 18:75846320-75846342 AGGAAGTCAAGTCTGTCCTCAGG + Intergenic
1165737052 19:38183491-38183513 CTCAAGGCAAGTCTGTCCTCCGG - Intronic
931355864 2:61537540-61537562 GGTAAGTCGACTGTGTCTTCGGG - Exonic
933299799 2:80528874-80528896 CAAAAGTCTAATCTGTCCTCAGG - Intronic
934968045 2:98740200-98740222 CGTAACTCAACTGTGTGTTCAGG - Intergenic
935037578 2:99393743-99393765 CGTAAGTCCACTCCATACTCAGG - Intronic
946057446 2:216914502-216914524 GGTACCTCAACTCTGTGCTCAGG + Intergenic
948147313 2:235717164-235717186 CGTCACTCACCTCTGCCCTCGGG + Intronic
948262449 2:236614161-236614183 CGAAAGTCAGCTCGGTCCACAGG + Intergenic
948718755 2:239883013-239883035 GGGAGGTCAACTCTGCCCTCAGG + Intergenic
1170111553 20:12809035-12809057 CCTGAGGCAAATCTGTCCTCTGG - Intergenic
1171206058 20:23282430-23282452 CAAAATTCAACTCTGTTCTCTGG - Intergenic
1172434072 20:34915910-34915932 AGTAAGTCAATTCTCCCCTCTGG + Intronic
1172989409 20:39021935-39021957 AGTAAGTCAGCTCTGTCCCCAGG + Exonic
1181305029 22:21911355-21911377 CTAGAGACAACTCTGTCCTCTGG + Intergenic
1185362339 22:50415837-50415859 CGTATGTAAGCTCTGTCTTCAGG - Intronic
955083029 3:55675393-55675415 CGTACCTTAACTCTGTCCTCAGG - Intronic
958944177 3:100346039-100346061 TGTAAATTATCTCTGTCCTCAGG + Intronic
965886977 3:173458015-173458037 CTTAATTCATCTCTGTACTCTGG - Intronic
966603430 3:181798227-181798249 CGTAAGTTTCCTCTTTCCTCTGG + Intergenic
975029848 4:69601279-69601301 GGTCAGTCAAGTCTGTGCTCTGG - Intronic
979568627 4:122187362-122187384 AGGAAGTGAACTATGTCCTCAGG + Intronic
979957165 4:126968244-126968266 CATAAATCATCTCAGTCCTCTGG - Intergenic
983095463 4:163556051-163556073 GGTAAGTCAACTCAGTGCTCTGG - Intronic
983731012 4:170993293-170993315 CATAAATTAATTCTGTCCTCTGG + Intergenic
986161676 5:5235084-5235106 CGGAAGTCAACACTGTCCCGGGG - Exonic
991372005 5:65928058-65928080 AGAAAATCAACTCTCTCCTCGGG - Intronic
993203938 5:84854579-84854601 CATGAGTCTGCTCTGTCCTCTGG - Intergenic
996450085 5:123611279-123611301 CATAAGGCAATGCTGTCCTCTGG + Intronic
1006800364 6:36756056-36756078 TGCAAGTCAACTCTCTCCCCTGG + Intronic
1014808062 6:125853855-125853877 CTTAAGAGAACTCTGACCTCAGG - Intronic
1014813061 6:125906788-125906810 CAGAACTCAACTCTGCCCTCTGG - Intronic
1020366587 7:7387039-7387061 ATTAGGTCACCTCTGTCCTCAGG - Intronic
1023686220 7:42738045-42738067 CCTCAGTCAACTCTGTCCATGGG + Intergenic
1023844254 7:44112212-44112234 CGGATCTCAACTCTGTGCTCTGG + Exonic
1042791439 8:72611375-72611397 AGTGAGTCAACTCTGTTCCCAGG - Intronic
1047645692 8:126867540-126867562 CATAAGTCAACACTGCCCTGGGG + Intergenic
1049178192 8:141206690-141206712 AGTGAGTCATCTCTGTCCTCTGG - Intergenic
1060423888 9:123488740-123488762 ATAAAGTAAACTCTGTCCTCTGG + Intronic
1199937592 X:152590678-152590700 AGCAAGTCAGCTCTGTCCTTAGG - Intergenic
1200377522 X:155799362-155799384 TCTAATTCACCTCTGTCCTCTGG - Intergenic