ID: 1125743286

View in Genome Browser
Species Human (GRCh38)
Location 15:41982365-41982387
Sequence ATTGCTTCCTAATGAATCTC TGG (reversed)
Strand -
Crispr in exon? Yes
Crispr in intron? No
Off-Target Counts All Exonic Intronic Intergenic
Total 174
Summary {0: 1, 1: 0, 2: 1, 3: 15, 4: 157}

Found 2 Related Crispr Pairs

ID Spacer Status Summary ID Location Sequence Summary
1125743286_1125743291 6 Left 1125743286 15:41982365-41982387 CCAGAGATTCATTAGGAAGCAAT 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1125743291 15:41982394-41982416 GGGCGGGCTTCTTCCTCTGACGG 0: 1
1: 0
2: 0
3: 8
4: 97
1125743286_1125743290 -10 Left 1125743286 15:41982365-41982387 CCAGAGATTCATTAGGAAGCAAT 0: 1
1: 0
2: 1
3: 15
4: 157
Right 1125743290 15:41982378-41982400 AGGAAGCAATCTTAAAGGGCGGG 0: 1
1: 0
2: 2
3: 15
4: 168

Off-Target Sites

Note: the row highlighted in blue is the original CRISPR

WGE ID Location Sequence Mismatches Strand Type
1125743286 Original CRISPR ATTGCTTCCTAATGAATCTC TGG (reversed) Exonic
900572913 1:3368207-3368229 ACTGCCTCCTAATGAATGTCAGG - Intronic
902973060 1:20069280-20069302 ATTGCTTCCTCATGATTATCAGG - Intronic
910242122 1:85098548-85098570 ATTGCTTCTTTATTACTCTCCGG - Exonic
910264312 1:85322494-85322516 AGTGCTTCCTAAAGAAGCACAGG - Intronic
911742867 1:101406368-101406390 ATTGCTCCTTAATGTATCTCTGG + Intergenic
914420956 1:147527971-147527993 GTTCCTGCCTAATGAATCCCTGG + Intergenic
914993637 1:152519854-152519876 ATTGCTGCCTAATTAATCTTAGG - Intronic
916002947 1:160634108-160634130 ATTGCTTAATAATGAAACACAGG - Intronic
918645526 1:186899725-186899747 ATTGCTTGCTAATGCTTCTGAGG - Intronic
919512952 1:198489253-198489275 ATTGCTTCTTAATACATGTCAGG - Intergenic
921591436 1:217009006-217009028 ACTGCTTCCAAATAAATTTCTGG - Intronic
924096132 1:240552710-240552732 ATTTATACCTAATGAATCTGAGG - Intronic
924484313 1:244465632-244465654 ATAGCTTTCTAATGAGTCTTCGG + Intronic
1062801104 10:381151-381173 GTTGCTGCCTAATTCATCTCAGG + Intronic
1063777577 10:9281606-9281628 ATGGCTACCTACAGAATCTCTGG - Intergenic
1065227561 10:23560322-23560344 ATTATTTCTTAATGAATCTGTGG - Intergenic
1065932965 10:30495598-30495620 ATGGATTTCTAATGAATGTCTGG + Intergenic
1068301384 10:55145809-55145831 AGTGATTTCTTATGAATCTCGGG - Intronic
1069461100 10:68595434-68595456 TTTTCTTCCAAATTAATCTCAGG - Intronic
1069858172 10:71453209-71453231 AATCCATCCTAATGAATCCCGGG - Intronic
1071811919 10:89191442-89191464 ATTGCTTCCATATGAATTTTAGG + Intergenic
1072552716 10:96491510-96491532 AGTGTTTCCTTATGAAGCTCTGG + Intronic
1072989431 10:100177213-100177235 ATAGTTTCCTATTTAATCTCTGG + Intronic
1083126919 11:60578682-60578704 TTTGTTTGCTAATGTATCTCAGG - Intergenic
1085949000 11:81306690-81306712 TTTTCTTCCAAATGTATCTCAGG + Intergenic
1086208992 11:84295526-84295548 ATTGATTCCTAGTGATTGTCTGG - Intronic
1086484054 11:87277889-87277911 CTTGCTTCTTAATGATACTCTGG + Intronic
1088257353 11:107913587-107913609 AGTGATTCTTAGTGAATCTCAGG - Intronic
1089941068 11:122418197-122418219 ATTCCTTCCTTCTGAGTCTCGGG - Intergenic
1091709705 12:2730539-2730561 ATTTCTTCCTAATGAAGTTTTGG + Intergenic
1097708716 12:62895472-62895494 TTTGCTTTCTAATGAGTCCCAGG - Intronic
1098659766 12:73076864-73076886 AATGGTTCCTATTGAATCACTGG - Intergenic
1100047439 12:90399798-90399820 ATTGGTTCATCATGAATCTTAGG - Intergenic
1100488799 12:95057670-95057692 TTTTCTTCCCAATGAAACTCAGG - Intronic
1100722072 12:97369786-97369808 AGTGATTCTTAGTGAATCTCAGG + Intergenic
1104611567 12:130233031-130233053 ATTTCTTCATAATCAATCCCTGG - Intergenic
1104690372 12:130821142-130821164 TTTGCTTCCTTTTGAATCTGAGG - Intronic
1106531609 13:30598324-30598346 ATTGCTTTAAAATGAGTCTCTGG - Intronic
1107115426 13:36741174-36741196 ATCCCTTCCTAGTTAATCTCAGG + Intergenic
1109250494 13:60014054-60014076 TTTGTTTCATAATGAATCTGAGG - Intronic
1111942688 13:94629351-94629373 AATGCTTCTTAATAAAGCTCTGG - Exonic
1112102131 13:96200699-96200721 TTTGCTCGCTAATGTATCTCAGG + Intronic
1115222230 14:31069450-31069472 ATTGCTTCCAAAAAAATCTTGGG + Intronic
1115862756 14:37707238-37707260 ATTGCTTTCTAATTAATTTTTGG + Intronic
1120328494 14:83057791-83057813 ACTGCTTCCTAATGATTTTATGG - Intergenic
1121943121 14:98092320-98092342 TTTGCTTCCTCCTGAATATCGGG - Intergenic
1124463739 15:29917789-29917811 TTTGCTTCCTAGTGACTCACTGG + Intronic
1125743286 15:41982365-41982387 ATTGCTTCCTAATGAATCTCTGG - Exonic
1127648975 15:60987772-60987794 ATTGCTTCCTCAGGACTCTTTGG - Intronic
1131130096 15:89893504-89893526 ATTTCTTCCTCATGAAACTGTGG + Intronic
1131236573 15:90702063-90702085 ATTGCCTCCTATTGTTTCTCTGG - Intergenic
1133360112 16:5167518-5167540 TGTGCGTCCTAATAAATCTCGGG + Intergenic
1134030627 16:10989685-10989707 ATGGTTTCCAGATGAATCTCTGG + Intronic
1135387346 16:22054548-22054570 ATTGTTTACTAAGGAGTCTCTGG + Intronic
1138207134 16:55133354-55133376 CTCGCTTCTGAATGAATCTCTGG - Intergenic
1139266794 16:65647542-65647564 GTGGCTTCCTAATGAAGTTCTGG - Intergenic
1140195130 16:72849049-72849071 TTTTCTTCCTAATGAAGCCCGGG + Intronic
1140218978 16:73029943-73029965 AATCCTTCCTAATGTATCTTGGG + Intronic
1140259072 16:73361771-73361793 ATTGCTTCCTACTGCAACTTTGG + Intergenic
1143589898 17:7877061-7877083 AATAATTCCTCATGAATCTCTGG - Intronic
1144404341 17:14938354-14938376 ATTCCTGCCTAATGATTTTCTGG - Intergenic
1144418529 17:15074173-15074195 ATTTCTTCCTTCTGAACCTCAGG - Intergenic
1146240581 17:31219092-31219114 ATTGCTTCCTGAGCAATCTCTGG - Exonic
1146323498 17:31865786-31865808 ATTTCTTCCTTTTGAATATCTGG + Intronic
1149305200 17:55340552-55340574 ATTGCTTCCCAAGGCATCTTAGG - Intergenic
1153066510 18:1051345-1051367 ATTTCTTCCTAATATTTCTCAGG + Intergenic
1153589011 18:6653844-6653866 ACTGCTGCTGAATGAATCTCTGG - Intergenic
1153995383 18:10436151-10436173 TTTGCTTCCTACTGAATATTGGG - Intergenic
1156545694 18:37961568-37961590 AGTGCTCCCTGATCAATCTCTGG + Intergenic
1156774955 18:40776026-40776048 CTTGCTTCCAAATGTCTCTCAGG - Intergenic
1157779397 18:50424026-50424048 ATCTCTTCCTAATCACTCTCAGG - Intergenic
1158253731 18:55520763-55520785 ATTCCTGCCTAATGAATGGCAGG - Intronic
1160400860 18:78610516-78610538 ATTTCTTCCTCCTGACTCTCAGG + Intergenic
925146328 2:1585585-1585607 CCTGTTTCCTAATGAATCTCCGG + Intergenic
925263138 2:2545473-2545495 ATTGCTGCCTAAGGAGTTTCAGG - Intergenic
926072613 2:9911167-9911189 ATTGCTACCTAAAGAATAACAGG - Intronic
926371608 2:12184548-12184570 TTTGCTCACTAATAAATCTCAGG - Intergenic
926835405 2:17013694-17013716 ATTGTTTCCTAATAAGTCACTGG - Intergenic
926972961 2:18485125-18485147 CTTGCTCCCTAATGAAACTATGG + Intergenic
928228630 2:29476868-29476890 ATTTGTTACTAATGACTCTCTGG + Intronic
930977354 2:57479418-57479440 ATTGCTTTGTAATAAATCACTGG - Intergenic
933225973 2:79750138-79750160 ATTTCTTCATATTGAAGCTCTGG + Intronic
935272070 2:101443430-101443452 ATTGGTTCCTAATGTATATATGG + Intronic
936110798 2:109662867-109662889 ATGGCTTCCTAATGATCCCCTGG + Intergenic
938096192 2:128465717-128465739 CCTGCTGCCTGATGAATCTCTGG + Intergenic
941347077 2:164383174-164383196 AATTCTTCCTAATTAATCTGTGG + Intergenic
941587294 2:167376547-167376569 ATTTCTTCCTAACTAATCTTGGG + Intergenic
942525636 2:176849922-176849944 ACTACTTCCTAATGAATTTCAGG - Intergenic
944489055 2:200238538-200238560 ATGGCTTCCTAATGCATCCTAGG + Intergenic
945232351 2:207605862-207605884 ATTGTTTCCTAATGATTATTAGG + Intronic
948112772 2:235470293-235470315 ATTGCTTCCTAAAAATACTCAGG + Intergenic
1170074019 20:12399451-12399473 ATTGCTTCTGAATGAATCTGAGG + Intergenic
1172978170 20:38921732-38921754 TTTGCTGCCAAATGCATCTCAGG + Exonic
1177802663 21:25843127-25843149 TCTGCTGCCTGATGAATCTCTGG + Intergenic
1179137375 21:38692031-38692053 TTTTCTTCCTGATGTATCTCAGG - Intergenic
1182756890 22:32687565-32687587 ATAGCTTCCTAACTACTCTCTGG + Intronic
1184699306 22:46159500-46159522 ATTGCTTGCTTGTGAATCACAGG - Intronic
949208451 3:1469028-1469050 ATTCCCTGCTAATGAACCTCGGG - Intergenic
949646650 3:6102836-6102858 ATTGATTCCTAATAGATCTTTGG + Intergenic
956128496 3:66033502-66033524 TTTGGTTTCTCATGAATCTCTGG - Intronic
956402238 3:68892746-68892768 ATTCCTTCCTAATGGATATATGG + Intronic
957518355 3:81286087-81286109 ATTTCTTTATAATGCATCTCTGG - Intergenic
957832202 3:85536271-85536293 TCTCCTTCCTAACGAATCTCAGG - Intronic
959944632 3:112113860-112113882 ATTGCTTTGTAGTGAAGCTCTGG + Intronic
960533535 3:118792341-118792363 TTTGCTTTGTAATGAATCTTAGG + Intergenic
963934304 3:151036507-151036529 ATAGCTTCCTAACTACTCTCAGG + Intergenic
964884886 3:161470651-161470673 ATTGCTTCTTCATCAATCTCTGG + Intergenic
966187407 3:177240550-177240572 AGTGCTTCCAAATGCATTTCAGG + Intergenic
969964938 4:10984436-10984458 AATGCTTCCCCATGACTCTCTGG - Intergenic
972234570 4:37116007-37116029 ATTGCTTCCCAGTGGATATCTGG + Intergenic
973626699 4:52779682-52779704 CTTTCTTCCTTATGAATCTGGGG + Intergenic
974953845 4:68614957-68614979 ATCTCCTCCTCATGAATCTCTGG - Intronic
978386130 4:108177190-108177212 GTTGCCTCCTAATGAGTCTCTGG + Intergenic
978959309 4:114656784-114656806 ATTGGTACCTGATGAATCTGAGG + Intronic
983312976 4:166088869-166088891 TTTTCTTCCTAATGAAACGCAGG - Intronic
984102626 4:175503409-175503431 ATTTCTTCTTCATGAATCCCTGG + Intergenic
989353916 5:40519424-40519446 TTTGCTTCCCCATAAATCTCTGG + Intergenic
989556147 5:42797726-42797748 ATTTCTTCCTAATAACTTTCTGG + Intronic
990504462 5:56430820-56430842 TTTGTTTCCCAATGAAGCTCAGG + Intergenic
991191869 5:63883961-63883983 ATTGCTTCCTAAGCCTTCTCTGG - Intergenic
991272268 5:64798070-64798092 ATTCCTTCCTCCTGCATCTCTGG - Intronic
993503882 5:88689580-88689602 AATGCTTCCTGATAAAGCTCTGG - Intergenic
993540171 5:89139463-89139485 TTTGGTTCCTTATGAATCTTGGG + Intergenic
993957145 5:94248211-94248233 TTTGCTTCTTAATGTATCTTTGG - Intronic
994267303 5:97733643-97733665 TTTGCTTCCTAATATGTCTCAGG + Intergenic
995000015 5:107115848-107115870 ATGGCTTCCTAATGAAATTTTGG - Intergenic
995107810 5:108395375-108395397 ATTGCTTCCTAAGCAATGCCGGG + Intergenic
995216820 5:109604896-109604918 TTTGCTGCTTAAAGAATCTCAGG + Intergenic
995810535 5:116102546-116102568 ATTGCTTCCATATGAATTTTAGG + Intronic
996484919 5:124021699-124021721 ATTGCTTACTAATGAAGCTTGGG + Intergenic
996621728 5:125513330-125513352 ATTGCTTTCTATTGACTGTCTGG + Intergenic
996756360 5:126939591-126939613 TTTTATTCCTGATGAATCTCTGG - Intronic
1000809956 5:165848984-165849006 ATCGCTTCCTAATGAACCACAGG + Intergenic
1001445967 5:171783550-171783572 ATTGATTCCAAATGAATCATGGG + Intergenic
1001851816 5:174974324-174974346 ACTTCTTCCTAATAAGTCTCAGG + Intergenic
1002050505 5:176568065-176568087 AGTCCTTGCTAATGAATATCGGG + Intronic
1003269465 6:4594530-4594552 ATTGCTTCCCAATGCAGCTGAGG + Intergenic
1007861500 6:44914506-44914528 ATTGATTCCTCATGAATCCAAGG - Intronic
1011665862 6:89632708-89632730 ATTGCAATCTAATGAGTCTCTGG - Exonic
1014105434 6:117555534-117555556 ATTGCTTCCTAAAGAATATGGGG + Intronic
1014795542 6:125720031-125720053 GTTGATCCCTAATGAATATCCGG + Intergenic
1015762199 6:136676174-136676196 CTTGCTGACCAATGAATCTCCGG + Intronic
1016729898 6:147417887-147417909 ATAGCTTCCAAATGAAGCCCAGG - Intergenic
1018807281 6:167271077-167271099 CTTGCTGCCTAATGACTCCCAGG - Intergenic
1018807305 6:167271232-167271254 CTTGCTGCCTAATGACTCCCAGG - Intronic
1024548821 7:50543553-50543575 CTTGCTTCCTAATGTATATGAGG + Intronic
1024872236 7:53977504-53977526 ATTGCCTCCTTATTAATCTTTGG + Intergenic
1025604530 7:63029923-63029945 ATTGTTTCTAAATGAATGTCTGG + Intergenic
1026192024 7:68137479-68137501 ATTGCTTGAAAATGAATTTCAGG + Intergenic
1027826982 7:83127848-83127870 ATTGCTTACTAATGATTAGCAGG + Intronic
1030308440 7:108044025-108044047 ATTCCTTGCAAATGAATCTATGG - Intronic
1031562141 7:123251234-123251256 ACAGCATCCTCATGAATCTCAGG - Intergenic
1032143373 7:129355053-129355075 TTTGCTTCTTAATGCATGTCAGG - Intronic
1033246084 7:139717354-139717376 GTTGCTTTCTACTGAAACTCAGG + Intronic
1036780444 8:11643241-11643263 ATTGTTTCTAAATGAATGTCTGG - Intergenic
1037380102 8:18275961-18275983 ATTTCTTCCTGATGAATATAAGG + Intergenic
1038912200 8:31978068-31978090 ATGGATTCCTAATGAATTCCTGG + Intronic
1041284286 8:56244422-56244444 AGTGTTTCCTCCTGAATCTCTGG - Intergenic
1041643359 8:60226522-60226544 ATTGACCCCTAATAAATCTCTGG + Intronic
1042759173 8:72252278-72252300 ATTAAGTCCTCATGAATCTCAGG + Intergenic
1043232284 8:77818214-77818236 ATTGCTTCCTTATGTATCTCAGG - Intergenic
1045186930 8:99847762-99847784 GTTGCTTCCAAATAACTCTCTGG + Intronic
1045254882 8:100511010-100511032 AATGCTTCCTAATGCAGCACAGG + Intronic
1045559849 8:103250622-103250644 ATTGCTTCCTAATCAAATTCTGG + Intergenic
1047337952 8:123954216-123954238 TTTCCATCCTAATGTATCTCAGG + Intronic
1047619248 8:126589488-126589510 CCTGCTTTCTAATGTATCTCTGG + Intergenic
1050728473 9:8679162-8679184 GTCGCTTCCTACTGAATTTCTGG + Intronic
1051793374 9:20834631-20834653 ATTCCTTCCTTATGAACTTCAGG + Intronic
1057945046 9:99319149-99319171 ACTGCATCCTAAAGAAACTCTGG - Intergenic
1058038804 9:100282249-100282271 CTTGCATCCGTATGAATCTCAGG + Intronic
1058808567 9:108617146-108617168 ATTGCTTCCTATTTATTCTCAGG + Intergenic
1191685389 X:63884665-63884687 ACTCCTTCCTGAAGAATCTCTGG - Intergenic
1193619706 X:83737121-83737143 ATAGCTCCCTAATGACTCCCCGG + Intergenic
1199843968 X:151677393-151677415 CACGCTTCCTAAAGAATCTCTGG - Intergenic