ID: 1125742115

View in Genome Browser
Species Human (GRCh38)
Location 15:41972512-41972534
Sequence CTCGGATGGGACCCTGCTCC GGG
Strand +
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 126
Summary {0: 1, 1: 0, 2: 1, 3: 8, 4: 116}

Found 12 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125742101_1125742115 19 Left 1125742101 15:41972470-41972492 CCTGCCGCCCCATCCAGCTGAAC 0: 1
1: 0
2: 0
3: 23
4: 233
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742105_1125742115 10 Left 1125742105 15:41972479-41972501 CCATCCAGCTGAACATCCTGCCG 0: 1
1: 0
2: 0
3: 9
4: 123
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742097_1125742115 27 Left 1125742097 15:41972462-41972484 CCCGCCCGCCTGCCGCCCCATCC 0: 1
1: 2
2: 26
3: 799
4: 4729
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742103_1125742115 12 Left 1125742103 15:41972477-41972499 CCCCATCCAGCTGAACATCCTGC 0: 1
1: 0
2: 2
3: 24
4: 201
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742098_1125742115 26 Left 1125742098 15:41972463-41972485 CCGCCCGCCTGCCGCCCCATCCA 0: 1
1: 0
2: 11
3: 154
4: 1097
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742110_1125742115 -10 Left 1125742110 15:41972499-41972521 CCGCCAGTCCACGCTCGGATGGG 0: 1
1: 0
2: 0
3: 3
4: 42
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742100_1125742115 22 Left 1125742100 15:41972467-41972489 CCGCCTGCCGCCCCATCCAGCTG 0: 1
1: 0
2: 7
3: 50
4: 563
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742104_1125742115 11 Left 1125742104 15:41972478-41972500 CCCATCCAGCTGAACATCCTGCC 0: 1
1: 0
2: 1
3: 19
4: 155
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742102_1125742115 15 Left 1125742102 15:41972474-41972496 CCGCCCCATCCAGCTGAACATCC 0: 1
1: 0
2: 2
3: 26
4: 334
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742108_1125742115 -6 Left 1125742108 15:41972495-41972517 CCTGCCGCCAGTCCACGCTCGGA 0: 1
1: 0
2: 0
3: 4
4: 53
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742106_1125742115 6 Left 1125742106 15:41972483-41972505 CCAGCTGAACATCCTGCCGCCAG 0: 1
1: 0
2: 1
3: 10
4: 110
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116
1125742099_1125742115 23 Left 1125742099 15:41972466-41972488 CCCGCCTGCCGCCCCATCCAGCT 0: 1
1: 0
2: 3
3: 92
4: 1698
Right 1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG 0: 1
1: 0
2: 1
3: 8
4: 116

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125742115 Original CRISPR CTCGGATGGGACCCTGCTCC GGG Exonic
902215343 1:14931076-14931098 CTGGGAAGGGACCATACTCCAGG + Intronic
902951315 1:19885047-19885069 CTCAGATGGGACCGTTCTCTTGG - Intronic
905794578 1:40808443-40808465 CTCCCATGGGACCCCTCTCCAGG + Intronic
906154657 1:43606837-43606859 CTCGGATGAGATCGTGGTCCAGG + Exonic
907300523 1:53483910-53483932 CTAGGATGTGGCCCTGCTCAAGG + Intergenic
915377308 1:155408172-155408194 CTCGGATGGTACCTTGATTCTGG + Intronic
916321097 1:163505053-163505075 CTCCGATGGGCTCCTGCTCTTGG - Intergenic
922723962 1:227914080-227914102 CTCAGATGAGACCCTGGCCCTGG + Intergenic
922791503 1:228313726-228313748 GCTGGATGGGACCCTGCTACAGG + Intronic
1063701544 10:8389257-8389279 CTCAGATGGCTCCATGCTCCTGG - Intergenic
1067839965 10:49667615-49667637 CTGGGAAAGGAGCCTGCTCCAGG + Intergenic
1076587555 10:131559808-131559830 CCCGGCAGGGACCCTGCACCTGG - Intergenic
1076727736 10:132421316-132421338 CGCAGATGGGGCCCTGCCCCTGG + Intergenic
1077293988 11:1815471-1815493 CTCCCATGGGGCCCTTCTCCTGG - Intergenic
1077918509 11:6626168-6626190 CTTGGAGGGGCCCCTGCTGCAGG - Exonic
1078428567 11:11270231-11270253 CTGGGAGGGGAATCTGCTCCAGG - Intergenic
1079237101 11:18698852-18698874 GGCGGCTGGCACCCTGCTCCGGG - Exonic
1080154048 11:29087631-29087653 CTCGGGTGGTATCCTGCTTCTGG - Intergenic
1082794745 11:57370862-57370884 GTAGGCTGGGACCCTGTTCCAGG + Intergenic
1084166609 11:67377753-67377775 CACTGATGGGACCCTGGCCCAGG + Intronic
1084944457 11:72631228-72631250 CACGGATGGCCCCCTCCTCCAGG + Intronic
1090281024 11:125456041-125456063 CACGGATGGCACCCTCCACCTGG + Exonic
1091410676 12:237250-237272 CTCTGATGGGATCCAGCACCTGG - Exonic
1092222365 12:6723802-6723824 CTCTGGTGGGTCCCTGGTCCCGG - Exonic
1092948246 12:13476346-13476368 CTCTGGAGGGACCCTCCTCCAGG - Intergenic
1096867104 12:54571133-54571155 CTGGGAGGGGACCCTCCACCTGG - Intronic
1100408644 12:94293522-94293544 CTCGGTGAGGACCCTCCTCCTGG + Intronic
1101578684 12:106021915-106021937 CTGGAATGAGACCCTGCTCTTGG + Intergenic
1103340227 12:120217003-120217025 CTGGGATGGGGTCCTGCTCAAGG + Intronic
1104728697 12:131093485-131093507 CTCAGATGGGCCCTGGCTCCAGG + Intronic
1105242754 13:18622209-18622231 CTCTGCAGGGCCCCTGCTCCTGG - Intergenic
1105848834 13:24316711-24316733 CTAGGTTGGGACCCTGTCCCAGG + Intronic
1114919671 14:27311037-27311059 CAAGGATGGCACCCTTCTCCTGG - Intergenic
1121269926 14:92631231-92631253 CTGGGCTGGGAGCCTGTTCCTGG + Intronic
1122297581 14:100713967-100713989 CTGGGATGGGGCCAGGCTCCGGG + Intergenic
1125742115 15:41972512-41972534 CTCGGATGGGACCCTGCTCCGGG + Exonic
1127610077 15:60628161-60628183 ATCGGATGGGATCCTGCAACAGG - Intronic
1128320484 15:66690379-66690401 CTCTGAGGACACCCTGCTCCTGG + Intergenic
1132974801 16:2705924-2705946 CTCAGATGCCACACTGCTCCTGG + Intronic
1134085403 16:11353986-11354008 CCCGGATGGGACCCTGGAACAGG - Intergenic
1136398264 16:30004701-30004723 CTTGGATGGGCCCCTCCTCGGGG - Intronic
1137029288 16:35506914-35506936 CTAGGATGCCAGCCTGCTCCGGG + Intergenic
1137702336 16:50506291-50506313 CCAGGCTGGAACCCTGCTCCTGG - Intergenic
1138446344 16:57066610-57066632 CTCAGGTGGGACCCAGCACCAGG + Exonic
1139509109 16:67416318-67416340 CCGGGATGGGGCCCCGCTCCCGG - Exonic
1145270336 17:21401396-21401418 CTCGGCTGGAACCCTCCTGCTGG + Intronic
1152754312 17:82080779-82080801 CTCGGAGCGGCCCCTGTTCCTGG - Exonic
1154132873 18:11751573-11751595 CTCGGACGCGTCCCTGCTCCTGG - Intronic
1154446184 18:14437668-14437690 CTCTGCAGGGCCCCTGCTCCTGG + Intergenic
1158075227 18:53520284-53520306 TTTGGATTGGACCATGCTCCAGG + Intronic
1160015669 18:75138504-75138526 CTCCCATGAGGCCCTGCTCCTGG + Intergenic
1161032567 19:2064957-2064979 ACTGGATGGGATCCTGCTCCCGG - Intergenic
1161925217 19:7294418-7294440 CTAGGAAGGGACTCTGCGCCCGG + Intergenic
1162353624 19:10166722-10166744 CTCGGGGGGGGCCCTGCACCGGG + Intronic
1163144588 19:15372030-15372052 ACCGGATGGGACCGTTCTCCGGG - Intronic
1163509665 19:17727214-17727236 CTGGGATCGGCCCCAGCTCCAGG - Exonic
1166225038 19:41389788-41389810 CTCTGATGGGACCCTCGTGCTGG - Exonic
1167727398 19:51225658-51225680 CTGGGATGGGACCCTGGTACTGG + Intronic
926692348 2:15746164-15746186 CTCAGATGGGACCCCGCTGAGGG + Intergenic
936148653 2:109998084-109998106 CTCAGCTGGGACCCCTCTCCAGG - Intergenic
936196025 2:110373284-110373306 CTCAGCTGGGACCCCTCTCCAGG + Intergenic
936236438 2:110746522-110746544 CCAGCATGGGACCCGGCTCCTGG + Intronic
938381302 2:130837745-130837767 CTCCGATGGGCTCCTACTCCGGG + Intronic
945699537 2:213152261-213152283 CTCGGCCGGGACGCGGCTCCCGG - Intronic
946010304 2:216559134-216559156 CCCTGATGGGAGCCTGCTCATGG - Intronic
947251203 2:228106379-228106401 CTCTGGGGGGACCCAGCTCCAGG - Intronic
948217202 2:236240562-236240584 CTCGGATGGCACCCTGCTTTGGG - Intronic
948976018 2:241464331-241464353 CTCTTAGGGGACCCTGCTCTGGG - Intronic
948980949 2:241494472-241494494 CTCGGCAGGGACCCTGCTCTGGG - Exonic
1172749264 20:37238474-37238496 CGGGGAAGGGACCCTGCTTCTGG - Intronic
1173809533 20:45947716-45947738 CGCGGCTAGGACCCTGCTCACGG - Exonic
1174528617 20:51193320-51193342 CTCGGTCGGGGCCCTGCTCTAGG - Intergenic
1174658723 20:52192283-52192305 CGCGGAGGGACCCCTGCTCCAGG + Intronic
1175402818 20:58710309-58710331 CTGGCATGGGCCACTGCTCCTGG + Intronic
1176304305 21:5115249-5115271 CTTGGCTGGGACTCAGCTCCGGG - Intergenic
1176449798 21:6852178-6852200 CTCTGCAGGGCCCCTGCTCCTGG - Intergenic
1176827970 21:13717202-13717224 CTCTGCAGGGCCCCTGCTCCTGG - Intergenic
1177651359 21:23965074-23965096 CAGGGAAGGGACCCTCCTCCGGG - Intergenic
1179242232 21:39602376-39602398 CTCGGATGAGACCCAGCCACTGG - Intronic
1179624114 21:42638635-42638657 TCCGGGTGGGACCCTGTTCCCGG - Intergenic
1179852752 21:44146781-44146803 CTTGGCTGGGACTCAGCTCCGGG + Intergenic
1180084584 21:45502118-45502140 CTCGGGCTGGGCCCTGCTCCGGG - Intronic
1181019539 22:20092126-20092148 CTCAGATGGGGCGCGGCTCCAGG - Intronic
1183379921 22:37485655-37485677 CCAGGCTGGGCCCCTGCTCCAGG - Intronic
1185081835 22:48713797-48713819 CTGGGATGGGCCCCTCCTCCAGG - Intronic
954700516 3:52448324-52448346 CTTGGATTGGTTCCTGCTCCAGG + Intergenic
957040681 3:75333290-75333312 CTCGAAAGGCACCCTGCTCTAGG + Intergenic
961462758 3:127063102-127063124 CTGGGAGGGGAGCCTGCGCCAGG - Intergenic
961628594 3:128280544-128280566 CTGGAATGGGCCCCTCCTCCTGG + Intronic
963316917 3:143769275-143769297 CTCGCCTGGGACCCTGCTCTGGG + Intronic
968100174 3:195958956-195958978 CCCACATGGGACCCAGCTCCCGG + Intergenic
968258463 3:197299128-197299150 GCCGGCTGGGACCCCGCTCCCGG + Intronic
972447474 4:39158942-39158964 CCTGGATTGGATCCTGCTCCAGG - Intergenic
986939995 5:12937713-12937735 CAGGGAAGGGACCCTCCTCCAGG + Intergenic
987631183 5:20474451-20474473 TACACATGGGACCCTGCTCCCGG + Intronic
994164419 5:96593801-96593823 CTCTGATGCGGGCCTGCTCCTGG - Intronic
998684668 5:144510127-144510149 CCAAGATGGTACCCTGCTCCAGG - Intergenic
1003870610 6:10399642-10399664 CTTGGGTGGGACCCTGTTTCTGG - Intronic
1006147074 6:31966031-31966053 CTCGGCAGGGCCCCAGCTCCAGG + Intronic
1007393966 6:41566751-41566773 CTCTGATTTGACTCTGCTCCTGG + Intronic
1007851261 6:44804728-44804750 CTCTGAGTGGACCTTGCTCCTGG + Intergenic
1009023306 6:57968420-57968442 TTTGGATGGGATCTTGCTCCTGG + Intergenic
1009198876 6:60719953-60719975 TTTGGATGGGATCTTGCTCCTGG + Intergenic
1009908880 6:69902721-69902743 CAGGGAAGGGACCCTCCTCCAGG - Intronic
1010372876 6:75132001-75132023 GTTCGCTGGGACCCTGCTCCAGG - Exonic
1015522454 6:134145438-134145460 CTGGGAAGGGACCCTAGTCCAGG + Intergenic
1027225941 7:76243730-76243752 CTGGCATGGGACCCTGGGCCAGG - Intronic
1027797657 7:82714650-82714672 CTGATATGGGGCCCTGCTCCTGG + Intergenic
1029472815 7:100765255-100765277 TTCGGAAGGGCCCCAGCTCCAGG - Intronic
1031012231 7:116536504-116536526 CTCTGCTGGGACCCTGTTCCTGG - Intronic
1034502296 7:151458690-151458712 CTCAGAGGGGAATCTGCTCCAGG + Intergenic
1034524174 7:151645398-151645420 TTCGGATGAGACCCTGGTCCTGG + Intronic
1035047479 7:155978155-155978177 CTCGCAGGGCAGCCTGCTCCAGG - Intergenic
1040037113 8:42881379-42881401 ACCTGATGGGCCCCTGCTCCTGG - Intronic
1044306448 8:90645875-90645897 CCCGGGCGGGATCCTGCTCCAGG - Exonic
1045502521 8:102754234-102754256 CTCGGATGGGAGTCAGCCCCAGG + Intergenic
1049545431 8:143228585-143228607 CTGTGGTCGGACCCTGCTCCTGG + Intergenic
1049661381 8:143821117-143821139 CTCCCTTGGGGCCCTGCTCCAGG - Intronic
1049708523 8:144053547-144053569 CTCAGAGGGGACCCTGAGCCAGG - Intronic
1054172713 9:61856027-61856049 CTCGGATTCGCCCCTGTTCCTGG + Intergenic
1054664827 9:67724774-67724796 CTCGGATTCGCCCCTGTTCCTGG - Intergenic
1056507827 9:87274161-87274183 CTGGGATGAGCCACTGCTCCTGG + Intergenic
1057708175 9:97412470-97412492 CTCTGAAGGGACCCTGCTCCGGG + Intronic
1062208923 9:135352794-135352816 GTCAGATGGGGCCCTTCTCCTGG + Intergenic
1203519386 Un_GL000213v1:32339-32361 CTCTGCAGGGCCCCTGCTCCTGG + Intergenic
1199553083 X:149078519-149078541 CAGGGAAGGGACCCTCCTCCAGG + Intergenic